Multiple sequence alignment - TraesCS6B01G019800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G019800 chr6B 100.000 2448 0 0 1 2448 11989710 11987263 0 4521
1 TraesCS6B01G019800 chr6B 96.843 2471 53 4 3 2448 663151554 663149084 0 4108
2 TraesCS6B01G019800 chr5B 97.329 2471 40 5 3 2448 494655857 494658326 0 4174
3 TraesCS6B01G019800 chr5B 97.208 2471 44 4 3 2448 41406863 41404393 0 4157
4 TraesCS6B01G019800 chr5B 96.926 2472 49 6 3 2448 660354743 660352273 0 4119
5 TraesCS6B01G019800 chr5B 96.885 2472 48 7 3 2448 494664106 494661638 0 4111
6 TraesCS6B01G019800 chr5B 96.768 2135 42 6 1 2110 537916712 537914580 0 3535
7 TraesCS6B01G019800 chr4B 97.128 2472 45 5 3 2448 57126066 57123595 0 4148
8 TraesCS6B01G019800 chr4B 96.520 2471 59 12 3 2448 574590072 574592540 0 4061
9 TraesCS6B01G019800 chr2B 97.194 2459 44 4 3 2436 50469412 50471870 0 4135
10 TraesCS6B01G019800 chr2B 97.006 2472 45 7 3 2448 66032265 66029797 0 4128
11 TraesCS6B01G019800 chr2B 96.324 2013 45 7 3 1988 82066845 82064835 0 3280
12 TraesCS6B01G019800 chr2B 96.695 1967 37 13 507 2448 786813144 786815107 0 3247


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G019800 chr6B 11987263 11989710 2447 True 4521 4521 100.000 1 2448 1 chr6B.!!$R1 2447
1 TraesCS6B01G019800 chr6B 663149084 663151554 2470 True 4108 4108 96.843 3 2448 1 chr6B.!!$R2 2445
2 TraesCS6B01G019800 chr5B 494655857 494658326 2469 False 4174 4174 97.329 3 2448 1 chr5B.!!$F1 2445
3 TraesCS6B01G019800 chr5B 41404393 41406863 2470 True 4157 4157 97.208 3 2448 1 chr5B.!!$R1 2445
4 TraesCS6B01G019800 chr5B 660352273 660354743 2470 True 4119 4119 96.926 3 2448 1 chr5B.!!$R4 2445
5 TraesCS6B01G019800 chr5B 494661638 494664106 2468 True 4111 4111 96.885 3 2448 1 chr5B.!!$R2 2445
6 TraesCS6B01G019800 chr5B 537914580 537916712 2132 True 3535 3535 96.768 1 2110 1 chr5B.!!$R3 2109
7 TraesCS6B01G019800 chr4B 57123595 57126066 2471 True 4148 4148 97.128 3 2448 1 chr4B.!!$R1 2445
8 TraesCS6B01G019800 chr4B 574590072 574592540 2468 False 4061 4061 96.520 3 2448 1 chr4B.!!$F1 2445
9 TraesCS6B01G019800 chr2B 50469412 50471870 2458 False 4135 4135 97.194 3 2436 1 chr2B.!!$F1 2433
10 TraesCS6B01G019800 chr2B 66029797 66032265 2468 True 4128 4128 97.006 3 2448 1 chr2B.!!$R1 2445
11 TraesCS6B01G019800 chr2B 82064835 82066845 2010 True 3280 3280 96.324 3 1988 1 chr2B.!!$R2 1985
12 TraesCS6B01G019800 chr2B 786813144 786815107 1963 False 3247 3247 96.695 507 2448 1 chr2B.!!$F2 1941

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
112 113 1.258676 GTCGTCTTCTCCTGTTCCCT 58.741 55.0 0.0 0.0 0.00 4.20 F
390 391 1.456296 TGCCTTCGCTACTTCGTCTA 58.544 50.0 0.0 0.0 35.36 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1346 1352 0.398696 TGTCACAAACGGGCAGGTAT 59.601 50.0 0.0 0.0 0.00 2.73 R
2073 2107 2.171448 CCTAATGGAGCACTTGGTAGCT 59.829 50.0 0.0 0.0 45.25 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 113 1.258676 GTCGTCTTCTCCTGTTCCCT 58.741 55.000 0.00 0.00 0.00 4.20
356 357 4.473520 TGCGGGCTAGGAGCTTGC 62.474 66.667 0.00 3.81 41.99 4.01
390 391 1.456296 TGCCTTCGCTACTTCGTCTA 58.544 50.000 0.00 0.00 35.36 2.59
411 412 1.808411 GCCAACGAGATCAAGTCCAA 58.192 50.000 0.00 0.00 0.00 3.53
739 740 3.235369 GGCCACTCCCTCTCCATC 58.765 66.667 0.00 0.00 0.00 3.51
1365 1372 0.398696 ATACCTGCCCGTTTGTGACA 59.601 50.000 0.00 0.00 0.00 3.58
1667 1676 9.683069 CCAATAAAAGGAATCGATTGATTTAGG 57.317 33.333 16.96 11.42 44.79 2.69
2073 2107 5.593502 ACCGGACAAAAATAAACTGTACCAA 59.406 36.000 9.46 0.00 0.00 3.67
2298 2332 1.747355 CATCTTCCTCCTGCGCATTTT 59.253 47.619 12.24 0.00 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 113 4.476410 CAGTAGCGACGCGGCTCA 62.476 66.667 11.76 0.00 43.54 4.26
356 357 2.279784 GCATTCGGAGCTCCTCGG 60.280 66.667 29.73 15.15 33.08 4.63
390 391 0.389948 GGACTTGATCTCGTTGGCGT 60.390 55.000 0.00 0.00 39.49 5.68
411 412 3.310860 GAAGTCGATGCGGGGGTGT 62.311 63.158 0.00 0.00 0.00 4.16
492 493 2.124560 CCTAGGGGAAGACATGGGAT 57.875 55.000 0.00 0.00 33.58 3.85
739 740 4.875713 GGTGTAGCGGGCATGGGG 62.876 72.222 0.00 0.00 0.00 4.96
1195 1199 4.617253 TTTTTGAACTGAGATCTCCGGA 57.383 40.909 20.03 2.93 0.00 5.14
1346 1352 0.398696 TGTCACAAACGGGCAGGTAT 59.601 50.000 0.00 0.00 0.00 2.73
1365 1372 6.899393 TTGCAAACTTTCCTAATCAGACAT 57.101 33.333 0.00 0.00 0.00 3.06
2073 2107 2.171448 CCTAATGGAGCACTTGGTAGCT 59.829 50.000 0.00 0.00 45.25 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.