Multiple sequence alignment - TraesCS6B01G012900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G012900 chr6B 100.000 7951 0 0 1 7951 8130270 8122320 0.000000e+00 14683.0
1 TraesCS6B01G012900 chr6B 95.679 162 7 0 7078 7239 450150582 450150743 2.200000e-65 261.0
2 TraesCS6B01G012900 chr2D 96.273 161 6 0 7079 7239 624881946 624881786 1.700000e-66 265.0
3 TraesCS6B01G012900 chrUn 95.706 163 6 1 7079 7240 141680907 141680745 2.200000e-65 261.0
4 TraesCS6B01G012900 chr4B 95.152 165 8 0 7075 7239 517213608 517213772 2.200000e-65 261.0
5 TraesCS6B01G012900 chr4B 80.000 235 32 8 7375 7594 317763534 317763300 8.260000e-35 159.0
6 TraesCS6B01G012900 chr5B 94.611 167 8 1 7075 7240 45271441 45271607 2.850000e-64 257.0
7 TraesCS6B01G012900 chr4D 94.611 167 8 1 7075 7240 12520136 12520302 2.850000e-64 257.0
8 TraesCS6B01G012900 chr4D 83.186 113 11 2 7375 7479 212159145 212159257 6.570000e-16 97.1
9 TraesCS6B01G012900 chr4A 94.118 170 8 2 7072 7240 517406465 517406633 2.850000e-64 257.0
10 TraesCS6B01G012900 chr7B 92.308 182 11 3 7076 7256 114143322 114143501 1.020000e-63 255.0
11 TraesCS6B01G012900 chr1B 76.517 511 93 15 4127 4624 12701195 12701691 3.680000e-63 254.0
12 TraesCS6B01G012900 chr7A 92.982 171 10 2 7071 7239 689378290 689378120 1.710000e-61 248.0
13 TraesCS6B01G012900 chr7A 100.000 30 0 0 7530 7559 646487982 646487953 1.000000e-03 56.5
14 TraesCS6B01G012900 chr1D 75.977 512 101 13 4127 4624 9344034 9343531 2.220000e-60 244.0
15 TraesCS6B01G012900 chr1D 76.955 243 37 11 7360 7586 443815792 443815553 3.900000e-23 121.0
16 TraesCS6B01G012900 chr1A 80.455 220 38 4 4126 4341 50734597 50734815 6.380000e-36 163.0
17 TraesCS6B01G012900 chr2A 84.000 175 15 9 7434 7598 82055432 82055261 1.070000e-33 156.0
18 TraesCS6B01G012900 chr7D 80.741 135 16 3 7360 7485 3188728 3188595 6.570000e-16 97.1
19 TraesCS6B01G012900 chr7D 100.000 30 0 0 7530 7559 561707719 561707690 1.000000e-03 56.5
20 TraesCS6B01G012900 chr2B 82.051 117 12 8 7488 7598 133682344 133682231 3.060000e-14 91.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G012900 chr6B 8122320 8130270 7950 True 14683 14683 100.000 1 7951 1 chr6B.!!$R1 7950
1 TraesCS6B01G012900 chr1D 9343531 9344034 503 True 244 244 75.977 4127 4624 1 chr1D.!!$R1 497


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
281 282 0.029167 CAATTGTGTGCGCTGTCACA 59.971 50.0 22.06 22.06 43.93 3.58 F
964 965 0.031449 GATCGACTACAGCCTGCCTC 59.969 60.0 0.00 0.00 0.00 4.70 F
1732 1733 0.033208 TGGGGGAGATGCAATGGTTC 60.033 55.0 0.00 0.00 0.00 3.62 F
2631 2632 0.035152 ATTGCATCCTTCGCCTCACA 60.035 50.0 0.00 0.00 0.00 3.58 F
2796 2797 0.035152 AAGCATGATCCGCAGACCAA 60.035 50.0 0.00 0.00 0.00 3.67 F
3857 3858 0.035176 GGTTGCCAACATGTGCCAAT 59.965 50.0 10.18 0.00 0.00 3.16 F
4804 4811 0.029035 GCTTCCATGCTTCATCGCAG 59.971 55.0 0.00 0.00 44.10 5.18 F
5713 5720 0.035056 GGTTGCCATGGCTAGTCACT 60.035 55.0 35.53 0.00 42.51 3.41 F
5715 5722 0.035152 TTGCCATGGCTAGTCACTGG 60.035 55.0 35.53 16.82 42.51 4.00 F
6825 6832 0.035152 TGCAGGCCAGAATGACGATT 60.035 50.0 5.01 0.00 39.69 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1713 1714 0.033208 GAACCATTGCATCTCCCCCA 60.033 55.0 0.00 0.0 0.00 4.96 R
2612 2613 0.035152 TGTGAGGCGAAGGATGCAAT 60.035 50.0 0.00 0.0 0.00 3.56 R
3059 3060 0.034186 GGATGGTGTCCAGATGGCAA 60.034 55.0 0.00 0.0 46.96 4.52 R
3832 3833 0.039618 ACATGTTGGCAACCCCTAGG 59.960 55.0 26.31 12.6 40.04 3.02 R
4785 4792 0.029035 CTGCGATGAAGCATGGAAGC 59.971 55.0 0.00 0.0 46.97 3.86 R
5694 5701 0.035056 AGTGACTAGCCATGGCAACC 60.035 55.0 37.18 22.4 44.88 3.77 R
6098 6105 0.034198 TCCGACATTCTGCCGACAAA 59.966 50.0 0.00 0.0 0.00 2.83 R
6806 6813 0.035152 AATCGTCATTCTGGCCTGCA 60.035 50.0 3.32 0.0 0.00 4.41 R
6835 6842 0.097674 GATGCACGCAGGATCACAAC 59.902 55.0 0.00 0.0 43.85 3.32 R
7836 7843 0.111061 TTGCAGTTGGAGATGGCTGT 59.889 50.0 0.00 0.0 0.00 4.40 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 6.272698 CACAAGGCACAATACAAACTTTTC 57.727 37.500 0.00 0.00 0.00 2.29
24 25 5.809562 CACAAGGCACAATACAAACTTTTCA 59.190 36.000 0.00 0.00 0.00 2.69
25 26 6.479660 CACAAGGCACAATACAAACTTTTCAT 59.520 34.615 0.00 0.00 0.00 2.57
26 27 6.479660 ACAAGGCACAATACAAACTTTTCATG 59.520 34.615 0.00 0.00 0.00 3.07
27 28 5.540911 AGGCACAATACAAACTTTTCATGG 58.459 37.500 0.00 0.00 0.00 3.66
28 29 4.152223 GGCACAATACAAACTTTTCATGGC 59.848 41.667 0.00 0.00 0.00 4.40
29 30 4.749099 GCACAATACAAACTTTTCATGGCA 59.251 37.500 0.00 0.00 0.00 4.92
30 31 5.107375 GCACAATACAAACTTTTCATGGCAG 60.107 40.000 0.00 0.00 0.00 4.85
31 32 4.990426 ACAATACAAACTTTTCATGGCAGC 59.010 37.500 0.00 0.00 0.00 5.25
32 33 4.870123 ATACAAACTTTTCATGGCAGCA 57.130 36.364 0.00 0.00 0.00 4.41
33 34 2.825205 ACAAACTTTTCATGGCAGCAC 58.175 42.857 0.00 0.00 0.00 4.40
34 35 1.788308 CAAACTTTTCATGGCAGCACG 59.212 47.619 0.00 0.00 0.00 5.34
35 36 0.314935 AACTTTTCATGGCAGCACGG 59.685 50.000 0.00 0.00 0.00 4.94
36 37 1.213537 CTTTTCATGGCAGCACGGG 59.786 57.895 0.00 0.00 0.00 5.28
37 38 1.228398 TTTTCATGGCAGCACGGGA 60.228 52.632 0.00 0.00 0.00 5.14
38 39 0.825425 TTTTCATGGCAGCACGGGAA 60.825 50.000 0.00 0.00 0.00 3.97
39 40 1.523154 TTTCATGGCAGCACGGGAAC 61.523 55.000 0.00 0.00 0.00 3.62
40 41 2.672651 CATGGCAGCACGGGAACA 60.673 61.111 0.00 0.00 0.00 3.18
41 42 2.115052 ATGGCAGCACGGGAACAA 59.885 55.556 0.00 0.00 0.00 2.83
42 43 1.973281 ATGGCAGCACGGGAACAAG 60.973 57.895 0.00 0.00 0.00 3.16
43 44 3.365265 GGCAGCACGGGAACAAGG 61.365 66.667 0.00 0.00 0.00 3.61
44 45 2.594592 GCAGCACGGGAACAAGGT 60.595 61.111 0.00 0.00 0.00 3.50
45 46 2.193536 GCAGCACGGGAACAAGGTT 61.194 57.895 0.00 0.00 0.00 3.50
46 47 1.734388 GCAGCACGGGAACAAGGTTT 61.734 55.000 0.00 0.00 0.00 3.27
47 48 0.030638 CAGCACGGGAACAAGGTTTG 59.969 55.000 0.00 0.00 0.00 2.93
48 49 1.299850 GCACGGGAACAAGGTTTGC 60.300 57.895 0.00 0.00 0.00 3.68
49 50 1.008995 CACGGGAACAAGGTTTGCG 60.009 57.895 0.00 0.00 0.00 4.85
50 51 2.050442 CGGGAACAAGGTTTGCGC 60.050 61.111 0.00 0.00 0.00 6.09
51 52 2.338620 GGGAACAAGGTTTGCGCC 59.661 61.111 4.18 0.00 0.00 6.53
52 53 2.494530 GGGAACAAGGTTTGCGCCA 61.495 57.895 4.18 0.00 0.00 5.69
53 54 1.007387 GGAACAAGGTTTGCGCCAG 60.007 57.895 4.18 0.00 0.00 4.85
54 55 1.452145 GGAACAAGGTTTGCGCCAGA 61.452 55.000 4.18 0.00 0.00 3.86
55 56 0.383949 GAACAAGGTTTGCGCCAGAA 59.616 50.000 4.18 0.00 0.00 3.02
56 57 0.820871 AACAAGGTTTGCGCCAGAAA 59.179 45.000 4.18 0.00 0.00 2.52
57 58 0.385390 ACAAGGTTTGCGCCAGAAAG 59.615 50.000 4.18 0.00 0.00 2.62
58 59 0.318955 CAAGGTTTGCGCCAGAAAGG 60.319 55.000 4.18 0.00 41.84 3.11
69 70 2.260844 CCAGAAAGGCAAGACTGTGA 57.739 50.000 0.00 0.00 0.00 3.58
70 71 1.876156 CCAGAAAGGCAAGACTGTGAC 59.124 52.381 0.00 0.00 0.00 3.67
71 72 2.564771 CAGAAAGGCAAGACTGTGACA 58.435 47.619 0.00 0.00 0.00 3.58
72 73 2.547211 CAGAAAGGCAAGACTGTGACAG 59.453 50.000 11.70 11.70 37.52 3.51
74 75 2.717639 AAGGCAAGACTGTGACAGTT 57.282 45.000 20.42 7.11 45.44 3.16
75 76 3.838244 AAGGCAAGACTGTGACAGTTA 57.162 42.857 20.42 0.00 45.44 2.24
76 77 3.393089 AGGCAAGACTGTGACAGTTAG 57.607 47.619 20.42 13.23 45.44 2.34
77 78 1.801178 GGCAAGACTGTGACAGTTAGC 59.199 52.381 20.42 21.15 45.44 3.09
78 79 1.457303 GCAAGACTGTGACAGTTAGCG 59.543 52.381 20.42 9.92 45.44 4.26
79 80 2.061773 CAAGACTGTGACAGTTAGCGG 58.938 52.381 20.42 4.73 45.44 5.52
80 81 0.603569 AGACTGTGACAGTTAGCGGG 59.396 55.000 20.42 0.00 45.44 6.13
81 82 0.601558 GACTGTGACAGTTAGCGGGA 59.398 55.000 20.42 0.00 45.44 5.14
82 83 0.603569 ACTGTGACAGTTAGCGGGAG 59.396 55.000 13.33 0.00 42.59 4.30
83 84 0.888619 CTGTGACAGTTAGCGGGAGA 59.111 55.000 4.01 0.00 0.00 3.71
84 85 1.272490 CTGTGACAGTTAGCGGGAGAA 59.728 52.381 4.01 0.00 0.00 2.87
85 86 1.272490 TGTGACAGTTAGCGGGAGAAG 59.728 52.381 0.00 0.00 0.00 2.85
86 87 1.544691 GTGACAGTTAGCGGGAGAAGA 59.455 52.381 0.00 0.00 0.00 2.87
87 88 2.166664 GTGACAGTTAGCGGGAGAAGAT 59.833 50.000 0.00 0.00 0.00 2.40
88 89 2.166459 TGACAGTTAGCGGGAGAAGATG 59.834 50.000 0.00 0.00 0.00 2.90
89 90 2.427453 GACAGTTAGCGGGAGAAGATGA 59.573 50.000 0.00 0.00 0.00 2.92
90 91 2.166664 ACAGTTAGCGGGAGAAGATGAC 59.833 50.000 0.00 0.00 0.00 3.06
91 92 1.405821 AGTTAGCGGGAGAAGATGACG 59.594 52.381 0.00 0.00 0.00 4.35
93 94 2.956964 GCGGGAGAAGATGACGCG 60.957 66.667 3.53 3.53 40.84 6.01
94 95 2.278857 CGGGAGAAGATGACGCGG 60.279 66.667 12.47 0.00 36.59 6.46
95 96 2.893398 GGGAGAAGATGACGCGGT 59.107 61.111 12.47 0.00 0.00 5.68
96 97 1.519455 GGGAGAAGATGACGCGGTG 60.519 63.158 12.47 0.00 0.00 4.94
97 98 1.511305 GGAGAAGATGACGCGGTGA 59.489 57.895 12.47 0.00 0.00 4.02
98 99 0.802607 GGAGAAGATGACGCGGTGAC 60.803 60.000 12.47 0.00 0.00 3.67
116 117 3.345808 GCAGGCGCGACACTTCAA 61.346 61.111 17.71 0.00 0.00 2.69
117 118 2.892334 GCAGGCGCGACACTTCAAA 61.892 57.895 17.71 0.00 0.00 2.69
118 119 1.868997 CAGGCGCGACACTTCAAAT 59.131 52.632 17.71 0.00 0.00 2.32
119 120 1.075542 CAGGCGCGACACTTCAAATA 58.924 50.000 17.71 0.00 0.00 1.40
120 121 1.665679 CAGGCGCGACACTTCAAATAT 59.334 47.619 17.71 0.00 0.00 1.28
121 122 1.933853 AGGCGCGACACTTCAAATATC 59.066 47.619 17.71 0.00 0.00 1.63
122 123 1.663643 GGCGCGACACTTCAAATATCA 59.336 47.619 12.10 0.00 0.00 2.15
123 124 2.536928 GGCGCGACACTTCAAATATCAC 60.537 50.000 12.10 0.00 0.00 3.06
124 125 2.093625 GCGCGACACTTCAAATATCACA 59.906 45.455 12.10 0.00 0.00 3.58
125 126 3.659735 CGCGACACTTCAAATATCACAC 58.340 45.455 0.00 0.00 0.00 3.82
126 127 3.122780 CGCGACACTTCAAATATCACACA 59.877 43.478 0.00 0.00 0.00 3.72
127 128 4.394795 GCGACACTTCAAATATCACACAC 58.605 43.478 0.00 0.00 0.00 3.82
128 129 4.084066 GCGACACTTCAAATATCACACACA 60.084 41.667 0.00 0.00 0.00 3.72
129 130 5.559991 GCGACACTTCAAATATCACACACAA 60.560 40.000 0.00 0.00 0.00 3.33
130 131 6.602179 CGACACTTCAAATATCACACACAAT 58.398 36.000 0.00 0.00 0.00 2.71
131 132 7.077605 CGACACTTCAAATATCACACACAATT 58.922 34.615 0.00 0.00 0.00 2.32
132 133 7.059831 CGACACTTCAAATATCACACACAATTG 59.940 37.037 3.24 3.24 0.00 2.32
133 134 7.147312 ACACTTCAAATATCACACACAATTGG 58.853 34.615 10.83 1.35 0.00 3.16
134 135 7.147312 CACTTCAAATATCACACACAATTGGT 58.853 34.615 10.83 2.02 0.00 3.67
135 136 7.326789 CACTTCAAATATCACACACAATTGGTC 59.673 37.037 10.83 0.00 0.00 4.02
136 137 6.890979 TCAAATATCACACACAATTGGTCA 57.109 33.333 10.83 0.00 0.00 4.02
137 138 7.282332 TCAAATATCACACACAATTGGTCAA 57.718 32.000 10.83 0.00 0.00 3.18
138 139 7.720442 TCAAATATCACACACAATTGGTCAAA 58.280 30.769 10.83 0.00 0.00 2.69
139 140 7.866898 TCAAATATCACACACAATTGGTCAAAG 59.133 33.333 10.83 0.00 0.00 2.77
140 141 7.523293 AATATCACACACAATTGGTCAAAGA 57.477 32.000 10.83 1.07 0.00 2.52
141 142 5.850557 ATCACACACAATTGGTCAAAGAA 57.149 34.783 10.83 0.00 0.00 2.52
142 143 5.651387 TCACACACAATTGGTCAAAGAAA 57.349 34.783 10.83 0.00 0.00 2.52
143 144 6.030548 TCACACACAATTGGTCAAAGAAAA 57.969 33.333 10.83 0.00 0.00 2.29
144 145 5.866633 TCACACACAATTGGTCAAAGAAAAC 59.133 36.000 10.83 0.00 0.00 2.43
145 146 5.868801 CACACACAATTGGTCAAAGAAAACT 59.131 36.000 10.83 0.00 0.00 2.66
146 147 5.868801 ACACACAATTGGTCAAAGAAAACTG 59.131 36.000 10.83 0.00 0.00 3.16
147 148 5.868801 CACACAATTGGTCAAAGAAAACTGT 59.131 36.000 10.83 0.00 0.00 3.55
148 149 5.868801 ACACAATTGGTCAAAGAAAACTGTG 59.131 36.000 10.83 0.00 37.16 3.66
149 150 5.868801 CACAATTGGTCAAAGAAAACTGTGT 59.131 36.000 10.83 0.00 0.00 3.72
150 151 5.868801 ACAATTGGTCAAAGAAAACTGTGTG 59.131 36.000 10.83 0.00 0.00 3.82
151 152 3.502191 TGGTCAAAGAAAACTGTGTGC 57.498 42.857 0.00 0.00 0.00 4.57
152 153 2.165437 TGGTCAAAGAAAACTGTGTGCC 59.835 45.455 0.00 0.00 0.00 5.01
153 154 2.450160 GTCAAAGAAAACTGTGTGCCG 58.550 47.619 0.00 0.00 0.00 5.69
154 155 2.096819 GTCAAAGAAAACTGTGTGCCGA 59.903 45.455 0.00 0.00 0.00 5.54
155 156 2.750166 TCAAAGAAAACTGTGTGCCGAA 59.250 40.909 0.00 0.00 0.00 4.30
156 157 2.844122 AAGAAAACTGTGTGCCGAAC 57.156 45.000 0.00 0.00 0.00 3.95
157 158 2.038387 AGAAAACTGTGTGCCGAACT 57.962 45.000 0.00 0.00 0.00 3.01
158 159 3.188159 AGAAAACTGTGTGCCGAACTA 57.812 42.857 0.00 0.00 0.00 2.24
159 160 2.870411 AGAAAACTGTGTGCCGAACTAC 59.130 45.455 0.00 0.00 0.00 2.73
160 161 2.319136 AAACTGTGTGCCGAACTACA 57.681 45.000 0.00 0.00 0.00 2.74
161 162 1.578583 AACTGTGTGCCGAACTACAC 58.421 50.000 0.00 0.00 45.57 2.90
165 166 2.980562 TGTGCCGAACTACACACAC 58.019 52.632 0.00 0.00 41.67 3.82
166 167 0.872451 TGTGCCGAACTACACACACG 60.872 55.000 0.00 0.00 41.67 4.49
167 168 0.595567 GTGCCGAACTACACACACGA 60.596 55.000 0.00 0.00 36.77 4.35
168 169 0.315886 TGCCGAACTACACACACGAT 59.684 50.000 0.00 0.00 0.00 3.73
169 170 0.713883 GCCGAACTACACACACGATG 59.286 55.000 0.00 0.00 0.00 3.84
170 171 0.713883 CCGAACTACACACACGATGC 59.286 55.000 0.00 0.00 0.00 3.91
171 172 1.414378 CGAACTACACACACGATGCA 58.586 50.000 0.00 0.00 0.00 3.96
172 173 1.124297 CGAACTACACACACGATGCAC 59.876 52.381 0.00 0.00 0.00 4.57
173 174 2.404215 GAACTACACACACGATGCACT 58.596 47.619 0.00 0.00 0.00 4.40
174 175 2.526304 ACTACACACACGATGCACTT 57.474 45.000 0.00 0.00 0.00 3.16
175 176 2.404215 ACTACACACACGATGCACTTC 58.596 47.619 0.00 0.00 0.00 3.01
176 177 2.223947 ACTACACACACGATGCACTTCA 60.224 45.455 0.00 0.00 0.00 3.02
177 178 1.662517 ACACACACGATGCACTTCAA 58.337 45.000 0.00 0.00 0.00 2.69
178 179 2.013400 ACACACACGATGCACTTCAAA 58.987 42.857 0.00 0.00 0.00 2.69
179 180 2.032054 ACACACACGATGCACTTCAAAG 59.968 45.455 0.00 0.00 0.00 2.77
180 181 2.287644 CACACACGATGCACTTCAAAGA 59.712 45.455 0.00 0.00 0.00 2.52
181 182 2.942376 ACACACGATGCACTTCAAAGAA 59.058 40.909 0.00 0.00 0.00 2.52
182 183 3.376859 ACACACGATGCACTTCAAAGAAA 59.623 39.130 0.00 0.00 0.00 2.52
183 184 4.036734 ACACACGATGCACTTCAAAGAAAT 59.963 37.500 0.00 0.00 0.00 2.17
184 185 4.380678 CACACGATGCACTTCAAAGAAATG 59.619 41.667 0.00 0.00 0.00 2.32
185 186 4.036734 ACACGATGCACTTCAAAGAAATGT 59.963 37.500 0.00 0.00 0.00 2.71
186 187 4.380678 CACGATGCACTTCAAAGAAATGTG 59.619 41.667 0.00 0.00 0.00 3.21
187 188 4.036734 ACGATGCACTTCAAAGAAATGTGT 59.963 37.500 0.00 0.00 0.00 3.72
188 189 5.238432 ACGATGCACTTCAAAGAAATGTGTA 59.762 36.000 0.00 0.00 0.00 2.90
189 190 6.072508 ACGATGCACTTCAAAGAAATGTGTAT 60.073 34.615 0.00 0.00 36.85 2.29
190 191 6.249893 CGATGCACTTCAAAGAAATGTGTATG 59.750 38.462 0.00 0.00 34.96 2.39
191 192 6.631971 TGCACTTCAAAGAAATGTGTATGA 57.368 33.333 0.00 0.00 0.00 2.15
192 193 7.218228 TGCACTTCAAAGAAATGTGTATGAT 57.782 32.000 0.00 0.00 0.00 2.45
193 194 7.085746 TGCACTTCAAAGAAATGTGTATGATG 58.914 34.615 0.00 0.00 0.00 3.07
194 195 7.086376 GCACTTCAAAGAAATGTGTATGATGT 58.914 34.615 0.00 0.00 0.00 3.06
195 196 7.596248 GCACTTCAAAGAAATGTGTATGATGTT 59.404 33.333 0.00 0.00 0.00 2.71
196 197 9.467258 CACTTCAAAGAAATGTGTATGATGTTT 57.533 29.630 0.00 0.00 0.00 2.83
197 198 9.683069 ACTTCAAAGAAATGTGTATGATGTTTC 57.317 29.630 0.00 0.00 0.00 2.78
198 199 9.132521 CTTCAAAGAAATGTGTATGATGTTTCC 57.867 33.333 0.00 0.00 31.02 3.13
199 200 7.304735 TCAAAGAAATGTGTATGATGTTTCCG 58.695 34.615 0.00 0.00 31.02 4.30
200 201 7.174080 TCAAAGAAATGTGTATGATGTTTCCGA 59.826 33.333 0.00 0.00 31.02 4.55
201 202 7.630242 AAGAAATGTGTATGATGTTTCCGAT 57.370 32.000 0.00 0.00 31.02 4.18
202 203 7.251704 AGAAATGTGTATGATGTTTCCGATC 57.748 36.000 0.00 0.00 31.02 3.69
203 204 6.823182 AGAAATGTGTATGATGTTTCCGATCA 59.177 34.615 0.00 0.00 34.37 2.92
204 205 7.500227 AGAAATGTGTATGATGTTTCCGATCAT 59.500 33.333 0.00 0.00 42.13 2.45
205 206 6.791887 ATGTGTATGATGTTTCCGATCATC 57.208 37.500 0.00 0.00 40.35 2.92
206 207 4.744631 TGTGTATGATGTTTCCGATCATCG 59.255 41.667 0.00 0.00 42.05 3.84
207 208 3.740832 TGTATGATGTTTCCGATCATCGC 59.259 43.478 0.00 0.00 42.05 4.58
208 209 2.307934 TGATGTTTCCGATCATCGCA 57.692 45.000 0.00 0.00 42.05 5.10
209 210 1.933181 TGATGTTTCCGATCATCGCAC 59.067 47.619 0.00 0.00 42.05 5.34
210 211 0.930310 ATGTTTCCGATCATCGCACG 59.070 50.000 0.00 0.00 38.82 5.34
211 212 1.012234 GTTTCCGATCATCGCACGC 60.012 57.895 0.00 0.00 38.82 5.34
212 213 1.446966 TTTCCGATCATCGCACGCA 60.447 52.632 0.00 0.00 38.82 5.24
213 214 1.016653 TTTCCGATCATCGCACGCAA 61.017 50.000 0.00 0.00 38.82 4.85
214 215 0.809636 TTCCGATCATCGCACGCAAT 60.810 50.000 0.00 0.00 38.82 3.56
215 216 0.809636 TCCGATCATCGCACGCAATT 60.810 50.000 0.00 0.00 38.82 2.32
216 217 0.858583 CCGATCATCGCACGCAATTA 59.141 50.000 0.00 0.00 38.82 1.40
217 218 1.397190 CCGATCATCGCACGCAATTAC 60.397 52.381 0.00 0.00 38.82 1.89
218 219 1.522676 CGATCATCGCACGCAATTACT 59.477 47.619 0.00 0.00 31.14 2.24
219 220 2.033747 CGATCATCGCACGCAATTACTT 60.034 45.455 0.00 0.00 31.14 2.24
220 221 3.544048 CGATCATCGCACGCAATTACTTT 60.544 43.478 0.00 0.00 31.14 2.66
221 222 4.317769 CGATCATCGCACGCAATTACTTTA 60.318 41.667 0.00 0.00 31.14 1.85
222 223 4.930463 TCATCGCACGCAATTACTTTAA 57.070 36.364 0.00 0.00 0.00 1.52
223 224 5.478233 TCATCGCACGCAATTACTTTAAT 57.522 34.783 0.00 0.00 0.00 1.40
224 225 5.874831 TCATCGCACGCAATTACTTTAATT 58.125 33.333 0.00 0.00 38.84 1.40
225 226 5.963004 TCATCGCACGCAATTACTTTAATTC 59.037 36.000 0.00 0.00 36.29 2.17
226 227 5.284428 TCGCACGCAATTACTTTAATTCA 57.716 34.783 0.00 0.00 36.29 2.57
227 228 5.690816 TCGCACGCAATTACTTTAATTCAA 58.309 33.333 0.00 0.00 36.29 2.69
228 229 5.566016 TCGCACGCAATTACTTTAATTCAAC 59.434 36.000 0.00 0.00 36.29 3.18
229 230 5.219951 CGCACGCAATTACTTTAATTCAACC 60.220 40.000 0.00 0.00 36.29 3.77
230 231 5.219951 GCACGCAATTACTTTAATTCAACCG 60.220 40.000 0.00 0.00 36.29 4.44
231 232 5.854338 CACGCAATTACTTTAATTCAACCGT 59.146 36.000 0.00 0.00 36.29 4.83
232 233 5.854338 ACGCAATTACTTTAATTCAACCGTG 59.146 36.000 0.00 0.00 36.29 4.94
233 234 5.854338 CGCAATTACTTTAATTCAACCGTGT 59.146 36.000 0.00 0.00 36.29 4.49
234 235 6.183359 CGCAATTACTTTAATTCAACCGTGTG 60.183 38.462 0.00 0.00 36.29 3.82
235 236 6.399564 GCAATTACTTTAATTCAACCGTGTGC 60.400 38.462 0.00 0.00 36.29 4.57
236 237 3.636282 ACTTTAATTCAACCGTGTGCC 57.364 42.857 0.00 0.00 0.00 5.01
237 238 2.295070 ACTTTAATTCAACCGTGTGCCC 59.705 45.455 0.00 0.00 0.00 5.36
238 239 1.982660 TTAATTCAACCGTGTGCCCA 58.017 45.000 0.00 0.00 0.00 5.36
239 240 1.982660 TAATTCAACCGTGTGCCCAA 58.017 45.000 0.00 0.00 0.00 4.12
240 241 0.387565 AATTCAACCGTGTGCCCAAC 59.612 50.000 0.00 0.00 0.00 3.77
241 242 0.753479 ATTCAACCGTGTGCCCAACA 60.753 50.000 0.00 0.00 36.04 3.33
242 243 1.380403 TTCAACCGTGTGCCCAACAG 61.380 55.000 0.00 0.00 40.26 3.16
243 244 1.821759 CAACCGTGTGCCCAACAGA 60.822 57.895 0.00 0.00 40.26 3.41
244 245 1.525995 AACCGTGTGCCCAACAGAG 60.526 57.895 0.00 0.00 40.26 3.35
245 246 3.357079 CCGTGTGCCCAACAGAGC 61.357 66.667 0.00 0.00 40.26 4.09
246 247 2.591429 CGTGTGCCCAACAGAGCA 60.591 61.111 0.00 0.00 40.26 4.26
247 248 1.968017 CGTGTGCCCAACAGAGCAT 60.968 57.895 0.00 0.00 41.86 3.79
248 249 1.878775 GTGTGCCCAACAGAGCATC 59.121 57.895 0.00 0.00 41.86 3.91
249 250 1.303561 TGTGCCCAACAGAGCATCC 60.304 57.895 0.00 0.00 41.86 3.51
250 251 1.303561 GTGCCCAACAGAGCATCCA 60.304 57.895 0.00 0.00 41.86 3.41
251 252 0.895100 GTGCCCAACAGAGCATCCAA 60.895 55.000 0.00 0.00 41.86 3.53
252 253 0.040058 TGCCCAACAGAGCATCCAAT 59.960 50.000 0.00 0.00 33.66 3.16
253 254 0.743097 GCCCAACAGAGCATCCAATC 59.257 55.000 0.00 0.00 33.66 2.67
254 255 1.396653 CCCAACAGAGCATCCAATCC 58.603 55.000 0.00 0.00 33.66 3.01
255 256 1.064166 CCCAACAGAGCATCCAATCCT 60.064 52.381 0.00 0.00 33.66 3.24
256 257 2.295885 CCAACAGAGCATCCAATCCTC 58.704 52.381 0.00 0.00 33.66 3.71
257 258 2.295885 CAACAGAGCATCCAATCCTCC 58.704 52.381 0.00 0.00 33.66 4.30
258 259 0.842635 ACAGAGCATCCAATCCTCCC 59.157 55.000 0.00 0.00 33.66 4.30
259 260 0.841961 CAGAGCATCCAATCCTCCCA 59.158 55.000 0.00 0.00 33.66 4.37
260 261 0.842635 AGAGCATCCAATCCTCCCAC 59.157 55.000 0.00 0.00 33.66 4.61
261 262 0.548031 GAGCATCCAATCCTCCCACA 59.452 55.000 0.00 0.00 0.00 4.17
262 263 0.257039 AGCATCCAATCCTCCCACAC 59.743 55.000 0.00 0.00 0.00 3.82
263 264 0.034186 GCATCCAATCCTCCCACACA 60.034 55.000 0.00 0.00 0.00 3.72
264 265 1.616725 GCATCCAATCCTCCCACACAA 60.617 52.381 0.00 0.00 0.00 3.33
265 266 2.951787 GCATCCAATCCTCCCACACAAT 60.952 50.000 0.00 0.00 0.00 2.71
266 267 3.368248 CATCCAATCCTCCCACACAATT 58.632 45.455 0.00 0.00 0.00 2.32
267 268 2.806434 TCCAATCCTCCCACACAATTG 58.194 47.619 3.24 3.24 0.00 2.32
268 269 2.109834 TCCAATCCTCCCACACAATTGT 59.890 45.455 4.92 4.92 35.84 2.71
279 280 2.403024 ACAATTGTGTGCGCTGTCA 58.597 47.368 11.07 2.35 36.31 3.58
280 281 0.029300 ACAATTGTGTGCGCTGTCAC 59.971 50.000 11.07 15.53 36.31 3.67
281 282 0.029167 CAATTGTGTGCGCTGTCACA 59.971 50.000 22.06 22.06 43.93 3.58
285 286 4.217035 TGTGCGCTGTCACAAGTT 57.783 50.000 9.73 0.00 43.27 2.66
286 287 1.720894 TGTGCGCTGTCACAAGTTG 59.279 52.632 9.73 0.00 43.27 3.16
287 288 1.024046 TGTGCGCTGTCACAAGTTGT 61.024 50.000 9.73 1.64 43.27 3.32
288 289 0.098728 GTGCGCTGTCACAAGTTGTT 59.901 50.000 9.73 0.00 36.97 2.83
289 290 0.376852 TGCGCTGTCACAAGTTGTTC 59.623 50.000 9.73 3.48 0.00 3.18
290 291 0.657840 GCGCTGTCACAAGTTGTTCT 59.342 50.000 5.57 0.00 0.00 3.01
291 292 1.064060 GCGCTGTCACAAGTTGTTCTT 59.936 47.619 5.57 0.00 36.75 2.52
292 293 2.286833 GCGCTGTCACAAGTTGTTCTTA 59.713 45.455 5.57 0.00 34.66 2.10
293 294 3.844943 GCGCTGTCACAAGTTGTTCTTAC 60.845 47.826 5.57 3.45 34.66 2.34
294 295 3.308595 CGCTGTCACAAGTTGTTCTTACA 59.691 43.478 5.57 7.75 34.66 2.41
295 296 4.201773 CGCTGTCACAAGTTGTTCTTACAA 60.202 41.667 5.57 0.00 41.82 2.41
296 297 5.636837 GCTGTCACAAGTTGTTCTTACAAA 58.363 37.500 5.57 0.00 45.33 2.83
297 298 6.090129 GCTGTCACAAGTTGTTCTTACAAAA 58.910 36.000 5.57 0.00 45.33 2.44
298 299 6.751888 GCTGTCACAAGTTGTTCTTACAAAAT 59.248 34.615 5.57 0.00 45.33 1.82
299 300 7.044052 GCTGTCACAAGTTGTTCTTACAAAATC 60.044 37.037 5.57 0.00 45.33 2.17
300 301 7.821652 TGTCACAAGTTGTTCTTACAAAATCA 58.178 30.769 5.57 0.00 45.33 2.57
301 302 8.465999 TGTCACAAGTTGTTCTTACAAAATCAT 58.534 29.630 5.57 0.00 45.33 2.45
302 303 8.745837 GTCACAAGTTGTTCTTACAAAATCATG 58.254 33.333 5.57 0.00 45.33 3.07
303 304 8.465999 TCACAAGTTGTTCTTACAAAATCATGT 58.534 29.630 5.57 0.00 45.33 3.21
304 305 9.729023 CACAAGTTGTTCTTACAAAATCATGTA 57.271 29.630 5.57 0.00 45.33 2.29
316 317 6.668323 ACAAAATCATGTAAGAACCTTCACG 58.332 36.000 0.00 0.00 0.00 4.35
317 318 4.946784 AATCATGTAAGAACCTTCACGC 57.053 40.909 0.00 0.00 0.00 5.34
318 319 3.394674 TCATGTAAGAACCTTCACGCA 57.605 42.857 0.00 0.00 0.00 5.24
319 320 3.325870 TCATGTAAGAACCTTCACGCAG 58.674 45.455 0.00 0.00 0.00 5.18
320 321 3.006430 TCATGTAAGAACCTTCACGCAGA 59.994 43.478 0.00 0.00 0.00 4.26
321 322 3.026630 TGTAAGAACCTTCACGCAGAG 57.973 47.619 0.00 0.00 0.00 3.35
322 323 2.626266 TGTAAGAACCTTCACGCAGAGA 59.374 45.455 0.00 0.00 0.00 3.10
323 324 2.447244 AAGAACCTTCACGCAGAGAG 57.553 50.000 0.00 0.00 0.00 3.20
324 325 1.621992 AGAACCTTCACGCAGAGAGA 58.378 50.000 0.00 0.00 0.00 3.10
325 326 1.964223 AGAACCTTCACGCAGAGAGAA 59.036 47.619 0.00 0.00 0.00 2.87
326 327 2.062519 GAACCTTCACGCAGAGAGAAC 58.937 52.381 0.00 0.00 0.00 3.01
327 328 1.040646 ACCTTCACGCAGAGAGAACA 58.959 50.000 0.00 0.00 0.00 3.18
328 329 1.620819 ACCTTCACGCAGAGAGAACAT 59.379 47.619 0.00 0.00 0.00 2.71
329 330 2.826128 ACCTTCACGCAGAGAGAACATA 59.174 45.455 0.00 0.00 0.00 2.29
330 331 3.449018 ACCTTCACGCAGAGAGAACATAT 59.551 43.478 0.00 0.00 0.00 1.78
331 332 4.081420 ACCTTCACGCAGAGAGAACATATT 60.081 41.667 0.00 0.00 0.00 1.28
332 333 5.127194 ACCTTCACGCAGAGAGAACATATTA 59.873 40.000 0.00 0.00 0.00 0.98
333 334 6.183360 ACCTTCACGCAGAGAGAACATATTAT 60.183 38.462 0.00 0.00 0.00 1.28
334 335 6.145209 CCTTCACGCAGAGAGAACATATTATG 59.855 42.308 2.03 2.03 0.00 1.90
336 337 7.272037 TCACGCAGAGAGAACATATTATGTA 57.728 36.000 9.67 0.00 44.07 2.29
337 338 7.712797 TCACGCAGAGAGAACATATTATGTAA 58.287 34.615 9.67 0.00 44.07 2.41
338 339 7.648112 TCACGCAGAGAGAACATATTATGTAAC 59.352 37.037 9.67 7.55 44.07 2.50
339 340 7.649705 CACGCAGAGAGAACATATTATGTAACT 59.350 37.037 9.67 11.60 44.07 2.24
340 341 8.198109 ACGCAGAGAGAACATATTATGTAACTT 58.802 33.333 9.67 0.00 44.07 2.66
341 342 9.678941 CGCAGAGAGAACATATTATGTAACTTA 57.321 33.333 9.67 0.00 44.07 2.24
344 345 9.680315 AGAGAGAACATATTATGTAACTTACGC 57.320 33.333 9.67 4.76 44.07 4.42
345 346 8.503486 AGAGAACATATTATGTAACTTACGCG 57.497 34.615 3.53 3.53 44.07 6.01
346 347 8.347771 AGAGAACATATTATGTAACTTACGCGA 58.652 33.333 15.93 0.00 44.07 5.87
347 348 9.125906 GAGAACATATTATGTAACTTACGCGAT 57.874 33.333 15.93 0.00 44.07 4.58
348 349 8.912658 AGAACATATTATGTAACTTACGCGATG 58.087 33.333 15.93 2.75 44.07 3.84
349 350 8.583810 AACATATTATGTAACTTACGCGATGT 57.416 30.769 15.93 3.49 44.07 3.06
350 351 8.583810 ACATATTATGTAACTTACGCGATGTT 57.416 30.769 15.93 16.39 42.78 2.71
351 352 8.697067 ACATATTATGTAACTTACGCGATGTTC 58.303 33.333 15.93 9.04 42.78 3.18
352 353 5.954434 TTATGTAACTTACGCGATGTTCC 57.046 39.130 15.93 6.20 0.00 3.62
353 354 2.609350 TGTAACTTACGCGATGTTCCC 58.391 47.619 15.93 9.18 0.00 3.97
354 355 1.929169 GTAACTTACGCGATGTTCCCC 59.071 52.381 15.93 3.14 0.00 4.81
355 356 0.322322 AACTTACGCGATGTTCCCCA 59.678 50.000 15.93 0.00 0.00 4.96
356 357 0.539986 ACTTACGCGATGTTCCCCAT 59.460 50.000 15.93 0.00 36.13 4.00
357 358 1.217882 CTTACGCGATGTTCCCCATC 58.782 55.000 15.93 0.00 45.50 3.51
366 367 2.495155 TGTTCCCCATCATCACACAG 57.505 50.000 0.00 0.00 0.00 3.66
367 368 1.984424 TGTTCCCCATCATCACACAGA 59.016 47.619 0.00 0.00 0.00 3.41
368 369 2.374839 TGTTCCCCATCATCACACAGAA 59.625 45.455 0.00 0.00 0.00 3.02
369 370 3.010472 TGTTCCCCATCATCACACAGAAT 59.990 43.478 0.00 0.00 0.00 2.40
370 371 4.019174 GTTCCCCATCATCACACAGAATT 58.981 43.478 0.00 0.00 0.00 2.17
371 372 3.889815 TCCCCATCATCACACAGAATTC 58.110 45.455 0.00 0.00 0.00 2.17
372 373 2.615447 CCCCATCATCACACAGAATTCG 59.385 50.000 0.00 0.00 0.00 3.34
373 374 3.273434 CCCATCATCACACAGAATTCGT 58.727 45.455 0.00 0.00 0.00 3.85
374 375 3.691118 CCCATCATCACACAGAATTCGTT 59.309 43.478 0.00 0.00 0.00 3.85
375 376 4.156556 CCCATCATCACACAGAATTCGTTT 59.843 41.667 0.00 0.00 0.00 3.60
376 377 5.353956 CCCATCATCACACAGAATTCGTTTA 59.646 40.000 0.00 0.00 0.00 2.01
377 378 6.038603 CCCATCATCACACAGAATTCGTTTAT 59.961 38.462 0.00 0.00 0.00 1.40
378 379 7.415541 CCCATCATCACACAGAATTCGTTTATT 60.416 37.037 0.00 0.00 0.00 1.40
379 380 7.430211 CCATCATCACACAGAATTCGTTTATTG 59.570 37.037 0.00 0.00 0.00 1.90
380 381 7.433708 TCATCACACAGAATTCGTTTATTGT 57.566 32.000 0.00 0.00 0.00 2.71
381 382 7.870826 TCATCACACAGAATTCGTTTATTGTT 58.129 30.769 0.00 0.00 0.00 2.83
382 383 8.349245 TCATCACACAGAATTCGTTTATTGTTT 58.651 29.630 0.00 0.00 0.00 2.83
383 384 9.605955 CATCACACAGAATTCGTTTATTGTTTA 57.394 29.630 0.00 0.00 0.00 2.01
385 386 9.820229 TCACACAGAATTCGTTTATTGTTTATC 57.180 29.630 0.00 0.00 0.00 1.75
386 387 9.825972 CACACAGAATTCGTTTATTGTTTATCT 57.174 29.630 0.00 0.00 0.00 1.98
387 388 9.825972 ACACAGAATTCGTTTATTGTTTATCTG 57.174 29.630 0.00 0.00 37.26 2.90
396 397 9.658475 TCGTTTATTGTTTATCTGAGTTGTTTG 57.342 29.630 0.00 0.00 0.00 2.93
397 398 8.417176 CGTTTATTGTTTATCTGAGTTGTTTGC 58.583 33.333 0.00 0.00 0.00 3.68
398 399 8.699749 GTTTATTGTTTATCTGAGTTGTTTGCC 58.300 33.333 0.00 0.00 0.00 4.52
399 400 5.843673 TTGTTTATCTGAGTTGTTTGCCA 57.156 34.783 0.00 0.00 0.00 4.92
400 401 5.181690 TGTTTATCTGAGTTGTTTGCCAC 57.818 39.130 0.00 0.00 0.00 5.01
401 402 4.219033 GTTTATCTGAGTTGTTTGCCACG 58.781 43.478 0.00 0.00 0.00 4.94
402 403 1.967319 ATCTGAGTTGTTTGCCACGT 58.033 45.000 0.00 0.00 0.00 4.49
403 404 2.605837 TCTGAGTTGTTTGCCACGTA 57.394 45.000 0.00 0.00 0.00 3.57
404 405 2.479837 TCTGAGTTGTTTGCCACGTAG 58.520 47.619 0.00 0.00 0.00 3.51
405 406 0.941542 TGAGTTGTTTGCCACGTAGC 59.058 50.000 0.00 0.00 0.00 3.58
406 407 0.941542 GAGTTGTTTGCCACGTAGCA 59.058 50.000 4.01 4.01 42.17 3.49
407 408 0.661020 AGTTGTTTGCCACGTAGCAC 59.339 50.000 8.55 0.00 43.97 4.40
408 409 0.378962 GTTGTTTGCCACGTAGCACA 59.621 50.000 8.55 0.00 43.97 4.57
409 410 0.378962 TTGTTTGCCACGTAGCACAC 59.621 50.000 16.74 16.74 43.97 3.82
410 411 2.018544 GTTTGCCACGTAGCACACA 58.981 52.632 18.31 0.00 43.97 3.72
411 412 0.316689 GTTTGCCACGTAGCACACAC 60.317 55.000 18.31 8.11 43.97 3.82
412 413 1.767127 TTTGCCACGTAGCACACACG 61.767 55.000 8.55 0.00 43.97 4.49
413 414 3.411351 GCCACGTAGCACACACGG 61.411 66.667 0.00 0.00 43.59 4.94
414 415 2.028484 CCACGTAGCACACACGGT 59.972 61.111 0.00 0.00 43.59 4.83
415 416 1.593209 CCACGTAGCACACACGGTT 60.593 57.895 0.00 0.00 43.59 4.44
416 417 1.155424 CCACGTAGCACACACGGTTT 61.155 55.000 0.00 0.00 43.59 3.27
417 418 0.042535 CACGTAGCACACACGGTTTG 60.043 55.000 0.00 0.00 43.59 2.93
418 419 0.179105 ACGTAGCACACACGGTTTGA 60.179 50.000 0.56 0.00 43.59 2.69
419 420 1.144969 CGTAGCACACACGGTTTGAT 58.855 50.000 0.56 0.00 35.78 2.57
420 421 1.126113 CGTAGCACACACGGTTTGATC 59.874 52.381 0.56 0.00 35.78 2.92
421 422 2.139917 GTAGCACACACGGTTTGATCA 58.860 47.619 0.56 0.00 0.00 2.92
422 423 1.674359 AGCACACACGGTTTGATCAA 58.326 45.000 3.38 3.38 0.00 2.57
423 424 2.020720 AGCACACACGGTTTGATCAAA 58.979 42.857 16.91 16.91 0.00 2.69
424 425 2.425312 AGCACACACGGTTTGATCAAAA 59.575 40.909 22.07 4.47 31.33 2.44
425 426 2.533942 GCACACACGGTTTGATCAAAAC 59.466 45.455 23.68 23.68 46.32 2.43
435 436 4.993550 GTTTGATCAAAACAATCGTGTGC 58.006 39.130 22.07 2.16 46.30 4.57
436 437 3.978718 TGATCAAAACAATCGTGTGCA 57.021 38.095 0.00 0.00 38.27 4.57
437 438 4.502171 TGATCAAAACAATCGTGTGCAT 57.498 36.364 0.00 0.00 38.27 3.96
438 439 4.869215 TGATCAAAACAATCGTGTGCATT 58.131 34.783 0.00 0.00 38.27 3.56
439 440 6.006759 TGATCAAAACAATCGTGTGCATTA 57.993 33.333 0.00 0.00 38.27 1.90
440 441 6.619744 TGATCAAAACAATCGTGTGCATTAT 58.380 32.000 0.00 0.00 38.27 1.28
441 442 6.746822 TGATCAAAACAATCGTGTGCATTATC 59.253 34.615 0.00 0.00 38.27 1.75
442 443 6.006759 TCAAAACAATCGTGTGCATTATCA 57.993 33.333 0.00 0.00 38.27 2.15
443 444 5.855925 TCAAAACAATCGTGTGCATTATCAC 59.144 36.000 0.00 0.00 38.27 3.06
451 452 4.974103 GTGTGCATTATCACGAGGTATC 57.026 45.455 0.00 0.00 39.73 2.24
460 461 3.675485 CGAGGTATCGCACACACG 58.325 61.111 0.00 0.00 42.97 4.49
461 462 1.154093 CGAGGTATCGCACACACGT 60.154 57.895 0.00 0.00 42.97 4.49
462 463 0.731514 CGAGGTATCGCACACACGTT 60.732 55.000 0.00 0.00 42.97 3.99
463 464 1.466192 CGAGGTATCGCACACACGTTA 60.466 52.381 0.00 0.00 42.97 3.18
464 465 2.182825 GAGGTATCGCACACACGTTAG 58.817 52.381 0.00 0.00 0.00 2.34
465 466 1.814394 AGGTATCGCACACACGTTAGA 59.186 47.619 0.00 0.00 0.00 2.10
466 467 1.916000 GGTATCGCACACACGTTAGAC 59.084 52.381 0.00 0.00 0.00 2.59
468 469 0.239082 ATCGCACACACGTTAGACGA 59.761 50.000 7.54 0.00 46.05 4.20
469 470 0.658244 TCGCACACACGTTAGACGAC 60.658 55.000 7.54 0.00 46.05 4.34
470 471 0.659417 CGCACACACGTTAGACGACT 60.659 55.000 7.54 0.00 46.05 4.18
471 472 0.776451 GCACACACGTTAGACGACTG 59.224 55.000 7.54 4.40 46.05 3.51
472 473 1.405461 CACACACGTTAGACGACTGG 58.595 55.000 7.54 0.00 46.05 4.00
473 474 1.002142 CACACACGTTAGACGACTGGA 60.002 52.381 7.54 0.00 46.05 3.86
474 475 1.002033 ACACACGTTAGACGACTGGAC 60.002 52.381 7.54 0.00 46.05 4.02
475 476 1.266175 CACACGTTAGACGACTGGACT 59.734 52.381 7.54 0.00 46.05 3.85
476 477 1.266175 ACACGTTAGACGACTGGACTG 59.734 52.381 7.54 0.00 46.05 3.51
477 478 1.266175 CACGTTAGACGACTGGACTGT 59.734 52.381 7.54 0.00 46.05 3.55
478 479 1.266175 ACGTTAGACGACTGGACTGTG 59.734 52.381 7.54 0.00 46.05 3.66
479 480 1.266175 CGTTAGACGACTGGACTGTGT 59.734 52.381 0.00 0.00 46.05 3.72
480 481 2.662700 GTTAGACGACTGGACTGTGTG 58.337 52.381 0.00 0.00 0.00 3.82
481 482 1.977056 TAGACGACTGGACTGTGTGT 58.023 50.000 0.00 0.00 0.00 3.72
482 483 0.669077 AGACGACTGGACTGTGTGTC 59.331 55.000 0.00 0.00 44.63 3.67
492 493 3.319137 GACTGTGTGTCCTCTATTGCA 57.681 47.619 0.00 0.00 39.69 4.08
493 494 2.996621 GACTGTGTGTCCTCTATTGCAC 59.003 50.000 0.00 0.00 39.69 4.57
494 495 2.368548 ACTGTGTGTCCTCTATTGCACA 59.631 45.455 0.00 0.00 39.21 4.57
496 497 2.078849 TGTGTCCTCTATTGCACACG 57.921 50.000 0.00 0.00 41.77 4.49
497 498 1.337728 TGTGTCCTCTATTGCACACGG 60.338 52.381 0.00 0.00 41.77 4.94
498 499 0.391130 TGTCCTCTATTGCACACGGC 60.391 55.000 0.00 0.00 45.13 5.68
499 500 0.108138 GTCCTCTATTGCACACGGCT 60.108 55.000 0.00 0.00 45.15 5.52
500 501 0.175760 TCCTCTATTGCACACGGCTC 59.824 55.000 0.00 0.00 45.15 4.70
501 502 0.176680 CCTCTATTGCACACGGCTCT 59.823 55.000 0.00 0.00 45.15 4.09
502 503 1.565305 CTCTATTGCACACGGCTCTC 58.435 55.000 0.00 0.00 45.15 3.20
503 504 1.135915 CTCTATTGCACACGGCTCTCT 59.864 52.381 0.00 0.00 45.15 3.10
504 505 1.550524 TCTATTGCACACGGCTCTCTT 59.449 47.619 0.00 0.00 45.15 2.85
505 506 2.028112 TCTATTGCACACGGCTCTCTTT 60.028 45.455 0.00 0.00 45.15 2.52
506 507 1.609208 ATTGCACACGGCTCTCTTTT 58.391 45.000 0.00 0.00 45.15 2.27
507 508 2.248280 TTGCACACGGCTCTCTTTTA 57.752 45.000 0.00 0.00 45.15 1.52
508 509 1.508632 TGCACACGGCTCTCTTTTAC 58.491 50.000 0.00 0.00 45.15 2.01
509 510 1.202592 TGCACACGGCTCTCTTTTACA 60.203 47.619 0.00 0.00 45.15 2.41
510 511 1.871039 GCACACGGCTCTCTTTTACAA 59.129 47.619 0.00 0.00 40.25 2.41
511 512 2.289547 GCACACGGCTCTCTTTTACAAA 59.710 45.455 0.00 0.00 40.25 2.83
512 513 3.242936 GCACACGGCTCTCTTTTACAAAA 60.243 43.478 0.00 0.00 40.25 2.44
513 514 4.556699 GCACACGGCTCTCTTTTACAAAAT 60.557 41.667 0.00 0.00 40.25 1.82
514 515 5.519722 CACACGGCTCTCTTTTACAAAATT 58.480 37.500 0.00 0.00 0.00 1.82
515 516 5.399301 CACACGGCTCTCTTTTACAAAATTG 59.601 40.000 0.00 0.00 0.00 2.32
516 517 5.067283 ACACGGCTCTCTTTTACAAAATTGT 59.933 36.000 4.01 4.01 44.86 2.71
517 518 5.399301 CACGGCTCTCTTTTACAAAATTGTG 59.601 40.000 8.99 0.00 42.31 3.33
518 519 4.382754 CGGCTCTCTTTTACAAAATTGTGC 59.617 41.667 8.99 1.42 42.31 4.57
519 520 4.686091 GGCTCTCTTTTACAAAATTGTGCC 59.314 41.667 8.99 6.64 42.31 5.01
520 521 4.686091 GCTCTCTTTTACAAAATTGTGCCC 59.314 41.667 8.99 0.00 42.31 5.36
521 522 5.738783 GCTCTCTTTTACAAAATTGTGCCCA 60.739 40.000 8.99 0.00 42.31 5.36
522 523 6.227298 TCTCTTTTACAAAATTGTGCCCAA 57.773 33.333 8.99 0.00 42.31 4.12
523 524 6.825610 TCTCTTTTACAAAATTGTGCCCAAT 58.174 32.000 8.99 0.00 43.14 3.16
524 525 6.705381 TCTCTTTTACAAAATTGTGCCCAATG 59.295 34.615 8.99 0.00 40.42 2.82
525 526 5.762218 TCTTTTACAAAATTGTGCCCAATGG 59.238 36.000 8.99 0.00 40.42 3.16
526 527 2.565046 ACAAAATTGTGCCCAATGGG 57.435 45.000 15.45 15.45 40.42 4.00
527 528 1.773653 ACAAAATTGTGCCCAATGGGT 59.226 42.857 21.02 0.00 40.42 4.51
528 529 2.152830 CAAAATTGTGCCCAATGGGTG 58.847 47.619 21.02 3.39 46.51 4.61
529 530 1.727062 AAATTGTGCCCAATGGGTGA 58.273 45.000 21.02 3.94 46.51 4.02
530 531 1.269012 AATTGTGCCCAATGGGTGAG 58.731 50.000 21.02 0.00 46.51 3.51
531 532 1.259840 ATTGTGCCCAATGGGTGAGC 61.260 55.000 21.02 5.70 46.51 4.26
532 533 3.070576 GTGCCCAATGGGTGAGCC 61.071 66.667 21.02 2.80 46.51 4.70
533 534 3.588511 TGCCCAATGGGTGAGCCA 61.589 61.111 21.02 5.57 46.51 4.75
534 535 2.042639 GCCCAATGGGTGAGCCAT 60.043 61.111 21.02 10.95 46.51 4.40
535 536 2.129785 GCCCAATGGGTGAGCCATC 61.130 63.158 21.02 0.08 46.51 3.51
536 537 1.307309 CCCAATGGGTGAGCCATCA 59.693 57.895 17.49 0.00 38.25 3.07
545 546 3.395210 TGAGCCATCACACACGTTT 57.605 47.368 0.00 0.00 0.00 3.60
546 547 1.225855 TGAGCCATCACACACGTTTC 58.774 50.000 0.00 0.00 0.00 2.78
547 548 1.225855 GAGCCATCACACACGTTTCA 58.774 50.000 0.00 0.00 0.00 2.69
548 549 0.944386 AGCCATCACACACGTTTCAC 59.056 50.000 0.00 0.00 0.00 3.18
549 550 0.944386 GCCATCACACACGTTTCACT 59.056 50.000 0.00 0.00 0.00 3.41
550 551 1.333619 GCCATCACACACGTTTCACTT 59.666 47.619 0.00 0.00 0.00 3.16
551 552 2.223479 GCCATCACACACGTTTCACTTT 60.223 45.455 0.00 0.00 0.00 2.66
552 553 3.617669 CCATCACACACGTTTCACTTTC 58.382 45.455 0.00 0.00 0.00 2.62
553 554 3.064682 CCATCACACACGTTTCACTTTCA 59.935 43.478 0.00 0.00 0.00 2.69
554 555 4.274069 CATCACACACGTTTCACTTTCAG 58.726 43.478 0.00 0.00 0.00 3.02
555 556 3.591023 TCACACACGTTTCACTTTCAGA 58.409 40.909 0.00 0.00 0.00 3.27
556 557 3.369756 TCACACACGTTTCACTTTCAGAC 59.630 43.478 0.00 0.00 0.00 3.51
557 558 3.124466 CACACACGTTTCACTTTCAGACA 59.876 43.478 0.00 0.00 0.00 3.41
558 559 3.124636 ACACACGTTTCACTTTCAGACAC 59.875 43.478 0.00 0.00 0.00 3.67
559 560 3.124466 CACACGTTTCACTTTCAGACACA 59.876 43.478 0.00 0.00 0.00 3.72
560 561 3.124636 ACACGTTTCACTTTCAGACACAC 59.875 43.478 0.00 0.00 0.00 3.82
561 562 2.347452 ACGTTTCACTTTCAGACACACG 59.653 45.455 0.00 0.00 0.00 4.49
562 563 2.285602 CGTTTCACTTTCAGACACACGG 60.286 50.000 0.00 0.00 0.00 4.94
563 564 2.676342 GTTTCACTTTCAGACACACGGT 59.324 45.455 0.00 0.00 0.00 4.83
564 565 2.684001 TCACTTTCAGACACACGGTT 57.316 45.000 0.00 0.00 0.00 4.44
565 566 2.980568 TCACTTTCAGACACACGGTTT 58.019 42.857 0.00 0.00 0.00 3.27
566 567 3.340034 TCACTTTCAGACACACGGTTTT 58.660 40.909 0.00 0.00 0.00 2.43
567 568 4.505808 TCACTTTCAGACACACGGTTTTA 58.494 39.130 0.00 0.00 0.00 1.52
568 569 5.120399 TCACTTTCAGACACACGGTTTTAT 58.880 37.500 0.00 0.00 0.00 1.40
569 570 5.587043 TCACTTTCAGACACACGGTTTTATT 59.413 36.000 0.00 0.00 0.00 1.40
570 571 6.094325 TCACTTTCAGACACACGGTTTTATTT 59.906 34.615 0.00 0.00 0.00 1.40
571 572 6.750039 CACTTTCAGACACACGGTTTTATTTT 59.250 34.615 0.00 0.00 0.00 1.82
572 573 7.274686 CACTTTCAGACACACGGTTTTATTTTT 59.725 33.333 0.00 0.00 0.00 1.94
573 574 7.274686 ACTTTCAGACACACGGTTTTATTTTTG 59.725 33.333 0.00 0.00 0.00 2.44
574 575 6.438259 TCAGACACACGGTTTTATTTTTGA 57.562 33.333 0.00 0.00 0.00 2.69
575 576 6.491394 TCAGACACACGGTTTTATTTTTGAG 58.509 36.000 0.00 0.00 0.00 3.02
576 577 6.316640 TCAGACACACGGTTTTATTTTTGAGA 59.683 34.615 0.00 0.00 0.00 3.27
577 578 6.413818 CAGACACACGGTTTTATTTTTGAGAC 59.586 38.462 0.00 0.00 0.00 3.36
578 579 5.267776 ACACACGGTTTTATTTTTGAGACG 58.732 37.500 0.00 0.00 0.00 4.18
579 580 5.163733 ACACACGGTTTTATTTTTGAGACGT 60.164 36.000 0.00 0.00 0.00 4.34
580 581 5.740099 CACACGGTTTTATTTTTGAGACGTT 59.260 36.000 0.00 0.00 0.00 3.99
581 582 5.967088 ACACGGTTTTATTTTTGAGACGTTC 59.033 36.000 0.00 0.00 0.00 3.95
582 583 5.966503 CACGGTTTTATTTTTGAGACGTTCA 59.033 36.000 0.00 0.00 0.00 3.18
583 584 6.635239 CACGGTTTTATTTTTGAGACGTTCAT 59.365 34.615 0.00 0.00 35.27 2.57
584 585 6.854381 ACGGTTTTATTTTTGAGACGTTCATC 59.146 34.615 0.00 0.00 35.27 2.92
585 586 6.853872 CGGTTTTATTTTTGAGACGTTCATCA 59.146 34.615 0.00 0.00 35.27 3.07
586 587 7.149192 CGGTTTTATTTTTGAGACGTTCATCAC 60.149 37.037 0.00 0.00 35.27 3.06
587 588 7.646130 GGTTTTATTTTTGAGACGTTCATCACA 59.354 33.333 0.00 0.00 35.27 3.58
588 589 8.469125 GTTTTATTTTTGAGACGTTCATCACAC 58.531 33.333 0.00 0.00 35.27 3.82
589 590 5.749596 ATTTTTGAGACGTTCATCACACA 57.250 34.783 0.00 0.00 35.27 3.72
590 591 5.749596 TTTTTGAGACGTTCATCACACAT 57.250 34.783 0.00 0.00 35.27 3.21
591 592 6.852858 TTTTTGAGACGTTCATCACACATA 57.147 33.333 0.00 0.00 35.27 2.29
592 593 6.466308 TTTTGAGACGTTCATCACACATAG 57.534 37.500 0.00 0.00 35.27 2.23
593 594 4.783764 TGAGACGTTCATCACACATAGT 57.216 40.909 0.00 0.00 0.00 2.12
594 595 5.134202 TGAGACGTTCATCACACATAGTT 57.866 39.130 0.00 0.00 0.00 2.24
595 596 5.538118 TGAGACGTTCATCACACATAGTTT 58.462 37.500 0.00 0.00 0.00 2.66
596 597 5.405269 TGAGACGTTCATCACACATAGTTTG 59.595 40.000 0.00 0.00 0.00 2.93
597 598 5.538118 AGACGTTCATCACACATAGTTTGA 58.462 37.500 0.00 0.00 0.00 2.69
598 599 6.166279 AGACGTTCATCACACATAGTTTGAT 58.834 36.000 0.00 0.00 33.89 2.57
599 600 6.091305 AGACGTTCATCACACATAGTTTGATG 59.909 38.462 16.24 16.24 46.09 3.07
600 601 5.023920 CGTTCATCACACATAGTTTGATGC 58.976 41.667 17.13 7.31 45.06 3.91
601 602 5.163824 CGTTCATCACACATAGTTTGATGCT 60.164 40.000 17.13 0.00 45.06 3.79
602 603 6.035975 CGTTCATCACACATAGTTTGATGCTA 59.964 38.462 17.13 8.32 45.06 3.49
603 604 7.404985 GTTCATCACACATAGTTTGATGCTAG 58.595 38.462 17.13 0.00 45.06 3.42
604 605 6.877236 TCATCACACATAGTTTGATGCTAGA 58.123 36.000 17.13 2.68 45.06 2.43
605 606 7.330262 TCATCACACATAGTTTGATGCTAGAA 58.670 34.615 17.13 2.39 45.06 2.10
606 607 7.989170 TCATCACACATAGTTTGATGCTAGAAT 59.011 33.333 17.13 0.00 45.06 2.40
607 608 7.543947 TCACACATAGTTTGATGCTAGAATG 57.456 36.000 0.00 0.00 0.00 2.67
608 609 7.105588 TCACACATAGTTTGATGCTAGAATGT 58.894 34.615 0.00 0.00 0.00 2.71
609 610 7.064966 TCACACATAGTTTGATGCTAGAATGTG 59.935 37.037 9.81 9.81 40.76 3.21
610 611 6.183360 ACACATAGTTTGATGCTAGAATGTGC 60.183 38.462 10.99 0.00 39.18 4.57
611 612 5.007039 ACATAGTTTGATGCTAGAATGTGCG 59.993 40.000 0.00 0.00 0.00 5.34
612 613 3.599343 AGTTTGATGCTAGAATGTGCGA 58.401 40.909 0.00 0.00 0.00 5.10
613 614 4.194640 AGTTTGATGCTAGAATGTGCGAT 58.805 39.130 0.00 0.00 0.00 4.58
614 615 5.359756 AGTTTGATGCTAGAATGTGCGATA 58.640 37.500 0.00 0.00 0.00 2.92
615 616 5.464722 AGTTTGATGCTAGAATGTGCGATAG 59.535 40.000 0.00 0.00 0.00 2.08
616 617 3.917988 TGATGCTAGAATGTGCGATAGG 58.082 45.455 0.00 0.00 0.00 2.57
617 618 3.321968 TGATGCTAGAATGTGCGATAGGT 59.678 43.478 0.00 0.00 0.00 3.08
618 619 3.097877 TGCTAGAATGTGCGATAGGTG 57.902 47.619 0.00 0.00 0.00 4.00
619 620 1.795286 GCTAGAATGTGCGATAGGTGC 59.205 52.381 0.00 0.00 0.00 5.01
620 621 2.803133 GCTAGAATGTGCGATAGGTGCA 60.803 50.000 0.00 0.00 40.70 4.57
627 628 2.979814 TGCGATAGGTGCACTAATGT 57.020 45.000 17.98 1.37 37.44 2.71
629 630 4.394439 TGCGATAGGTGCACTAATGTAA 57.606 40.909 17.98 0.00 37.44 2.41
630 631 4.368315 TGCGATAGGTGCACTAATGTAAG 58.632 43.478 17.98 2.57 37.44 2.34
631 632 4.098807 TGCGATAGGTGCACTAATGTAAGA 59.901 41.667 17.98 0.00 37.44 2.10
632 633 5.047847 GCGATAGGTGCACTAATGTAAGAA 58.952 41.667 17.98 0.00 34.79 2.52
633 634 5.175856 GCGATAGGTGCACTAATGTAAGAAG 59.824 44.000 17.98 0.00 34.79 2.85
634 635 5.175856 CGATAGGTGCACTAATGTAAGAAGC 59.824 44.000 17.98 0.00 34.79 3.86
635 636 3.610911 AGGTGCACTAATGTAAGAAGCC 58.389 45.455 17.98 0.00 0.00 4.35
636 637 2.351726 GGTGCACTAATGTAAGAAGCCG 59.648 50.000 17.98 0.00 0.00 5.52
637 638 2.006888 TGCACTAATGTAAGAAGCCGC 58.993 47.619 0.00 0.00 0.00 6.53
638 639 2.006888 GCACTAATGTAAGAAGCCGCA 58.993 47.619 0.00 0.00 0.00 5.69
639 640 2.223044 GCACTAATGTAAGAAGCCGCAC 60.223 50.000 0.00 0.00 0.00 5.34
640 641 2.029244 CACTAATGTAAGAAGCCGCACG 59.971 50.000 0.00 0.00 0.00 5.34
641 642 2.094390 ACTAATGTAAGAAGCCGCACGA 60.094 45.455 0.00 0.00 0.00 4.35
642 643 1.359848 AATGTAAGAAGCCGCACGAG 58.640 50.000 0.00 0.00 0.00 4.18
643 644 0.530744 ATGTAAGAAGCCGCACGAGA 59.469 50.000 0.00 0.00 0.00 4.04
644 645 0.530744 TGTAAGAAGCCGCACGAGAT 59.469 50.000 0.00 0.00 0.00 2.75
645 646 0.924090 GTAAGAAGCCGCACGAGATG 59.076 55.000 0.00 0.00 0.00 2.90
646 647 0.815095 TAAGAAGCCGCACGAGATGA 59.185 50.000 0.00 0.00 0.00 2.92
647 648 0.037326 AAGAAGCCGCACGAGATGAA 60.037 50.000 0.00 0.00 0.00 2.57
648 649 0.737715 AGAAGCCGCACGAGATGAAC 60.738 55.000 0.00 0.00 0.00 3.18
649 650 1.005037 AAGCCGCACGAGATGAACA 60.005 52.632 0.00 0.00 0.00 3.18
650 651 0.602638 AAGCCGCACGAGATGAACAA 60.603 50.000 0.00 0.00 0.00 2.83
651 652 1.016130 AGCCGCACGAGATGAACAAG 61.016 55.000 0.00 0.00 0.00 3.16
652 653 1.970917 GCCGCACGAGATGAACAAGG 61.971 60.000 0.00 0.00 0.00 3.61
653 654 0.389817 CCGCACGAGATGAACAAGGA 60.390 55.000 0.00 0.00 0.00 3.36
654 655 0.716108 CGCACGAGATGAACAAGGAC 59.284 55.000 0.00 0.00 0.00 3.85
655 656 1.670087 CGCACGAGATGAACAAGGACT 60.670 52.381 0.00 0.00 0.00 3.85
656 657 2.415491 CGCACGAGATGAACAAGGACTA 60.415 50.000 0.00 0.00 0.00 2.59
657 658 3.735208 CGCACGAGATGAACAAGGACTAT 60.735 47.826 0.00 0.00 0.00 2.12
658 659 3.553511 GCACGAGATGAACAAGGACTATG 59.446 47.826 0.00 0.00 0.00 2.23
659 660 4.678044 GCACGAGATGAACAAGGACTATGA 60.678 45.833 0.00 0.00 0.00 2.15
660 661 4.800993 CACGAGATGAACAAGGACTATGAC 59.199 45.833 0.00 0.00 0.00 3.06
661 662 4.707448 ACGAGATGAACAAGGACTATGACT 59.293 41.667 0.00 0.00 0.00 3.41
662 663 5.186021 ACGAGATGAACAAGGACTATGACTT 59.814 40.000 0.00 0.00 0.00 3.01
663 664 5.746245 CGAGATGAACAAGGACTATGACTTC 59.254 44.000 0.00 0.00 0.00 3.01
664 665 6.405286 CGAGATGAACAAGGACTATGACTTCT 60.405 42.308 0.00 0.00 0.00 2.85
665 666 6.872920 AGATGAACAAGGACTATGACTTCTC 58.127 40.000 0.00 0.00 0.00 2.87
666 667 6.438741 AGATGAACAAGGACTATGACTTCTCA 59.561 38.462 0.00 0.00 0.00 3.27
667 668 5.784177 TGAACAAGGACTATGACTTCTCAC 58.216 41.667 0.00 0.00 0.00 3.51
668 669 4.810191 ACAAGGACTATGACTTCTCACC 57.190 45.455 0.00 0.00 0.00 4.02
669 670 4.421131 ACAAGGACTATGACTTCTCACCT 58.579 43.478 0.00 0.00 0.00 4.00
670 671 4.464597 ACAAGGACTATGACTTCTCACCTC 59.535 45.833 0.00 0.00 0.00 3.85
671 672 4.601406 AGGACTATGACTTCTCACCTCT 57.399 45.455 0.00 0.00 0.00 3.69
672 673 5.718801 AGGACTATGACTTCTCACCTCTA 57.281 43.478 0.00 0.00 0.00 2.43
673 674 6.080969 AGGACTATGACTTCTCACCTCTAA 57.919 41.667 0.00 0.00 0.00 2.10
674 675 5.889289 AGGACTATGACTTCTCACCTCTAAC 59.111 44.000 0.00 0.00 0.00 2.34
675 676 5.889289 GGACTATGACTTCTCACCTCTAACT 59.111 44.000 0.00 0.00 0.00 2.24
676 677 6.183360 GGACTATGACTTCTCACCTCTAACTG 60.183 46.154 0.00 0.00 0.00 3.16
677 678 3.944055 TGACTTCTCACCTCTAACTGC 57.056 47.619 0.00 0.00 0.00 4.40
678 679 2.563179 TGACTTCTCACCTCTAACTGCC 59.437 50.000 0.00 0.00 0.00 4.85
679 680 2.829120 GACTTCTCACCTCTAACTGCCT 59.171 50.000 0.00 0.00 0.00 4.75
680 681 3.243724 ACTTCTCACCTCTAACTGCCTT 58.756 45.455 0.00 0.00 0.00 4.35
681 682 4.417437 ACTTCTCACCTCTAACTGCCTTA 58.583 43.478 0.00 0.00 0.00 2.69
682 683 5.026790 ACTTCTCACCTCTAACTGCCTTAT 58.973 41.667 0.00 0.00 0.00 1.73
683 684 5.485708 ACTTCTCACCTCTAACTGCCTTATT 59.514 40.000 0.00 0.00 0.00 1.40
684 685 5.599999 TCTCACCTCTAACTGCCTTATTC 57.400 43.478 0.00 0.00 0.00 1.75
685 686 5.273208 TCTCACCTCTAACTGCCTTATTCT 58.727 41.667 0.00 0.00 0.00 2.40
686 687 5.721960 TCTCACCTCTAACTGCCTTATTCTT 59.278 40.000 0.00 0.00 0.00 2.52
687 688 6.895756 TCTCACCTCTAACTGCCTTATTCTTA 59.104 38.462 0.00 0.00 0.00 2.10
688 689 7.399191 TCTCACCTCTAACTGCCTTATTCTTAA 59.601 37.037 0.00 0.00 0.00 1.85
689 690 8.090788 TCACCTCTAACTGCCTTATTCTTAAT 57.909 34.615 0.00 0.00 0.00 1.40
690 691 8.548877 TCACCTCTAACTGCCTTATTCTTAATT 58.451 33.333 0.00 0.00 0.00 1.40
691 692 8.616076 CACCTCTAACTGCCTTATTCTTAATTG 58.384 37.037 0.00 0.00 0.00 2.32
692 693 7.775561 ACCTCTAACTGCCTTATTCTTAATTGG 59.224 37.037 0.00 0.00 0.00 3.16
693 694 7.775561 CCTCTAACTGCCTTATTCTTAATTGGT 59.224 37.037 0.00 0.00 0.00 3.67
694 695 8.732746 TCTAACTGCCTTATTCTTAATTGGTC 57.267 34.615 0.00 0.00 0.00 4.02
695 696 8.548877 TCTAACTGCCTTATTCTTAATTGGTCT 58.451 33.333 0.00 0.00 0.00 3.85
696 697 9.832445 CTAACTGCCTTATTCTTAATTGGTCTA 57.168 33.333 0.00 0.00 0.00 2.59
697 698 8.738645 AACTGCCTTATTCTTAATTGGTCTAG 57.261 34.615 0.00 0.00 0.00 2.43
698 699 6.768381 ACTGCCTTATTCTTAATTGGTCTAGC 59.232 38.462 0.00 0.00 0.00 3.42
699 700 6.658849 TGCCTTATTCTTAATTGGTCTAGCA 58.341 36.000 0.00 0.00 0.00 3.49
700 701 6.767902 TGCCTTATTCTTAATTGGTCTAGCAG 59.232 38.462 0.00 0.00 0.00 4.24
701 702 6.293680 GCCTTATTCTTAATTGGTCTAGCAGC 60.294 42.308 0.00 0.00 0.00 5.25
702 703 6.767902 CCTTATTCTTAATTGGTCTAGCAGCA 59.232 38.462 0.00 0.00 0.00 4.41
703 704 7.446625 CCTTATTCTTAATTGGTCTAGCAGCAT 59.553 37.037 0.00 0.00 30.77 3.79
704 705 6.630444 ATTCTTAATTGGTCTAGCAGCATG 57.370 37.500 0.00 0.00 40.87 4.06
705 706 5.102953 TCTTAATTGGTCTAGCAGCATGT 57.897 39.130 0.00 0.00 39.31 3.21
706 707 6.233905 TCTTAATTGGTCTAGCAGCATGTA 57.766 37.500 0.00 0.00 39.31 2.29
707 708 6.049149 TCTTAATTGGTCTAGCAGCATGTAC 58.951 40.000 0.00 0.00 39.31 2.90
708 709 3.912496 ATTGGTCTAGCAGCATGTACA 57.088 42.857 0.00 0.00 39.31 2.90
709 710 2.967599 TGGTCTAGCAGCATGTACAG 57.032 50.000 0.33 0.00 39.31 2.74
710 711 1.482182 TGGTCTAGCAGCATGTACAGG 59.518 52.381 2.43 2.43 39.31 4.00
711 712 1.576356 GTCTAGCAGCATGTACAGGC 58.424 55.000 24.30 24.30 39.31 4.85
724 725 7.050281 GCATGTACAGGCTTCTTAATATACG 57.950 40.000 24.40 0.00 34.92 3.06
725 726 6.645415 GCATGTACAGGCTTCTTAATATACGT 59.355 38.462 24.40 0.00 34.92 3.57
726 727 7.811236 GCATGTACAGGCTTCTTAATATACGTA 59.189 37.037 24.40 0.00 34.92 3.57
727 728 9.125906 CATGTACAGGCTTCTTAATATACGTAC 57.874 37.037 0.33 0.00 0.00 3.67
728 729 8.224389 TGTACAGGCTTCTTAATATACGTACA 57.776 34.615 0.00 0.00 34.68 2.90
729 730 8.853126 TGTACAGGCTTCTTAATATACGTACAT 58.147 33.333 0.00 0.00 32.78 2.29
732 733 9.075678 ACAGGCTTCTTAATATACGTACATACT 57.924 33.333 0.00 0.00 0.00 2.12
735 736 9.483062 GGCTTCTTAATATACGTACATACTACG 57.517 37.037 0.00 0.00 45.44 3.51
746 747 6.858104 CGTACATACTACGTCATTTGTTGA 57.142 37.500 0.00 0.00 36.31 3.18
762 763 6.642707 TTTGTTGACAAATGGGTACCTTAG 57.357 37.500 12.72 0.49 44.86 2.18
763 764 5.697067 TTGTTGACAAATGGGTACCTTAGT 58.303 37.500 12.72 3.86 40.78 2.24
764 765 6.839454 TTGTTGACAAATGGGTACCTTAGTA 58.161 36.000 12.72 0.00 40.78 1.82
765 766 7.288560 TTGTTGACAAATGGGTACCTTAGTAA 58.711 34.615 12.72 0.00 40.78 2.24
766 767 7.945664 TTGTTGACAAATGGGTACCTTAGTAAT 59.054 33.333 12.72 0.00 40.78 1.89
775 776 4.117685 GGTACCTTAGTAATTGCTCGTGG 58.882 47.826 4.06 3.81 0.00 4.94
776 777 3.261981 ACCTTAGTAATTGCTCGTGGG 57.738 47.619 0.00 1.40 0.00 4.61
777 778 2.093128 ACCTTAGTAATTGCTCGTGGGG 60.093 50.000 0.00 0.00 0.00 4.96
778 779 2.169769 CCTTAGTAATTGCTCGTGGGGA 59.830 50.000 0.00 0.00 0.00 4.81
779 780 3.458189 CTTAGTAATTGCTCGTGGGGAG 58.542 50.000 0.00 0.00 46.06 4.30
780 781 1.276622 AGTAATTGCTCGTGGGGAGT 58.723 50.000 0.00 0.00 45.03 3.85
781 782 1.628846 AGTAATTGCTCGTGGGGAGTT 59.371 47.619 0.00 0.00 45.03 3.01
782 783 2.007608 GTAATTGCTCGTGGGGAGTTC 58.992 52.381 0.00 0.00 45.03 3.01
783 784 0.322546 AATTGCTCGTGGGGAGTTCC 60.323 55.000 0.00 0.00 45.03 3.62
784 785 1.488705 ATTGCTCGTGGGGAGTTCCA 61.489 55.000 0.00 0.00 45.03 3.53
791 792 3.274823 TGGGGAGTTCCACTTTCCT 57.725 52.632 1.53 0.00 41.04 3.36
792 793 1.529744 TGGGGAGTTCCACTTTCCTT 58.470 50.000 1.53 0.00 41.04 3.36
793 794 1.856920 TGGGGAGTTCCACTTTCCTTT 59.143 47.619 1.53 0.00 41.04 3.11
794 795 2.246327 TGGGGAGTTCCACTTTCCTTTT 59.754 45.455 1.53 0.00 41.04 2.27
795 796 2.628178 GGGGAGTTCCACTTTCCTTTTG 59.372 50.000 0.00 0.00 36.20 2.44
796 797 3.562182 GGGAGTTCCACTTTCCTTTTGA 58.438 45.455 0.00 0.00 37.91 2.69
797 798 3.318275 GGGAGTTCCACTTTCCTTTTGAC 59.682 47.826 0.00 0.00 37.91 3.18
798 799 3.951680 GGAGTTCCACTTTCCTTTTGACA 59.048 43.478 0.00 0.00 35.64 3.58
799 800 4.036852 GGAGTTCCACTTTCCTTTTGACAG 59.963 45.833 0.00 0.00 35.64 3.51
800 801 4.600062 AGTTCCACTTTCCTTTTGACAGT 58.400 39.130 0.00 0.00 34.29 3.55
801 802 5.751586 AGTTCCACTTTCCTTTTGACAGTA 58.248 37.500 0.00 0.00 32.22 2.74
802 803 5.589050 AGTTCCACTTTCCTTTTGACAGTAC 59.411 40.000 0.00 0.00 32.22 2.73
803 804 5.367945 TCCACTTTCCTTTTGACAGTACT 57.632 39.130 0.00 0.00 32.22 2.73
804 805 5.123227 TCCACTTTCCTTTTGACAGTACTG 58.877 41.667 21.44 21.44 32.22 2.74
806 807 6.053005 CCACTTTCCTTTTGACAGTACTGTA 58.947 40.000 27.98 11.50 45.05 2.74
807 808 6.202954 CCACTTTCCTTTTGACAGTACTGTAG 59.797 42.308 27.98 20.25 45.05 2.74
808 809 6.761714 CACTTTCCTTTTGACAGTACTGTAGT 59.238 38.462 27.98 19.90 45.05 2.73
809 810 7.924412 CACTTTCCTTTTGACAGTACTGTAGTA 59.076 37.037 27.98 14.71 45.05 1.82
824 825 6.588348 ACTGTAGTACAAACAAACGTAACC 57.412 37.500 4.21 0.00 0.00 2.85
825 826 6.105333 ACTGTAGTACAAACAAACGTAACCA 58.895 36.000 4.21 0.00 0.00 3.67
826 827 6.762661 ACTGTAGTACAAACAAACGTAACCAT 59.237 34.615 4.21 0.00 0.00 3.55
827 828 7.280652 ACTGTAGTACAAACAAACGTAACCATT 59.719 33.333 4.21 0.00 0.00 3.16
828 829 7.629130 TGTAGTACAAACAAACGTAACCATTC 58.371 34.615 0.00 0.00 0.00 2.67
829 830 5.740406 AGTACAAACAAACGTAACCATTCG 58.260 37.500 0.00 0.00 0.00 3.34
830 831 4.619437 ACAAACAAACGTAACCATTCGT 57.381 36.364 0.00 0.00 42.12 3.85
831 832 5.731599 ACAAACAAACGTAACCATTCGTA 57.268 34.783 0.00 0.00 39.39 3.43
832 833 6.303021 ACAAACAAACGTAACCATTCGTAT 57.697 33.333 0.00 0.00 39.39 3.06
833 834 7.418840 ACAAACAAACGTAACCATTCGTATA 57.581 32.000 0.00 0.00 39.39 1.47
834 835 7.859598 ACAAACAAACGTAACCATTCGTATAA 58.140 30.769 0.00 0.00 39.39 0.98
835 836 8.341173 ACAAACAAACGTAACCATTCGTATAAA 58.659 29.630 0.00 0.00 39.39 1.40
836 837 9.332301 CAAACAAACGTAACCATTCGTATAAAT 57.668 29.630 0.00 0.00 39.39 1.40
837 838 9.896263 AAACAAACGTAACCATTCGTATAAATT 57.104 25.926 0.00 0.00 39.39 1.82
838 839 8.883789 ACAAACGTAACCATTCGTATAAATTG 57.116 30.769 0.00 0.00 39.39 2.32
839 840 7.482428 ACAAACGTAACCATTCGTATAAATTGC 59.518 33.333 0.00 0.00 39.39 3.56
840 841 6.665474 ACGTAACCATTCGTATAAATTGCA 57.335 33.333 0.00 0.00 38.52 4.08
841 842 7.074507 ACGTAACCATTCGTATAAATTGCAA 57.925 32.000 0.00 0.00 38.52 4.08
842 843 7.184106 ACGTAACCATTCGTATAAATTGCAAG 58.816 34.615 4.94 0.00 38.52 4.01
843 844 7.064847 ACGTAACCATTCGTATAAATTGCAAGA 59.935 33.333 4.94 0.00 38.52 3.02
844 845 7.906010 CGTAACCATTCGTATAAATTGCAAGAA 59.094 33.333 4.94 1.14 0.00 2.52
845 846 9.006215 GTAACCATTCGTATAAATTGCAAGAAC 57.994 33.333 4.94 0.00 0.00 3.01
846 847 6.560711 ACCATTCGTATAAATTGCAAGAACC 58.439 36.000 4.94 0.00 0.00 3.62
847 848 5.977129 CCATTCGTATAAATTGCAAGAACCC 59.023 40.000 4.94 0.00 0.00 4.11
848 849 6.183360 CCATTCGTATAAATTGCAAGAACCCT 60.183 38.462 4.94 0.00 0.00 4.34
849 850 6.431198 TTCGTATAAATTGCAAGAACCCTC 57.569 37.500 4.94 0.00 0.00 4.30
850 851 4.879545 TCGTATAAATTGCAAGAACCCTCC 59.120 41.667 4.94 0.00 0.00 4.30
851 852 4.638421 CGTATAAATTGCAAGAACCCTCCA 59.362 41.667 4.94 0.00 0.00 3.86
852 853 5.220854 CGTATAAATTGCAAGAACCCTCCAG 60.221 44.000 4.94 0.00 0.00 3.86
853 854 1.928868 AATTGCAAGAACCCTCCAGG 58.071 50.000 4.94 0.00 43.78 4.45
854 855 0.613012 ATTGCAAGAACCCTCCAGGC 60.613 55.000 4.94 0.00 40.58 4.85
855 856 1.719063 TTGCAAGAACCCTCCAGGCT 61.719 55.000 0.00 0.00 40.58 4.58
856 857 0.840288 TGCAAGAACCCTCCAGGCTA 60.840 55.000 0.00 0.00 40.58 3.93
857 858 0.393132 GCAAGAACCCTCCAGGCTAC 60.393 60.000 0.00 0.00 40.58 3.58
858 859 1.280457 CAAGAACCCTCCAGGCTACT 58.720 55.000 0.00 0.00 40.58 2.57
859 860 2.467880 CAAGAACCCTCCAGGCTACTA 58.532 52.381 0.00 0.00 40.58 1.82
860 861 3.041946 CAAGAACCCTCCAGGCTACTAT 58.958 50.000 0.00 0.00 40.58 2.12
861 862 2.965562 AGAACCCTCCAGGCTACTATC 58.034 52.381 0.00 0.00 40.58 2.08
862 863 1.972075 GAACCCTCCAGGCTACTATCC 59.028 57.143 0.00 0.00 40.58 2.59
863 864 0.191314 ACCCTCCAGGCTACTATCCC 59.809 60.000 0.00 0.00 40.58 3.85
864 865 0.191064 CCCTCCAGGCTACTATCCCA 59.809 60.000 0.00 0.00 0.00 4.37
865 866 1.203364 CCCTCCAGGCTACTATCCCAT 60.203 57.143 0.00 0.00 0.00 4.00
866 867 2.183679 CCTCCAGGCTACTATCCCATC 58.816 57.143 0.00 0.00 0.00 3.51
867 868 2.183679 CTCCAGGCTACTATCCCATCC 58.816 57.143 0.00 0.00 0.00 3.51
868 869 1.507742 TCCAGGCTACTATCCCATCCA 59.492 52.381 0.00 0.00 0.00 3.41
869 870 1.625818 CCAGGCTACTATCCCATCCAC 59.374 57.143 0.00 0.00 0.00 4.02
870 871 2.614259 CAGGCTACTATCCCATCCACT 58.386 52.381 0.00 0.00 0.00 4.00
871 872 2.564947 CAGGCTACTATCCCATCCACTC 59.435 54.545 0.00 0.00 0.00 3.51
872 873 2.452823 AGGCTACTATCCCATCCACTCT 59.547 50.000 0.00 0.00 0.00 3.24
873 874 3.116551 AGGCTACTATCCCATCCACTCTT 60.117 47.826 0.00 0.00 0.00 2.85
874 875 3.259625 GGCTACTATCCCATCCACTCTTC 59.740 52.174 0.00 0.00 0.00 2.87
875 876 3.898123 GCTACTATCCCATCCACTCTTCA 59.102 47.826 0.00 0.00 0.00 3.02
876 877 4.530161 GCTACTATCCCATCCACTCTTCAT 59.470 45.833 0.00 0.00 0.00 2.57
877 878 5.012561 GCTACTATCCCATCCACTCTTCATT 59.987 44.000 0.00 0.00 0.00 2.57
878 879 5.301835 ACTATCCCATCCACTCTTCATTG 57.698 43.478 0.00 0.00 0.00 2.82
879 880 2.425143 TCCCATCCACTCTTCATTGC 57.575 50.000 0.00 0.00 0.00 3.56
880 881 1.634973 TCCCATCCACTCTTCATTGCA 59.365 47.619 0.00 0.00 0.00 4.08
881 882 2.022195 CCCATCCACTCTTCATTGCAG 58.978 52.381 0.00 0.00 0.00 4.41
882 883 1.404391 CCATCCACTCTTCATTGCAGC 59.596 52.381 0.00 0.00 0.00 5.25
883 884 1.404391 CATCCACTCTTCATTGCAGCC 59.596 52.381 0.00 0.00 0.00 4.85
884 885 0.322816 TCCACTCTTCATTGCAGCCC 60.323 55.000 0.00 0.00 0.00 5.19
885 886 0.323178 CCACTCTTCATTGCAGCCCT 60.323 55.000 0.00 0.00 0.00 5.19
886 887 0.809385 CACTCTTCATTGCAGCCCTG 59.191 55.000 0.00 0.00 0.00 4.45
897 898 3.271250 CAGCCCTGCCAAACATACT 57.729 52.632 0.00 0.00 0.00 2.12
898 899 2.418368 CAGCCCTGCCAAACATACTA 57.582 50.000 0.00 0.00 0.00 1.82
899 900 2.936202 CAGCCCTGCCAAACATACTAT 58.064 47.619 0.00 0.00 0.00 2.12
900 901 2.880890 CAGCCCTGCCAAACATACTATC 59.119 50.000 0.00 0.00 0.00 2.08
901 902 2.780010 AGCCCTGCCAAACATACTATCT 59.220 45.455 0.00 0.00 0.00 1.98
902 903 3.142174 GCCCTGCCAAACATACTATCTC 58.858 50.000 0.00 0.00 0.00 2.75
903 904 3.433598 GCCCTGCCAAACATACTATCTCA 60.434 47.826 0.00 0.00 0.00 3.27
904 905 4.130118 CCCTGCCAAACATACTATCTCAC 58.870 47.826 0.00 0.00 0.00 3.51
905 906 3.804325 CCTGCCAAACATACTATCTCACG 59.196 47.826 0.00 0.00 0.00 4.35
906 907 4.441495 CCTGCCAAACATACTATCTCACGA 60.441 45.833 0.00 0.00 0.00 4.35
907 908 4.430007 TGCCAAACATACTATCTCACGAC 58.570 43.478 0.00 0.00 0.00 4.34
908 909 4.159693 TGCCAAACATACTATCTCACGACT 59.840 41.667 0.00 0.00 0.00 4.18
909 910 4.740695 GCCAAACATACTATCTCACGACTC 59.259 45.833 0.00 0.00 0.00 3.36
910 911 5.678871 GCCAAACATACTATCTCACGACTCA 60.679 44.000 0.00 0.00 0.00 3.41
911 912 5.744345 CCAAACATACTATCTCACGACTCAC 59.256 44.000 0.00 0.00 0.00 3.51
913 914 3.002451 ACATACTATCTCACGACTCACGC 59.998 47.826 0.00 0.00 46.94 5.34
914 915 1.450025 ACTATCTCACGACTCACGCA 58.550 50.000 0.00 0.00 46.94 5.24
915 916 1.398739 ACTATCTCACGACTCACGCAG 59.601 52.381 0.00 0.00 46.94 5.18
916 917 1.666189 CTATCTCACGACTCACGCAGA 59.334 52.381 0.00 0.00 46.94 4.26
917 918 0.169230 ATCTCACGACTCACGCAGAC 59.831 55.000 0.00 0.00 46.94 3.51
918 919 1.794003 CTCACGACTCACGCAGACG 60.794 63.158 5.52 5.52 46.94 4.18
930 931 2.872557 CAGACGTGCATGCCAAGG 59.127 61.111 16.68 5.67 0.00 3.61
931 932 1.968017 CAGACGTGCATGCCAAGGT 60.968 57.895 16.68 9.25 0.00 3.50
932 933 1.672356 AGACGTGCATGCCAAGGTC 60.672 57.895 16.68 17.62 32.30 3.85
933 934 3.027170 GACGTGCATGCCAAGGTCG 62.027 63.158 16.68 12.16 0.00 4.79
934 935 2.741985 CGTGCATGCCAAGGTCGA 60.742 61.111 16.68 0.00 0.00 4.20
935 936 2.870372 GTGCATGCCAAGGTCGAC 59.130 61.111 16.68 7.13 0.00 4.20
936 937 1.672356 GTGCATGCCAAGGTCGACT 60.672 57.895 16.68 0.00 0.00 4.18
937 938 1.073025 TGCATGCCAAGGTCGACTT 59.927 52.632 16.68 4.52 41.00 3.01
944 945 2.665185 AAGGTCGACTTGCACGCC 60.665 61.111 16.46 0.00 38.21 5.68
947 948 2.809601 GTCGACTTGCACGCCGAT 60.810 61.111 8.70 0.00 33.47 4.18
948 949 2.506217 TCGACTTGCACGCCGATC 60.506 61.111 0.00 0.00 0.00 3.69
949 950 3.902063 CGACTTGCACGCCGATCG 61.902 66.667 8.51 8.51 45.38 3.69
950 951 2.506217 GACTTGCACGCCGATCGA 60.506 61.111 18.66 0.00 41.67 3.59
951 952 2.789203 GACTTGCACGCCGATCGAC 61.789 63.158 18.66 3.27 41.67 4.20
952 953 2.507102 CTTGCACGCCGATCGACT 60.507 61.111 18.66 0.00 41.67 4.18
953 954 1.226575 CTTGCACGCCGATCGACTA 60.227 57.895 18.66 0.00 41.67 2.59
954 955 1.472276 CTTGCACGCCGATCGACTAC 61.472 60.000 18.66 2.37 41.67 2.73
955 956 2.101575 GCACGCCGATCGACTACA 59.898 61.111 18.66 0.00 41.67 2.74
956 957 1.939785 GCACGCCGATCGACTACAG 60.940 63.158 18.66 0.00 41.67 2.74
957 958 1.939785 CACGCCGATCGACTACAGC 60.940 63.158 18.66 9.27 41.67 4.40
958 959 2.353607 CGCCGATCGACTACAGCC 60.354 66.667 18.66 0.00 41.67 4.85
959 960 2.835705 CGCCGATCGACTACAGCCT 61.836 63.158 18.66 0.00 41.67 4.58
960 961 1.299468 GCCGATCGACTACAGCCTG 60.299 63.158 18.66 0.00 0.00 4.85
961 962 1.299468 CCGATCGACTACAGCCTGC 60.299 63.158 18.66 0.00 0.00 4.85
962 963 1.299468 CGATCGACTACAGCCTGCC 60.299 63.158 10.26 0.00 0.00 4.85
963 964 1.729470 CGATCGACTACAGCCTGCCT 61.729 60.000 10.26 0.00 0.00 4.75
964 965 0.031449 GATCGACTACAGCCTGCCTC 59.969 60.000 0.00 0.00 0.00 4.70
965 966 1.729470 ATCGACTACAGCCTGCCTCG 61.729 60.000 0.00 0.00 0.00 4.63
966 967 2.496817 GACTACAGCCTGCCTCGG 59.503 66.667 0.00 0.00 0.00 4.63
974 975 4.208686 CCTGCCTCGGCCGTCTAC 62.209 72.222 27.15 13.84 41.09 2.59
975 976 4.208686 CTGCCTCGGCCGTCTACC 62.209 72.222 27.15 10.79 41.09 3.18
1003 1004 4.079446 ACGGCTGTGAAACCATGG 57.921 55.556 11.19 11.19 34.36 3.66
1004 1005 1.454104 ACGGCTGTGAAACCATGGA 59.546 52.632 21.47 0.00 34.36 3.41
1005 1006 0.889186 ACGGCTGTGAAACCATGGAC 60.889 55.000 21.47 6.54 34.36 4.02
1006 1007 0.888736 CGGCTGTGAAACCATGGACA 60.889 55.000 21.47 11.44 34.36 4.02
1007 1008 0.598065 GGCTGTGAAACCATGGACAC 59.402 55.000 21.47 22.84 34.36 3.67
1008 1009 1.609208 GCTGTGAAACCATGGACACT 58.391 50.000 27.10 9.95 34.36 3.55
1009 1010 1.267806 GCTGTGAAACCATGGACACTG 59.732 52.381 27.10 26.54 34.36 3.66
1010 1011 1.267806 CTGTGAAACCATGGACACTGC 59.732 52.381 27.10 13.20 34.36 4.40
1011 1012 1.133823 TGTGAAACCATGGACACTGCT 60.134 47.619 27.10 3.60 34.36 4.24
1012 1013 2.105649 TGTGAAACCATGGACACTGCTA 59.894 45.455 27.10 14.20 34.36 3.49
1013 1014 2.484264 GTGAAACCATGGACACTGCTAC 59.516 50.000 21.47 2.59 0.00 3.58
1014 1015 2.105649 TGAAACCATGGACACTGCTACA 59.894 45.455 21.47 2.50 0.00 2.74
1015 1016 2.479566 AACCATGGACACTGCTACAG 57.520 50.000 21.47 0.00 37.52 2.74
1016 1017 1.352083 ACCATGGACACTGCTACAGT 58.648 50.000 21.47 0.00 46.51 3.55
1025 1026 2.929531 ACTGCTACAGTGATCGAGTG 57.070 50.000 0.00 0.00 43.63 3.51
1026 1027 2.163509 ACTGCTACAGTGATCGAGTGT 58.836 47.619 0.00 9.57 43.63 3.55
1027 1028 2.558795 ACTGCTACAGTGATCGAGTGTT 59.441 45.455 0.00 0.00 43.63 3.32
1028 1029 3.005897 ACTGCTACAGTGATCGAGTGTTT 59.994 43.478 0.00 0.00 43.63 2.83
1029 1030 3.575630 TGCTACAGTGATCGAGTGTTTC 58.424 45.455 0.00 5.02 39.16 2.78
1030 1031 3.005367 TGCTACAGTGATCGAGTGTTTCA 59.995 43.478 0.00 6.81 39.16 2.69
1031 1032 3.610242 GCTACAGTGATCGAGTGTTTCAG 59.390 47.826 0.00 4.83 39.16 3.02
1032 1033 3.032017 ACAGTGATCGAGTGTTTCAGG 57.968 47.619 0.00 0.00 34.24 3.86
1033 1034 2.628178 ACAGTGATCGAGTGTTTCAGGA 59.372 45.455 0.00 0.00 34.24 3.86
1034 1035 3.069586 ACAGTGATCGAGTGTTTCAGGAA 59.930 43.478 0.00 0.00 34.24 3.36
1035 1036 3.430218 CAGTGATCGAGTGTTTCAGGAAC 59.570 47.826 0.00 0.00 38.78 3.62
1036 1037 3.069586 AGTGATCGAGTGTTTCAGGAACA 59.930 43.478 0.00 0.00 45.70 3.18
1045 1046 3.149196 TGTTTCAGGAACAAGAGCATCC 58.851 45.455 0.00 0.00 44.95 3.51
1046 1047 3.181440 TGTTTCAGGAACAAGAGCATCCT 60.181 43.478 0.00 0.00 44.95 3.24
1047 1048 4.041567 TGTTTCAGGAACAAGAGCATCCTA 59.958 41.667 0.00 0.00 44.95 2.94
1048 1049 4.908601 TTCAGGAACAAGAGCATCCTAA 57.091 40.909 0.00 0.00 41.63 2.69
1049 1050 5.441718 TTCAGGAACAAGAGCATCCTAAT 57.558 39.130 0.00 0.00 41.63 1.73
1050 1051 5.028549 TCAGGAACAAGAGCATCCTAATC 57.971 43.478 0.00 0.00 41.63 1.75
1051 1052 4.471025 TCAGGAACAAGAGCATCCTAATCA 59.529 41.667 0.00 0.00 41.63 2.57
1052 1053 4.574013 CAGGAACAAGAGCATCCTAATCAC 59.426 45.833 0.00 0.00 41.63 3.06
1053 1054 3.879892 GGAACAAGAGCATCCTAATCACC 59.120 47.826 0.00 0.00 33.66 4.02
1054 1055 3.185246 ACAAGAGCATCCTAATCACCG 57.815 47.619 0.00 0.00 33.66 4.94
1055 1056 2.158900 ACAAGAGCATCCTAATCACCGG 60.159 50.000 0.00 0.00 33.66 5.28
1056 1057 0.394565 AGAGCATCCTAATCACCGGC 59.605 55.000 0.00 0.00 33.66 6.13
1057 1058 0.394565 GAGCATCCTAATCACCGGCT 59.605 55.000 0.00 0.00 0.00 5.52
1058 1059 0.394565 AGCATCCTAATCACCGGCTC 59.605 55.000 0.00 0.00 0.00 4.70
1059 1060 0.946221 GCATCCTAATCACCGGCTCG 60.946 60.000 0.00 0.00 0.00 5.03
1060 1061 0.673985 CATCCTAATCACCGGCTCGA 59.326 55.000 0.00 0.00 0.00 4.04
1061 1062 0.674534 ATCCTAATCACCGGCTCGAC 59.325 55.000 0.00 0.00 0.00 4.20
1062 1063 0.681887 TCCTAATCACCGGCTCGACA 60.682 55.000 0.00 0.00 0.00 4.35
1063 1064 0.249073 CCTAATCACCGGCTCGACAG 60.249 60.000 0.00 0.00 0.00 3.51
1064 1065 0.249073 CTAATCACCGGCTCGACAGG 60.249 60.000 0.00 3.43 39.94 4.00
1065 1066 2.292794 TAATCACCGGCTCGACAGGC 62.293 60.000 0.00 0.00 41.98 4.85
1067 1068 4.379243 CACCGGCTCGACAGGCTT 62.379 66.667 0.00 0.00 43.28 4.35
1068 1069 4.070552 ACCGGCTCGACAGGCTTC 62.071 66.667 0.00 0.00 43.28 3.86
1070 1071 4.421479 CGGCTCGACAGGCTTCGT 62.421 66.667 15.24 0.00 43.28 3.85
1071 1072 2.507324 GGCTCGACAGGCTTCGTC 60.507 66.667 15.24 6.88 42.14 4.20
1076 1077 2.654877 GACAGGCTTCGTCGGGAA 59.345 61.111 0.00 0.00 0.00 3.97
1077 1078 1.005394 GACAGGCTTCGTCGGGAAA 60.005 57.895 0.00 0.00 33.34 3.13
1078 1079 0.601841 GACAGGCTTCGTCGGGAAAA 60.602 55.000 0.00 0.00 33.34 2.29
1079 1080 0.602905 ACAGGCTTCGTCGGGAAAAG 60.603 55.000 0.00 0.00 33.34 2.27
1080 1081 0.602905 CAGGCTTCGTCGGGAAAAGT 60.603 55.000 0.00 0.00 33.34 2.66
1081 1082 0.971386 AGGCTTCGTCGGGAAAAGTA 59.029 50.000 0.00 0.00 33.34 2.24
1082 1083 1.073964 GGCTTCGTCGGGAAAAGTAC 58.926 55.000 0.00 0.00 33.34 2.73
1083 1084 1.606224 GGCTTCGTCGGGAAAAGTACA 60.606 52.381 0.00 0.00 33.34 2.90
1084 1085 2.344025 GCTTCGTCGGGAAAAGTACAT 58.656 47.619 0.00 0.00 33.34 2.29
1085 1086 3.514645 GCTTCGTCGGGAAAAGTACATA 58.485 45.455 0.00 0.00 33.34 2.29
1086 1087 3.305361 GCTTCGTCGGGAAAAGTACATAC 59.695 47.826 0.00 0.00 33.34 2.39
1087 1088 3.135414 TCGTCGGGAAAAGTACATACG 57.865 47.619 0.00 0.00 0.00 3.06
1088 1089 1.585214 CGTCGGGAAAAGTACATACGC 59.415 52.381 0.00 0.00 0.00 4.42
1089 1090 1.929169 GTCGGGAAAAGTACATACGCC 59.071 52.381 0.00 0.00 0.00 5.68
1090 1091 1.826720 TCGGGAAAAGTACATACGCCT 59.173 47.619 0.00 0.00 0.00 5.52
1091 1092 2.159198 TCGGGAAAAGTACATACGCCTC 60.159 50.000 0.00 0.00 0.00 4.70
1092 1093 2.159142 CGGGAAAAGTACATACGCCTCT 60.159 50.000 0.00 0.00 0.00 3.69
1093 1094 3.677976 CGGGAAAAGTACATACGCCTCTT 60.678 47.826 0.00 0.00 0.00 2.85
1094 1095 4.259356 GGGAAAAGTACATACGCCTCTTT 58.741 43.478 0.00 0.00 0.00 2.52
1095 1096 5.422145 GGGAAAAGTACATACGCCTCTTTA 58.578 41.667 0.00 0.00 0.00 1.85
1096 1097 6.053650 GGGAAAAGTACATACGCCTCTTTAT 58.946 40.000 0.00 0.00 0.00 1.40
1097 1098 7.212274 GGGAAAAGTACATACGCCTCTTTATA 58.788 38.462 0.00 0.00 0.00 0.98
1098 1099 7.712205 GGGAAAAGTACATACGCCTCTTTATAA 59.288 37.037 0.00 0.00 0.00 0.98
1099 1100 8.762426 GGAAAAGTACATACGCCTCTTTATAAG 58.238 37.037 0.00 0.00 0.00 1.73
1100 1101 9.310716 GAAAAGTACATACGCCTCTTTATAAGT 57.689 33.333 0.00 0.00 0.00 2.24
1102 1103 9.962783 AAAGTACATACGCCTCTTTATAAGTAG 57.037 33.333 0.00 0.00 0.00 2.57
1103 1104 8.915057 AGTACATACGCCTCTTTATAAGTAGA 57.085 34.615 0.00 0.00 0.00 2.59
1104 1105 9.517868 AGTACATACGCCTCTTTATAAGTAGAT 57.482 33.333 0.00 0.00 0.00 1.98
1111 1112 9.517868 ACGCCTCTTTATAAGTAGATATACACT 57.482 33.333 0.00 0.00 0.00 3.55
1152 1153 7.913789 ACAGTAGGTATACATTCCAGTTTTCA 58.086 34.615 5.01 0.00 34.07 2.69
1153 1154 8.380099 ACAGTAGGTATACATTCCAGTTTTCAA 58.620 33.333 5.01 0.00 34.07 2.69
1154 1155 8.883731 CAGTAGGTATACATTCCAGTTTTCAAG 58.116 37.037 5.01 0.00 34.07 3.02
1155 1156 8.603304 AGTAGGTATACATTCCAGTTTTCAAGT 58.397 33.333 5.01 0.00 34.07 3.16
1156 1157 7.923414 AGGTATACATTCCAGTTTTCAAGTC 57.077 36.000 5.01 0.00 0.00 3.01
1157 1158 6.884836 AGGTATACATTCCAGTTTTCAAGTCC 59.115 38.462 5.01 0.00 0.00 3.85
1158 1159 6.095021 GGTATACATTCCAGTTTTCAAGTCCC 59.905 42.308 5.01 0.00 0.00 4.46
1159 1160 3.909732 ACATTCCAGTTTTCAAGTCCCA 58.090 40.909 0.00 0.00 0.00 4.37
1160 1161 4.285863 ACATTCCAGTTTTCAAGTCCCAA 58.714 39.130 0.00 0.00 0.00 4.12
1161 1162 4.714308 ACATTCCAGTTTTCAAGTCCCAAA 59.286 37.500 0.00 0.00 0.00 3.28
1162 1163 5.163416 ACATTCCAGTTTTCAAGTCCCAAAG 60.163 40.000 0.00 0.00 0.00 2.77
1163 1164 4.243793 TCCAGTTTTCAAGTCCCAAAGA 57.756 40.909 0.00 0.00 0.00 2.52
1164 1165 4.605183 TCCAGTTTTCAAGTCCCAAAGAA 58.395 39.130 0.00 0.00 0.00 2.52
1165 1166 5.020132 TCCAGTTTTCAAGTCCCAAAGAAA 58.980 37.500 0.00 0.00 0.00 2.52
1166 1167 5.482175 TCCAGTTTTCAAGTCCCAAAGAAAA 59.518 36.000 0.00 0.00 37.56 2.29
1167 1168 6.014156 TCCAGTTTTCAAGTCCCAAAGAAAAA 60.014 34.615 0.00 0.00 40.41 1.94
1168 1169 6.313658 CCAGTTTTCAAGTCCCAAAGAAAAAG 59.686 38.462 0.00 0.00 40.41 2.27
1169 1170 7.096551 CAGTTTTCAAGTCCCAAAGAAAAAGA 58.903 34.615 0.00 0.00 40.41 2.52
1170 1171 7.276438 CAGTTTTCAAGTCCCAAAGAAAAAGAG 59.724 37.037 0.00 0.00 40.41 2.85
1171 1172 7.178451 AGTTTTCAAGTCCCAAAGAAAAAGAGA 59.822 33.333 0.00 0.00 40.41 3.10
1172 1173 7.475137 TTTCAAGTCCCAAAGAAAAAGAGAA 57.525 32.000 0.00 0.00 0.00 2.87
1173 1174 6.451064 TCAAGTCCCAAAGAAAAAGAGAAC 57.549 37.500 0.00 0.00 0.00 3.01
1174 1175 6.187682 TCAAGTCCCAAAGAAAAAGAGAACT 58.812 36.000 0.00 0.00 0.00 3.01
1175 1176 7.343357 TCAAGTCCCAAAGAAAAAGAGAACTA 58.657 34.615 0.00 0.00 0.00 2.24
1176 1177 7.282450 TCAAGTCCCAAAGAAAAAGAGAACTAC 59.718 37.037 0.00 0.00 0.00 2.73
1177 1178 6.062749 AGTCCCAAAGAAAAAGAGAACTACC 58.937 40.000 0.00 0.00 0.00 3.18
1178 1179 6.062749 GTCCCAAAGAAAAAGAGAACTACCT 58.937 40.000 0.00 0.00 0.00 3.08
1179 1180 6.205076 GTCCCAAAGAAAAAGAGAACTACCTC 59.795 42.308 0.00 0.00 0.00 3.85
1180 1181 6.062095 CCCAAAGAAAAAGAGAACTACCTCA 58.938 40.000 0.00 0.00 35.68 3.86
1181 1182 6.546034 CCCAAAGAAAAAGAGAACTACCTCAA 59.454 38.462 0.00 0.00 35.68 3.02
1182 1183 7.255277 CCCAAAGAAAAAGAGAACTACCTCAAG 60.255 40.741 0.00 0.00 35.68 3.02
1183 1184 7.499232 CCAAAGAAAAAGAGAACTACCTCAAGA 59.501 37.037 0.00 0.00 35.68 3.02
1184 1185 8.893727 CAAAGAAAAAGAGAACTACCTCAAGAA 58.106 33.333 0.00 0.00 35.68 2.52
1185 1186 9.634021 AAAGAAAAAGAGAACTACCTCAAGAAT 57.366 29.630 0.00 0.00 35.68 2.40
1186 1187 9.634021 AAGAAAAAGAGAACTACCTCAAGAATT 57.366 29.630 0.00 0.00 35.68 2.17
1187 1188 9.634021 AGAAAAAGAGAACTACCTCAAGAATTT 57.366 29.630 0.00 0.00 35.68 1.82
1188 1189 9.670719 GAAAAAGAGAACTACCTCAAGAATTTG 57.329 33.333 0.00 0.00 35.68 2.32
1189 1190 8.980481 AAAAGAGAACTACCTCAAGAATTTGA 57.020 30.769 0.00 0.00 40.92 2.69
1190 1191 8.980481 AAAGAGAACTACCTCAAGAATTTGAA 57.020 30.769 0.00 0.00 42.48 2.69
1191 1192 8.980481 AAGAGAACTACCTCAAGAATTTGAAA 57.020 30.769 0.00 0.00 42.48 2.69
1192 1193 8.980481 AGAGAACTACCTCAAGAATTTGAAAA 57.020 30.769 0.00 0.00 42.48 2.29
1193 1194 8.841300 AGAGAACTACCTCAAGAATTTGAAAAC 58.159 33.333 0.00 0.00 42.48 2.43
1194 1195 8.519799 AGAACTACCTCAAGAATTTGAAAACA 57.480 30.769 0.00 0.00 42.48 2.83
1195 1196 8.624776 AGAACTACCTCAAGAATTTGAAAACAG 58.375 33.333 0.00 0.00 42.48 3.16
1196 1197 8.519799 AACTACCTCAAGAATTTGAAAACAGA 57.480 30.769 0.00 0.00 42.48 3.41
1197 1198 8.519799 ACTACCTCAAGAATTTGAAAACAGAA 57.480 30.769 0.00 0.00 42.48 3.02
1198 1199 8.406297 ACTACCTCAAGAATTTGAAAACAGAAC 58.594 33.333 0.00 0.00 42.48 3.01
1199 1200 7.169158 ACCTCAAGAATTTGAAAACAGAACA 57.831 32.000 0.00 0.00 42.48 3.18
1200 1201 7.260603 ACCTCAAGAATTTGAAAACAGAACAG 58.739 34.615 0.00 0.00 42.48 3.16
1201 1202 6.698766 CCTCAAGAATTTGAAAACAGAACAGG 59.301 38.462 0.00 0.00 42.48 4.00
1202 1203 6.042143 TCAAGAATTTGAAAACAGAACAGGC 58.958 36.000 0.00 0.00 40.26 4.85
1203 1204 5.596836 AGAATTTGAAAACAGAACAGGCA 57.403 34.783 0.00 0.00 0.00 4.75
1204 1205 5.976458 AGAATTTGAAAACAGAACAGGCAA 58.024 33.333 0.00 0.00 0.00 4.52
1205 1206 6.585416 AGAATTTGAAAACAGAACAGGCAAT 58.415 32.000 0.00 0.00 0.00 3.56
1206 1207 7.725251 AGAATTTGAAAACAGAACAGGCAATA 58.275 30.769 0.00 0.00 0.00 1.90
1207 1208 7.869429 AGAATTTGAAAACAGAACAGGCAATAG 59.131 33.333 0.00 0.00 0.00 1.73
1208 1209 4.503741 TGAAAACAGAACAGGCAATAGC 57.496 40.909 0.00 0.00 41.10 2.97
1209 1210 4.144297 TGAAAACAGAACAGGCAATAGCT 58.856 39.130 0.00 0.00 41.70 3.32
1210 1211 5.312895 TGAAAACAGAACAGGCAATAGCTA 58.687 37.500 0.00 0.00 41.70 3.32
1211 1212 5.412594 TGAAAACAGAACAGGCAATAGCTAG 59.587 40.000 0.00 0.00 41.70 3.42
1212 1213 3.550437 ACAGAACAGGCAATAGCTAGG 57.450 47.619 0.00 0.00 41.70 3.02
1213 1214 2.840651 ACAGAACAGGCAATAGCTAGGT 59.159 45.455 0.00 0.00 41.70 3.08
1214 1215 3.264450 ACAGAACAGGCAATAGCTAGGTT 59.736 43.478 0.00 0.00 41.70 3.50
1215 1216 3.873952 CAGAACAGGCAATAGCTAGGTTC 59.126 47.826 0.00 6.38 41.14 3.62
1216 1217 3.777522 AGAACAGGCAATAGCTAGGTTCT 59.222 43.478 0.00 8.35 43.46 3.01
1217 1218 4.962995 AGAACAGGCAATAGCTAGGTTCTA 59.037 41.667 15.76 0.00 44.82 2.10
1218 1219 5.425539 AGAACAGGCAATAGCTAGGTTCTAA 59.574 40.000 15.76 0.00 44.82 2.10
1219 1220 5.896073 ACAGGCAATAGCTAGGTTCTAAT 57.104 39.130 0.00 0.00 41.70 1.73
1220 1221 5.615289 ACAGGCAATAGCTAGGTTCTAATG 58.385 41.667 0.00 0.00 41.70 1.90
1221 1222 5.131142 ACAGGCAATAGCTAGGTTCTAATGT 59.869 40.000 0.00 0.00 41.70 2.71
1222 1223 5.698545 CAGGCAATAGCTAGGTTCTAATGTC 59.301 44.000 0.00 0.00 41.70 3.06
1223 1224 5.604650 AGGCAATAGCTAGGTTCTAATGTCT 59.395 40.000 0.00 0.00 41.70 3.41
1224 1225 5.929415 GGCAATAGCTAGGTTCTAATGTCTC 59.071 44.000 0.00 0.00 41.70 3.36
1225 1226 6.463049 GGCAATAGCTAGGTTCTAATGTCTCA 60.463 42.308 0.00 0.00 41.70 3.27
1226 1227 7.158021 GCAATAGCTAGGTTCTAATGTCTCAT 58.842 38.462 0.00 0.00 37.91 2.90
1227 1228 8.307483 GCAATAGCTAGGTTCTAATGTCTCATA 58.693 37.037 0.00 0.00 37.91 2.15
1228 1229 9.632807 CAATAGCTAGGTTCTAATGTCTCATAC 57.367 37.037 0.00 0.00 0.00 2.39
1229 1230 8.941995 ATAGCTAGGTTCTAATGTCTCATACA 57.058 34.615 0.00 0.00 43.86 2.29
1230 1231 7.283625 AGCTAGGTTCTAATGTCTCATACAG 57.716 40.000 0.00 0.00 42.70 2.74
1231 1232 5.923684 GCTAGGTTCTAATGTCTCATACAGC 59.076 44.000 0.00 0.00 42.70 4.40
1232 1233 6.239176 GCTAGGTTCTAATGTCTCATACAGCT 60.239 42.308 0.00 0.00 42.70 4.24
1233 1234 7.040340 GCTAGGTTCTAATGTCTCATACAGCTA 60.040 40.741 0.00 0.00 42.70 3.32
1234 1235 7.283625 AGGTTCTAATGTCTCATACAGCTAG 57.716 40.000 0.00 0.00 42.70 3.42
1235 1236 5.923684 GGTTCTAATGTCTCATACAGCTAGC 59.076 44.000 6.62 6.62 42.70 3.42
1236 1237 5.363979 TCTAATGTCTCATACAGCTAGCG 57.636 43.478 9.55 7.05 42.70 4.26
1237 1238 4.822350 TCTAATGTCTCATACAGCTAGCGT 59.178 41.667 9.55 12.78 42.70 5.07
1238 1239 2.851805 TGTCTCATACAGCTAGCGTG 57.148 50.000 18.37 14.86 33.01 5.34
1239 1240 1.202302 TGTCTCATACAGCTAGCGTGC 60.202 52.381 18.37 0.00 33.01 5.34
1240 1241 1.066303 GTCTCATACAGCTAGCGTGCT 59.934 52.381 18.37 0.00 45.18 4.40
1241 1242 2.290916 GTCTCATACAGCTAGCGTGCTA 59.709 50.000 18.37 1.07 41.98 3.49
1242 1243 3.057876 GTCTCATACAGCTAGCGTGCTAT 60.058 47.826 18.37 10.68 41.98 2.97
1243 1244 3.570125 TCTCATACAGCTAGCGTGCTATT 59.430 43.478 18.37 0.52 41.98 1.73
1244 1245 3.902150 TCATACAGCTAGCGTGCTATTC 58.098 45.455 18.37 0.00 41.98 1.75
1245 1246 3.317993 TCATACAGCTAGCGTGCTATTCA 59.682 43.478 18.37 1.82 41.98 2.57
1246 1247 2.898729 ACAGCTAGCGTGCTATTCAT 57.101 45.000 9.55 0.00 41.98 2.57
1247 1248 2.477825 ACAGCTAGCGTGCTATTCATG 58.522 47.619 9.55 0.12 41.98 3.07
1248 1249 2.101415 ACAGCTAGCGTGCTATTCATGA 59.899 45.455 9.55 0.00 41.98 3.07
1249 1250 3.244009 ACAGCTAGCGTGCTATTCATGAT 60.244 43.478 9.55 0.00 41.98 2.45
1250 1251 3.367327 CAGCTAGCGTGCTATTCATGATC 59.633 47.826 9.55 0.00 41.98 2.92
1251 1252 3.006217 AGCTAGCGTGCTATTCATGATCA 59.994 43.478 9.55 0.00 42.10 2.92
1252 1253 3.742882 GCTAGCGTGCTATTCATGATCAA 59.257 43.478 0.00 0.00 33.49 2.57
1253 1254 4.391216 GCTAGCGTGCTATTCATGATCAAT 59.609 41.667 0.00 0.00 33.49 2.57
1254 1255 5.578336 GCTAGCGTGCTATTCATGATCAATA 59.422 40.000 0.00 0.00 33.49 1.90
1255 1256 6.257411 GCTAGCGTGCTATTCATGATCAATAT 59.743 38.462 0.00 0.00 33.49 1.28
1256 1257 7.201591 GCTAGCGTGCTATTCATGATCAATATT 60.202 37.037 0.00 0.00 33.49 1.28
1257 1258 6.839033 AGCGTGCTATTCATGATCAATATTG 58.161 36.000 9.29 9.29 33.49 1.90
1258 1259 6.652062 AGCGTGCTATTCATGATCAATATTGA 59.348 34.615 20.07 20.07 35.53 2.57
1259 1260 7.173735 AGCGTGCTATTCATGATCAATATTGAA 59.826 33.333 21.50 10.95 35.09 2.69
1260 1261 7.804600 GCGTGCTATTCATGATCAATATTGAAA 59.195 33.333 21.50 13.41 35.09 2.69
1261 1262 9.110617 CGTGCTATTCATGATCAATATTGAAAC 57.889 33.333 21.50 17.58 41.13 2.78
1262 1263 9.110617 GTGCTATTCATGATCAATATTGAAACG 57.889 33.333 21.50 10.81 41.13 3.60
1263 1264 9.054922 TGCTATTCATGATCAATATTGAAACGA 57.945 29.630 21.50 12.73 41.13 3.85
1264 1265 9.882996 GCTATTCATGATCAATATTGAAACGAA 57.117 29.630 21.50 19.21 41.13 3.85
1272 1273 9.777297 TGATCAATATTGAAACGAAGATATGGA 57.223 29.630 21.50 0.00 41.13 3.41
1280 1281 8.731275 TTGAAACGAAGATATGGATATTGTGT 57.269 30.769 0.00 0.00 0.00 3.72
1281 1282 8.141835 TGAAACGAAGATATGGATATTGTGTG 57.858 34.615 0.00 0.00 0.00 3.82
1282 1283 7.984617 TGAAACGAAGATATGGATATTGTGTGA 59.015 33.333 0.00 0.00 0.00 3.58
1283 1284 7.953158 AACGAAGATATGGATATTGTGTGAG 57.047 36.000 0.00 0.00 0.00 3.51
1284 1285 6.459066 ACGAAGATATGGATATTGTGTGAGG 58.541 40.000 0.00 0.00 0.00 3.86
1285 1286 5.349817 CGAAGATATGGATATTGTGTGAGGC 59.650 44.000 0.00 0.00 0.00 4.70
1286 1287 5.830799 AGATATGGATATTGTGTGAGGCA 57.169 39.130 0.00 0.00 0.00 4.75
1287 1288 5.802465 AGATATGGATATTGTGTGAGGCAG 58.198 41.667 0.00 0.00 0.00 4.85
1288 1289 3.939740 ATGGATATTGTGTGAGGCAGT 57.060 42.857 0.00 0.00 0.00 4.40
1289 1290 2.989909 TGGATATTGTGTGAGGCAGTG 58.010 47.619 0.00 0.00 0.00 3.66
1290 1291 1.672881 GGATATTGTGTGAGGCAGTGC 59.327 52.381 6.55 6.55 0.00 4.40
1291 1292 2.636830 GATATTGTGTGAGGCAGTGCT 58.363 47.619 16.11 0.33 0.00 4.40
1292 1293 1.812235 TATTGTGTGAGGCAGTGCTG 58.188 50.000 16.11 0.00 0.00 4.41
1293 1294 0.892358 ATTGTGTGAGGCAGTGCTGG 60.892 55.000 16.11 0.00 0.00 4.85
1294 1295 2.111878 GTGTGAGGCAGTGCTGGT 59.888 61.111 16.11 0.00 0.00 4.00
1295 1296 2.111669 TGTGAGGCAGTGCTGGTG 59.888 61.111 16.11 0.00 0.00 4.17
1296 1297 2.670934 GTGAGGCAGTGCTGGTGG 60.671 66.667 16.11 0.00 0.00 4.61
1297 1298 2.848679 TGAGGCAGTGCTGGTGGA 60.849 61.111 16.11 0.00 0.00 4.02
1298 1299 2.046507 GAGGCAGTGCTGGTGGAG 60.047 66.667 16.11 0.00 0.00 3.86
1299 1300 2.527624 AGGCAGTGCTGGTGGAGA 60.528 61.111 16.11 0.00 0.00 3.71
1300 1301 2.116983 GAGGCAGTGCTGGTGGAGAA 62.117 60.000 16.11 0.00 0.00 2.87
1301 1302 1.673665 GGCAGTGCTGGTGGAGAAG 60.674 63.158 16.11 0.00 0.00 2.85
1302 1303 1.372683 GCAGTGCTGGTGGAGAAGA 59.627 57.895 8.18 0.00 0.00 2.87
1303 1304 0.035630 GCAGTGCTGGTGGAGAAGAT 60.036 55.000 8.18 0.00 0.00 2.40
1304 1305 1.208052 GCAGTGCTGGTGGAGAAGATA 59.792 52.381 8.18 0.00 0.00 1.98
1305 1306 2.898705 CAGTGCTGGTGGAGAAGATAC 58.101 52.381 0.00 0.00 0.00 2.24
1306 1307 2.499289 CAGTGCTGGTGGAGAAGATACT 59.501 50.000 0.00 0.00 0.00 2.12
1307 1308 2.499289 AGTGCTGGTGGAGAAGATACTG 59.501 50.000 0.00 0.00 0.00 2.74
1308 1309 2.497675 GTGCTGGTGGAGAAGATACTGA 59.502 50.000 0.00 0.00 0.00 3.41
1309 1310 2.762887 TGCTGGTGGAGAAGATACTGAG 59.237 50.000 0.00 0.00 0.00 3.35
1310 1311 2.102252 GCTGGTGGAGAAGATACTGAGG 59.898 54.545 0.00 0.00 0.00 3.86
1311 1312 2.697751 CTGGTGGAGAAGATACTGAGGG 59.302 54.545 0.00 0.00 0.00 4.30
1312 1313 2.044492 TGGTGGAGAAGATACTGAGGGT 59.956 50.000 0.00 0.00 0.00 4.34
1313 1314 3.108376 GGTGGAGAAGATACTGAGGGTT 58.892 50.000 0.00 0.00 0.00 4.11
1314 1315 3.133183 GGTGGAGAAGATACTGAGGGTTC 59.867 52.174 0.00 0.00 0.00 3.62
1315 1316 3.769844 GTGGAGAAGATACTGAGGGTTCA 59.230 47.826 0.00 0.00 0.00 3.18
1322 1323 3.313874 CTGAGGGTTCAGCCGGAT 58.686 61.111 5.05 0.00 43.98 4.18
1323 1324 1.153289 CTGAGGGTTCAGCCGGATG 60.153 63.158 15.12 15.12 43.98 3.51
1324 1325 1.903877 CTGAGGGTTCAGCCGGATGT 61.904 60.000 20.97 0.00 43.98 3.06
1325 1326 1.450312 GAGGGTTCAGCCGGATGTG 60.450 63.158 20.97 6.05 38.44 3.21
1326 1327 1.899437 GAGGGTTCAGCCGGATGTGA 61.899 60.000 20.97 8.61 38.44 3.58
1327 1328 1.002624 GGGTTCAGCCGGATGTGAA 60.003 57.895 20.97 14.39 38.44 3.18
1328 1329 1.026718 GGGTTCAGCCGGATGTGAAG 61.027 60.000 20.97 0.00 38.44 3.02
1329 1330 0.036388 GGTTCAGCCGGATGTGAAGA 60.036 55.000 20.97 0.00 33.37 2.87
1330 1331 1.610624 GGTTCAGCCGGATGTGAAGAA 60.611 52.381 20.97 2.70 33.37 2.52
1331 1332 1.734465 GTTCAGCCGGATGTGAAGAAG 59.266 52.381 20.97 0.00 33.37 2.85
1332 1333 0.391661 TCAGCCGGATGTGAAGAAGC 60.392 55.000 20.97 0.00 0.00 3.86
1333 1334 0.392193 CAGCCGGATGTGAAGAAGCT 60.392 55.000 12.68 0.00 0.00 3.74
1334 1335 0.107945 AGCCGGATGTGAAGAAGCTC 60.108 55.000 5.05 0.00 0.00 4.09
1335 1336 0.107945 GCCGGATGTGAAGAAGCTCT 60.108 55.000 5.05 0.00 0.00 4.09
1336 1337 1.137086 GCCGGATGTGAAGAAGCTCTA 59.863 52.381 5.05 0.00 0.00 2.43
1337 1338 2.815478 CCGGATGTGAAGAAGCTCTAC 58.185 52.381 0.00 0.00 0.00 2.59
1338 1339 2.482142 CCGGATGTGAAGAAGCTCTACC 60.482 54.545 0.00 0.00 0.00 3.18
1339 1340 2.428890 CGGATGTGAAGAAGCTCTACCT 59.571 50.000 0.00 0.00 0.00 3.08
1340 1341 3.490078 CGGATGTGAAGAAGCTCTACCTC 60.490 52.174 0.00 0.00 0.00 3.85
1341 1342 3.181470 GGATGTGAAGAAGCTCTACCTCC 60.181 52.174 0.00 0.00 0.00 4.30
1342 1343 3.176924 TGTGAAGAAGCTCTACCTCCT 57.823 47.619 0.00 0.00 0.00 3.69
1343 1344 3.093057 TGTGAAGAAGCTCTACCTCCTC 58.907 50.000 0.00 0.00 0.00 3.71
1344 1345 2.098443 GTGAAGAAGCTCTACCTCCTCG 59.902 54.545 0.00 0.00 0.00 4.63
1345 1346 2.291024 TGAAGAAGCTCTACCTCCTCGT 60.291 50.000 0.00 0.00 0.00 4.18
1346 1347 3.054582 TGAAGAAGCTCTACCTCCTCGTA 60.055 47.826 0.00 0.00 0.00 3.43
1347 1348 2.921821 AGAAGCTCTACCTCCTCGTAC 58.078 52.381 0.00 0.00 0.00 3.67
1348 1349 1.598601 GAAGCTCTACCTCCTCGTACG 59.401 57.143 9.53 9.53 0.00 3.67
1349 1350 0.814812 AGCTCTACCTCCTCGTACGC 60.815 60.000 11.24 0.00 0.00 4.42
1350 1351 0.814812 GCTCTACCTCCTCGTACGCT 60.815 60.000 11.24 0.00 0.00 5.07
1351 1352 1.219646 CTCTACCTCCTCGTACGCTC 58.780 60.000 11.24 0.00 0.00 5.03
1352 1353 0.538584 TCTACCTCCTCGTACGCTCA 59.461 55.000 11.24 0.00 0.00 4.26
1353 1354 1.140452 TCTACCTCCTCGTACGCTCAT 59.860 52.381 11.24 0.00 0.00 2.90
1354 1355 1.532007 CTACCTCCTCGTACGCTCATC 59.468 57.143 11.24 0.00 0.00 2.92
1355 1356 0.107116 ACCTCCTCGTACGCTCATCT 60.107 55.000 11.24 0.00 0.00 2.90
1356 1357 0.589223 CCTCCTCGTACGCTCATCTC 59.411 60.000 11.24 0.00 0.00 2.75
1357 1358 1.588674 CTCCTCGTACGCTCATCTCT 58.411 55.000 11.24 0.00 0.00 3.10
1358 1359 2.548280 CCTCCTCGTACGCTCATCTCTA 60.548 54.545 11.24 0.00 0.00 2.43
1359 1360 3.331150 CTCCTCGTACGCTCATCTCTAT 58.669 50.000 11.24 0.00 0.00 1.98
1360 1361 3.327626 TCCTCGTACGCTCATCTCTATC 58.672 50.000 11.24 0.00 0.00 2.08
1361 1362 3.067833 CCTCGTACGCTCATCTCTATCA 58.932 50.000 11.24 0.00 0.00 2.15
1362 1363 3.120477 CCTCGTACGCTCATCTCTATCAC 60.120 52.174 11.24 0.00 0.00 3.06
1363 1364 3.463944 TCGTACGCTCATCTCTATCACA 58.536 45.455 11.24 0.00 0.00 3.58
1364 1365 3.875134 TCGTACGCTCATCTCTATCACAA 59.125 43.478 11.24 0.00 0.00 3.33
1365 1366 4.515567 TCGTACGCTCATCTCTATCACAAT 59.484 41.667 11.24 0.00 0.00 2.71
1366 1367 4.614702 CGTACGCTCATCTCTATCACAATG 59.385 45.833 0.52 0.00 0.00 2.82
1367 1368 4.662468 ACGCTCATCTCTATCACAATGT 57.338 40.909 0.00 0.00 0.00 2.71
1368 1369 5.016051 ACGCTCATCTCTATCACAATGTT 57.984 39.130 0.00 0.00 0.00 2.71
1369 1370 4.807834 ACGCTCATCTCTATCACAATGTTG 59.192 41.667 0.00 0.00 0.00 3.33
1370 1371 4.210746 CGCTCATCTCTATCACAATGTTGG 59.789 45.833 0.00 0.00 0.00 3.77
1371 1372 5.363101 GCTCATCTCTATCACAATGTTGGA 58.637 41.667 0.00 0.00 0.00 3.53
1372 1373 5.996513 GCTCATCTCTATCACAATGTTGGAT 59.003 40.000 0.00 0.00 0.00 3.41
1373 1374 6.147492 GCTCATCTCTATCACAATGTTGGATC 59.853 42.308 0.00 0.00 0.00 3.36
1374 1375 6.528321 TCATCTCTATCACAATGTTGGATCC 58.472 40.000 4.20 4.20 0.00 3.36
1375 1376 5.296151 TCTCTATCACAATGTTGGATCCC 57.704 43.478 9.90 0.00 0.00 3.85
1376 1377 4.971282 TCTCTATCACAATGTTGGATCCCT 59.029 41.667 9.90 0.00 0.00 4.20
1377 1378 5.070981 TCTCTATCACAATGTTGGATCCCTC 59.929 44.000 9.90 2.64 0.00 4.30
1378 1379 4.971282 TCTATCACAATGTTGGATCCCTCT 59.029 41.667 9.90 0.00 0.00 3.69
1379 1380 3.634397 TCACAATGTTGGATCCCTCTC 57.366 47.619 9.90 0.00 0.00 3.20
1380 1381 2.912295 TCACAATGTTGGATCCCTCTCA 59.088 45.455 9.90 3.57 0.00 3.27
1381 1382 3.330405 TCACAATGTTGGATCCCTCTCAA 59.670 43.478 9.90 0.00 0.00 3.02
1382 1383 4.081406 CACAATGTTGGATCCCTCTCAAA 58.919 43.478 9.90 0.00 0.00 2.69
1383 1384 4.157289 CACAATGTTGGATCCCTCTCAAAG 59.843 45.833 9.90 3.39 0.00 2.77
1384 1385 2.496899 TGTTGGATCCCTCTCAAAGC 57.503 50.000 9.90 0.00 0.00 3.51
1385 1386 1.988107 TGTTGGATCCCTCTCAAAGCT 59.012 47.619 9.90 0.00 0.00 3.74
1386 1387 2.376518 TGTTGGATCCCTCTCAAAGCTT 59.623 45.455 9.90 0.00 0.00 3.74
1387 1388 3.181429 TGTTGGATCCCTCTCAAAGCTTT 60.181 43.478 9.90 5.69 0.00 3.51
1388 1389 3.356529 TGGATCCCTCTCAAAGCTTTC 57.643 47.619 9.23 0.00 0.00 2.62
1389 1390 2.284190 GGATCCCTCTCAAAGCTTTCG 58.716 52.381 9.23 5.54 0.00 3.46
1390 1391 2.355209 GGATCCCTCTCAAAGCTTTCGT 60.355 50.000 9.23 0.00 0.00 3.85
1391 1392 3.118738 GGATCCCTCTCAAAGCTTTCGTA 60.119 47.826 9.23 0.00 0.00 3.43
1392 1393 3.594603 TCCCTCTCAAAGCTTTCGTAG 57.405 47.619 9.23 7.50 0.00 3.51
1393 1394 3.162666 TCCCTCTCAAAGCTTTCGTAGA 58.837 45.455 9.23 11.34 0.00 2.59
1394 1395 3.769844 TCCCTCTCAAAGCTTTCGTAGAT 59.230 43.478 9.23 0.00 35.04 1.98
1395 1396 4.116238 CCCTCTCAAAGCTTTCGTAGATC 58.884 47.826 9.23 0.00 35.04 2.75
1396 1397 4.142049 CCCTCTCAAAGCTTTCGTAGATCT 60.142 45.833 9.23 0.00 35.04 2.75
1397 1398 5.040635 CCTCTCAAAGCTTTCGTAGATCTC 58.959 45.833 9.23 0.00 35.04 2.75
1398 1399 5.393569 CCTCTCAAAGCTTTCGTAGATCTCA 60.394 44.000 9.23 0.00 35.04 3.27
1399 1400 6.214191 TCTCAAAGCTTTCGTAGATCTCAT 57.786 37.500 9.23 0.00 35.04 2.90
1400 1401 7.334844 TCTCAAAGCTTTCGTAGATCTCATA 57.665 36.000 9.23 0.00 35.04 2.15
1401 1402 7.421599 TCTCAAAGCTTTCGTAGATCTCATAG 58.578 38.462 9.23 0.00 35.04 2.23
1402 1403 6.507900 TCAAAGCTTTCGTAGATCTCATAGG 58.492 40.000 9.23 0.00 35.04 2.57
1403 1404 6.321435 TCAAAGCTTTCGTAGATCTCATAGGA 59.679 38.462 9.23 0.00 35.04 2.94
1404 1405 6.909550 AAGCTTTCGTAGATCTCATAGGAT 57.090 37.500 0.00 0.00 35.04 3.24
1405 1406 6.509418 AGCTTTCGTAGATCTCATAGGATC 57.491 41.667 0.00 0.00 41.55 3.36
1406 1407 6.007076 AGCTTTCGTAGATCTCATAGGATCA 58.993 40.000 0.00 0.00 43.11 2.92
1407 1408 6.072175 AGCTTTCGTAGATCTCATAGGATCAC 60.072 42.308 0.00 0.00 43.11 3.06
1408 1409 6.294231 GCTTTCGTAGATCTCATAGGATCACA 60.294 42.308 0.00 0.00 43.11 3.58
1409 1410 7.582667 TTTCGTAGATCTCATAGGATCACAA 57.417 36.000 0.00 0.00 43.11 3.33
1410 1411 7.582667 TTCGTAGATCTCATAGGATCACAAA 57.417 36.000 0.00 0.00 43.11 2.83
1411 1412 7.208225 TCGTAGATCTCATAGGATCACAAAG 57.792 40.000 0.00 0.00 43.11 2.77
1412 1413 6.773200 TCGTAGATCTCATAGGATCACAAAGT 59.227 38.462 0.00 0.00 43.11 2.66
1413 1414 7.041030 TCGTAGATCTCATAGGATCACAAAGTC 60.041 40.741 0.00 0.00 43.11 3.01
1414 1415 7.255277 CGTAGATCTCATAGGATCACAAAGTCA 60.255 40.741 0.00 0.00 43.11 3.41
1415 1416 7.429374 AGATCTCATAGGATCACAAAGTCAA 57.571 36.000 7.14 0.00 43.11 3.18
1416 1417 7.271511 AGATCTCATAGGATCACAAAGTCAAC 58.728 38.462 7.14 0.00 43.11 3.18
1417 1418 5.734720 TCTCATAGGATCACAAAGTCAACC 58.265 41.667 0.00 0.00 0.00 3.77
1418 1419 5.485353 TCTCATAGGATCACAAAGTCAACCT 59.515 40.000 0.00 0.00 0.00 3.50
1419 1420 6.013379 TCTCATAGGATCACAAAGTCAACCTT 60.013 38.462 0.00 0.00 33.79 3.50
1420 1421 5.939883 TCATAGGATCACAAAGTCAACCTTG 59.060 40.000 0.00 0.00 32.32 3.61
1421 1422 2.887152 AGGATCACAAAGTCAACCTTGC 59.113 45.455 0.00 0.00 32.32 4.01
1422 1423 2.887152 GGATCACAAAGTCAACCTTGCT 59.113 45.455 0.00 0.00 32.32 3.91
1423 1424 3.319122 GGATCACAAAGTCAACCTTGCTT 59.681 43.478 0.00 0.00 32.32 3.91
1424 1425 4.540824 GATCACAAAGTCAACCTTGCTTC 58.459 43.478 0.00 0.00 32.32 3.86
1425 1426 3.620488 TCACAAAGTCAACCTTGCTTCT 58.380 40.909 0.00 0.00 32.32 2.85
1426 1427 3.627577 TCACAAAGTCAACCTTGCTTCTC 59.372 43.478 0.00 0.00 32.32 2.87
1427 1428 2.952310 ACAAAGTCAACCTTGCTTCTCC 59.048 45.455 0.00 0.00 32.32 3.71
1428 1429 2.951642 CAAAGTCAACCTTGCTTCTCCA 59.048 45.455 0.00 0.00 32.32 3.86
1429 1430 3.297134 AAGTCAACCTTGCTTCTCCAA 57.703 42.857 0.00 0.00 30.18 3.53
1430 1431 2.856222 AGTCAACCTTGCTTCTCCAAG 58.144 47.619 0.00 0.00 41.40 3.61
1443 1444 4.829968 CTTCTCCAAGCTCTTCAATCTCA 58.170 43.478 0.00 0.00 0.00 3.27
1444 1445 5.430007 CTTCTCCAAGCTCTTCAATCTCAT 58.570 41.667 0.00 0.00 0.00 2.90
1445 1446 6.550938 TTCTCCAAGCTCTTCAATCTCATA 57.449 37.500 0.00 0.00 0.00 2.15
1446 1447 6.744175 TCTCCAAGCTCTTCAATCTCATAT 57.256 37.500 0.00 0.00 0.00 1.78
1447 1448 7.846101 TCTCCAAGCTCTTCAATCTCATATA 57.154 36.000 0.00 0.00 0.00 0.86
1448 1449 8.433249 TCTCCAAGCTCTTCAATCTCATATAT 57.567 34.615 0.00 0.00 0.00 0.86
1449 1450 8.878211 TCTCCAAGCTCTTCAATCTCATATATT 58.122 33.333 0.00 0.00 0.00 1.28
1450 1451 9.153721 CTCCAAGCTCTTCAATCTCATATATTC 57.846 37.037 0.00 0.00 0.00 1.75
1451 1452 7.816513 TCCAAGCTCTTCAATCTCATATATTCG 59.183 37.037 0.00 0.00 0.00 3.34
1452 1453 7.064371 CCAAGCTCTTCAATCTCATATATTCGG 59.936 40.741 0.00 0.00 0.00 4.30
1453 1454 7.238486 AGCTCTTCAATCTCATATATTCGGT 57.762 36.000 0.00 0.00 0.00 4.69
1454 1455 8.354711 AGCTCTTCAATCTCATATATTCGGTA 57.645 34.615 0.00 0.00 0.00 4.02
1455 1456 8.976353 AGCTCTTCAATCTCATATATTCGGTAT 58.024 33.333 0.00 0.00 0.00 2.73
1456 1457 9.243637 GCTCTTCAATCTCATATATTCGGTATC 57.756 37.037 0.00 0.00 0.00 2.24
1467 1468 9.868160 TCATATATTCGGTATCATGACTATCCT 57.132 33.333 0.00 0.00 0.00 3.24
1471 1472 6.724893 TTCGGTATCATGACTATCCTTTCA 57.275 37.500 0.00 0.00 0.00 2.69
1472 1473 6.332735 TCGGTATCATGACTATCCTTTCAG 57.667 41.667 0.00 0.00 0.00 3.02
1473 1474 4.926238 CGGTATCATGACTATCCTTTCAGC 59.074 45.833 0.00 0.00 0.00 4.26
1474 1475 5.509670 CGGTATCATGACTATCCTTTCAGCA 60.510 44.000 0.00 0.00 0.00 4.41
1475 1476 6.471146 GGTATCATGACTATCCTTTCAGCAT 58.529 40.000 0.00 0.00 0.00 3.79
1476 1477 6.939163 GGTATCATGACTATCCTTTCAGCATT 59.061 38.462 0.00 0.00 0.00 3.56
1477 1478 7.118971 GGTATCATGACTATCCTTTCAGCATTC 59.881 40.741 0.00 0.00 0.00 2.67
1478 1479 5.993055 TCATGACTATCCTTTCAGCATTCA 58.007 37.500 0.00 0.00 0.00 2.57
1479 1480 6.417258 TCATGACTATCCTTTCAGCATTCAA 58.583 36.000 0.00 0.00 0.00 2.69
1480 1481 7.058525 TCATGACTATCCTTTCAGCATTCAAT 58.941 34.615 0.00 0.00 0.00 2.57
1481 1482 7.558807 TCATGACTATCCTTTCAGCATTCAATT 59.441 33.333 0.00 0.00 0.00 2.32
1482 1483 7.325660 TGACTATCCTTTCAGCATTCAATTC 57.674 36.000 0.00 0.00 0.00 2.17
1483 1484 7.114754 TGACTATCCTTTCAGCATTCAATTCT 58.885 34.615 0.00 0.00 0.00 2.40
1484 1485 8.267183 TGACTATCCTTTCAGCATTCAATTCTA 58.733 33.333 0.00 0.00 0.00 2.10
1485 1486 8.443953 ACTATCCTTTCAGCATTCAATTCTAC 57.556 34.615 0.00 0.00 0.00 2.59
1486 1487 8.049117 ACTATCCTTTCAGCATTCAATTCTACA 58.951 33.333 0.00 0.00 0.00 2.74
1487 1488 6.748333 TCCTTTCAGCATTCAATTCTACAG 57.252 37.500 0.00 0.00 0.00 2.74
1488 1489 5.649395 TCCTTTCAGCATTCAATTCTACAGG 59.351 40.000 0.00 0.00 0.00 4.00
1489 1490 5.416952 CCTTTCAGCATTCAATTCTACAGGT 59.583 40.000 0.00 0.00 0.00 4.00
1490 1491 6.071728 CCTTTCAGCATTCAATTCTACAGGTT 60.072 38.462 0.00 0.00 0.00 3.50
1491 1492 5.885230 TCAGCATTCAATTCTACAGGTTG 57.115 39.130 0.00 0.00 0.00 3.77
1492 1493 5.316167 TCAGCATTCAATTCTACAGGTTGT 58.684 37.500 0.00 0.00 0.00 3.32
1493 1494 6.472016 TCAGCATTCAATTCTACAGGTTGTA 58.528 36.000 0.00 0.00 0.00 2.41
1522 1523 6.396829 AAAAACTCTTTGATGTTCTGAGGG 57.603 37.500 0.00 0.00 0.00 4.30
1523 1524 4.982241 AACTCTTTGATGTTCTGAGGGA 57.018 40.909 0.00 0.00 0.00 4.20
1524 1525 4.278975 ACTCTTTGATGTTCTGAGGGAC 57.721 45.455 0.00 0.00 0.00 4.46
1525 1526 3.257393 CTCTTTGATGTTCTGAGGGACG 58.743 50.000 0.00 0.00 0.00 4.79
1526 1527 2.897326 TCTTTGATGTTCTGAGGGACGA 59.103 45.455 0.00 0.00 0.00 4.20
1527 1528 3.515502 TCTTTGATGTTCTGAGGGACGAT 59.484 43.478 0.00 0.00 0.00 3.73
1528 1529 3.526931 TTGATGTTCTGAGGGACGATC 57.473 47.619 0.00 0.00 0.00 3.69
1529 1530 2.456577 TGATGTTCTGAGGGACGATCA 58.543 47.619 0.00 0.00 0.00 2.92
1530 1531 3.033909 TGATGTTCTGAGGGACGATCAT 58.966 45.455 0.00 0.00 0.00 2.45
1531 1532 4.215109 TGATGTTCTGAGGGACGATCATA 58.785 43.478 0.00 0.00 0.00 2.15
1532 1533 4.279420 TGATGTTCTGAGGGACGATCATAG 59.721 45.833 0.00 0.00 0.00 2.23
1533 1534 2.959030 TGTTCTGAGGGACGATCATAGG 59.041 50.000 0.00 0.00 0.00 2.57
1534 1535 2.294449 TCTGAGGGACGATCATAGGG 57.706 55.000 0.00 0.00 0.00 3.53
1535 1536 0.605589 CTGAGGGACGATCATAGGGC 59.394 60.000 0.00 0.00 0.00 5.19
1536 1537 0.188587 TGAGGGACGATCATAGGGCT 59.811 55.000 0.00 0.00 0.00 5.19
1537 1538 1.427753 TGAGGGACGATCATAGGGCTA 59.572 52.381 0.00 0.00 0.00 3.93
1538 1539 2.158370 TGAGGGACGATCATAGGGCTAA 60.158 50.000 0.00 0.00 0.00 3.09
1539 1540 3.100671 GAGGGACGATCATAGGGCTAAT 58.899 50.000 0.00 0.00 0.00 1.73
1540 1541 3.515901 GAGGGACGATCATAGGGCTAATT 59.484 47.826 0.00 0.00 0.00 1.40
1541 1542 3.910627 AGGGACGATCATAGGGCTAATTT 59.089 43.478 0.00 0.00 0.00 1.82
1542 1543 4.020128 AGGGACGATCATAGGGCTAATTTC 60.020 45.833 0.00 0.00 0.00 2.17
1543 1544 4.262894 GGGACGATCATAGGGCTAATTTCA 60.263 45.833 0.00 0.00 0.00 2.69
1544 1545 5.305585 GGACGATCATAGGGCTAATTTCAA 58.694 41.667 0.00 0.00 0.00 2.69
1545 1546 5.179555 GGACGATCATAGGGCTAATTTCAAC 59.820 44.000 0.00 0.00 0.00 3.18
1546 1547 5.930135 ACGATCATAGGGCTAATTTCAACT 58.070 37.500 0.00 0.00 0.00 3.16
1547 1548 5.992217 ACGATCATAGGGCTAATTTCAACTC 59.008 40.000 0.00 0.00 0.00 3.01
1548 1549 5.409826 CGATCATAGGGCTAATTTCAACTCC 59.590 44.000 0.00 0.00 0.00 3.85
1549 1550 5.975988 TCATAGGGCTAATTTCAACTCCT 57.024 39.130 0.00 0.00 0.00 3.69
1550 1551 6.327386 TCATAGGGCTAATTTCAACTCCTT 57.673 37.500 0.00 0.00 0.00 3.36
1551 1552 6.357367 TCATAGGGCTAATTTCAACTCCTTC 58.643 40.000 0.00 0.00 0.00 3.46
1552 1553 4.657814 AGGGCTAATTTCAACTCCTTCA 57.342 40.909 0.00 0.00 0.00 3.02
1553 1554 5.198602 AGGGCTAATTTCAACTCCTTCAT 57.801 39.130 0.00 0.00 0.00 2.57
1554 1555 5.196695 AGGGCTAATTTCAACTCCTTCATC 58.803 41.667 0.00 0.00 0.00 2.92
1555 1556 4.339530 GGGCTAATTTCAACTCCTTCATCC 59.660 45.833 0.00 0.00 0.00 3.51
1556 1557 4.949856 GGCTAATTTCAACTCCTTCATCCA 59.050 41.667 0.00 0.00 0.00 3.41
1557 1558 5.418840 GGCTAATTTCAACTCCTTCATCCAA 59.581 40.000 0.00 0.00 0.00 3.53
1558 1559 6.405176 GGCTAATTTCAACTCCTTCATCCAAG 60.405 42.308 0.00 0.00 0.00 3.61
1559 1560 5.397142 AATTTCAACTCCTTCATCCAAGC 57.603 39.130 0.00 0.00 0.00 4.01
1560 1561 3.795688 TTCAACTCCTTCATCCAAGCT 57.204 42.857 0.00 0.00 0.00 3.74
1561 1562 4.908601 TTCAACTCCTTCATCCAAGCTA 57.091 40.909 0.00 0.00 0.00 3.32
1562 1563 4.908601 TCAACTCCTTCATCCAAGCTAA 57.091 40.909 0.00 0.00 0.00 3.09
1563 1564 5.241403 TCAACTCCTTCATCCAAGCTAAA 57.759 39.130 0.00 0.00 0.00 1.85
1564 1565 5.630121 TCAACTCCTTCATCCAAGCTAAAA 58.370 37.500 0.00 0.00 0.00 1.52
1565 1566 6.248433 TCAACTCCTTCATCCAAGCTAAAAT 58.752 36.000 0.00 0.00 0.00 1.82
1566 1567 6.721208 TCAACTCCTTCATCCAAGCTAAAATT 59.279 34.615 0.00 0.00 0.00 1.82
1567 1568 7.233348 TCAACTCCTTCATCCAAGCTAAAATTT 59.767 33.333 0.00 0.00 0.00 1.82
1568 1569 7.163001 ACTCCTTCATCCAAGCTAAAATTTC 57.837 36.000 0.00 0.00 0.00 2.17
1569 1570 6.950619 ACTCCTTCATCCAAGCTAAAATTTCT 59.049 34.615 0.00 0.00 0.00 2.52
1570 1571 7.121907 ACTCCTTCATCCAAGCTAAAATTTCTC 59.878 37.037 0.00 0.00 0.00 2.87
1571 1572 6.378280 TCCTTCATCCAAGCTAAAATTTCTCC 59.622 38.462 0.00 0.00 0.00 3.71
1572 1573 6.379417 CCTTCATCCAAGCTAAAATTTCTCCT 59.621 38.462 0.00 0.00 0.00 3.69
1573 1574 7.396540 TTCATCCAAGCTAAAATTTCTCCTC 57.603 36.000 0.00 0.00 0.00 3.71
1574 1575 6.725364 TCATCCAAGCTAAAATTTCTCCTCT 58.275 36.000 0.00 0.00 0.00 3.69
1575 1576 7.861629 TCATCCAAGCTAAAATTTCTCCTCTA 58.138 34.615 0.00 0.00 0.00 2.43
1576 1577 7.770897 TCATCCAAGCTAAAATTTCTCCTCTAC 59.229 37.037 0.00 0.00 0.00 2.59
1577 1578 6.415573 TCCAAGCTAAAATTTCTCCTCTACC 58.584 40.000 0.00 0.00 0.00 3.18
1578 1579 6.215636 TCCAAGCTAAAATTTCTCCTCTACCT 59.784 38.462 0.00 0.00 0.00 3.08
1579 1580 6.317391 CCAAGCTAAAATTTCTCCTCTACCTG 59.683 42.308 0.00 0.00 0.00 4.00
1580 1581 5.995446 AGCTAAAATTTCTCCTCTACCTGG 58.005 41.667 0.00 0.00 0.00 4.45
1581 1582 5.726793 AGCTAAAATTTCTCCTCTACCTGGA 59.273 40.000 0.00 0.00 0.00 3.86
1589 1590 3.474798 TCCTCTACCTGGAGACATTGT 57.525 47.619 0.00 0.00 41.51 2.71
1590 1591 3.099905 TCCTCTACCTGGAGACATTGTG 58.900 50.000 0.00 0.00 41.51 3.33
1591 1592 2.419297 CCTCTACCTGGAGACATTGTGC 60.419 54.545 0.00 0.00 41.51 4.57
1592 1593 2.234661 CTCTACCTGGAGACATTGTGCA 59.765 50.000 0.00 0.00 41.51 4.57
1593 1594 2.028112 TCTACCTGGAGACATTGTGCAC 60.028 50.000 10.75 10.75 41.51 4.57
1594 1595 0.603707 ACCTGGAGACATTGTGCACG 60.604 55.000 13.13 0.00 41.51 5.34
1595 1596 0.320683 CCTGGAGACATTGTGCACGA 60.321 55.000 9.77 9.77 41.51 4.35
1596 1597 0.792640 CTGGAGACATTGTGCACGAC 59.207 55.000 9.51 0.00 41.51 4.34
1597 1598 0.105778 TGGAGACATTGTGCACGACA 59.894 50.000 9.51 0.00 33.40 4.35
1604 1605 3.320884 TTGTGCACGACAACTTTGC 57.679 47.368 13.13 0.00 39.78 3.68
1605 1606 0.523519 TTGTGCACGACAACTTTGCA 59.476 45.000 13.13 0.00 43.89 4.08
1607 1608 2.476772 TGCACGACAACTTTGCACT 58.523 47.368 0.00 0.00 41.29 4.40
1608 1609 0.808125 TGCACGACAACTTTGCACTT 59.192 45.000 0.00 0.00 41.29 3.16
1609 1610 2.010497 TGCACGACAACTTTGCACTTA 58.990 42.857 0.00 0.00 41.29 2.24
1610 1611 2.420372 TGCACGACAACTTTGCACTTAA 59.580 40.909 0.00 0.00 41.29 1.85
1611 1612 2.781646 GCACGACAACTTTGCACTTAAC 59.218 45.455 0.00 0.00 36.22 2.01
1612 1613 3.729462 GCACGACAACTTTGCACTTAACA 60.729 43.478 0.00 0.00 36.22 2.41
1613 1614 4.028383 CACGACAACTTTGCACTTAACAG 58.972 43.478 0.00 0.00 0.00 3.16
1614 1615 3.035942 CGACAACTTTGCACTTAACAGC 58.964 45.455 0.00 0.00 0.00 4.40
1615 1616 3.242739 CGACAACTTTGCACTTAACAGCT 60.243 43.478 0.00 0.00 0.00 4.24
1616 1617 4.282873 GACAACTTTGCACTTAACAGCTC 58.717 43.478 0.00 0.00 0.00 4.09
1617 1618 3.947834 ACAACTTTGCACTTAACAGCTCT 59.052 39.130 0.00 0.00 0.00 4.09
1618 1619 5.123227 ACAACTTTGCACTTAACAGCTCTA 58.877 37.500 0.00 0.00 0.00 2.43
1619 1620 5.007724 ACAACTTTGCACTTAACAGCTCTAC 59.992 40.000 0.00 0.00 0.00 2.59
1620 1621 4.065789 ACTTTGCACTTAACAGCTCTACC 58.934 43.478 0.00 0.00 0.00 3.18
1621 1622 3.762407 TTGCACTTAACAGCTCTACCA 57.238 42.857 0.00 0.00 0.00 3.25
1622 1623 3.981071 TGCACTTAACAGCTCTACCAT 57.019 42.857 0.00 0.00 0.00 3.55
1623 1624 4.286297 TGCACTTAACAGCTCTACCATT 57.714 40.909 0.00 0.00 0.00 3.16
1624 1625 4.002982 TGCACTTAACAGCTCTACCATTG 58.997 43.478 0.00 0.00 0.00 2.82
1625 1626 4.253685 GCACTTAACAGCTCTACCATTGA 58.746 43.478 0.00 0.00 0.00 2.57
1626 1627 4.695455 GCACTTAACAGCTCTACCATTGAA 59.305 41.667 0.00 0.00 0.00 2.69
1627 1628 5.390991 GCACTTAACAGCTCTACCATTGAAC 60.391 44.000 0.00 0.00 0.00 3.18
1628 1629 4.929808 ACTTAACAGCTCTACCATTGAACG 59.070 41.667 0.00 0.00 0.00 3.95
1629 1630 1.726853 ACAGCTCTACCATTGAACGC 58.273 50.000 0.00 0.00 0.00 4.84
1630 1631 1.009829 CAGCTCTACCATTGAACGCC 58.990 55.000 0.00 0.00 0.00 5.68
1631 1632 0.905357 AGCTCTACCATTGAACGCCT 59.095 50.000 0.00 0.00 0.00 5.52
1632 1633 1.134670 AGCTCTACCATTGAACGCCTC 60.135 52.381 0.00 0.00 0.00 4.70
1633 1634 1.134670 GCTCTACCATTGAACGCCTCT 60.135 52.381 0.00 0.00 0.00 3.69
1634 1635 2.815478 CTCTACCATTGAACGCCTCTC 58.185 52.381 0.00 0.00 0.00 3.20
1635 1636 1.480954 TCTACCATTGAACGCCTCTCC 59.519 52.381 0.00 0.00 0.00 3.71
1636 1637 0.539986 TACCATTGAACGCCTCTCCC 59.460 55.000 0.00 0.00 0.00 4.30
1637 1638 1.299648 CCATTGAACGCCTCTCCCA 59.700 57.895 0.00 0.00 0.00 4.37
1638 1639 0.745845 CCATTGAACGCCTCTCCCAG 60.746 60.000 0.00 0.00 0.00 4.45
1639 1640 0.745845 CATTGAACGCCTCTCCCAGG 60.746 60.000 0.00 0.00 46.82 4.45
1651 1652 3.120468 TCTCCCAGGAGATTGATGTCA 57.880 47.619 12.50 0.00 45.26 3.58
1652 1653 3.662078 TCTCCCAGGAGATTGATGTCAT 58.338 45.455 12.50 0.00 45.26 3.06
1653 1654 4.042884 TCTCCCAGGAGATTGATGTCATT 58.957 43.478 12.50 0.00 45.26 2.57
1654 1655 4.135306 CTCCCAGGAGATTGATGTCATTG 58.865 47.826 8.05 0.00 44.53 2.82
1655 1656 3.524789 TCCCAGGAGATTGATGTCATTGT 59.475 43.478 0.00 0.00 0.00 2.71
1656 1657 3.881688 CCCAGGAGATTGATGTCATTGTC 59.118 47.826 0.00 0.00 0.00 3.18
1657 1658 4.520179 CCAGGAGATTGATGTCATTGTCA 58.480 43.478 4.98 0.00 0.00 3.58
1658 1659 4.575236 CCAGGAGATTGATGTCATTGTCAG 59.425 45.833 4.98 0.00 0.00 3.51
1659 1660 5.183969 CAGGAGATTGATGTCATTGTCAGT 58.816 41.667 4.98 0.00 0.00 3.41
1660 1661 5.064834 CAGGAGATTGATGTCATTGTCAGTG 59.935 44.000 4.98 0.00 0.00 3.66
1661 1662 4.940046 GGAGATTGATGTCATTGTCAGTGT 59.060 41.667 0.00 0.00 0.00 3.55
1662 1663 5.163784 GGAGATTGATGTCATTGTCAGTGTG 60.164 44.000 0.00 0.00 0.00 3.82
1663 1664 4.698780 AGATTGATGTCATTGTCAGTGTGG 59.301 41.667 0.00 0.00 0.00 4.17
1664 1665 2.153645 TGATGTCATTGTCAGTGTGGC 58.846 47.619 0.00 0.00 0.00 5.01
1665 1666 2.224597 TGATGTCATTGTCAGTGTGGCT 60.225 45.455 0.00 0.00 0.00 4.75
1666 1667 1.596603 TGTCATTGTCAGTGTGGCTG 58.403 50.000 0.00 0.00 46.34 4.85
1667 1668 0.239347 GTCATTGTCAGTGTGGCTGC 59.761 55.000 0.00 0.00 44.66 5.25
1668 1669 0.890542 TCATTGTCAGTGTGGCTGCC 60.891 55.000 12.87 12.87 44.66 4.85
1669 1670 0.892358 CATTGTCAGTGTGGCTGCCT 60.892 55.000 21.03 0.00 44.66 4.75
1670 1671 0.178981 ATTGTCAGTGTGGCTGCCTT 60.179 50.000 21.03 0.00 44.66 4.35
1671 1672 0.819259 TTGTCAGTGTGGCTGCCTTC 60.819 55.000 21.03 13.25 44.66 3.46
1672 1673 1.072159 GTCAGTGTGGCTGCCTTCT 59.928 57.895 21.03 12.04 44.66 2.85
1673 1674 0.321671 GTCAGTGTGGCTGCCTTCTA 59.678 55.000 21.03 0.00 44.66 2.10
1674 1675 1.065854 GTCAGTGTGGCTGCCTTCTAT 60.066 52.381 21.03 0.00 44.66 1.98
1675 1676 1.065926 TCAGTGTGGCTGCCTTCTATG 60.066 52.381 21.03 11.95 44.66 2.23
1676 1677 1.065926 CAGTGTGGCTGCCTTCTATGA 60.066 52.381 21.03 0.00 38.52 2.15
1677 1678 1.209019 AGTGTGGCTGCCTTCTATGAG 59.791 52.381 21.03 0.00 0.00 2.90
1678 1679 1.208052 GTGTGGCTGCCTTCTATGAGA 59.792 52.381 21.03 0.00 0.00 3.27
1679 1680 2.121948 TGTGGCTGCCTTCTATGAGAT 58.878 47.619 21.03 0.00 0.00 2.75
1680 1681 2.158856 TGTGGCTGCCTTCTATGAGATG 60.159 50.000 21.03 0.00 0.00 2.90
1681 1682 2.121948 TGGCTGCCTTCTATGAGATGT 58.878 47.619 21.03 0.00 0.00 3.06
1682 1683 3.070159 GTGGCTGCCTTCTATGAGATGTA 59.930 47.826 21.03 0.00 0.00 2.29
1683 1684 3.070159 TGGCTGCCTTCTATGAGATGTAC 59.930 47.826 21.03 0.00 0.00 2.90
1684 1685 3.312828 GCTGCCTTCTATGAGATGTACG 58.687 50.000 0.00 0.00 0.00 3.67
1685 1686 3.243569 GCTGCCTTCTATGAGATGTACGT 60.244 47.826 0.00 0.00 0.00 3.57
1686 1687 4.023107 GCTGCCTTCTATGAGATGTACGTA 60.023 45.833 0.00 0.00 0.00 3.57
1687 1688 5.336055 GCTGCCTTCTATGAGATGTACGTAT 60.336 44.000 0.00 0.00 0.00 3.06
1688 1689 6.127980 GCTGCCTTCTATGAGATGTACGTATA 60.128 42.308 0.00 0.00 0.00 1.47
1689 1690 7.575155 GCTGCCTTCTATGAGATGTACGTATAA 60.575 40.741 0.00 0.00 0.00 0.98
1690 1691 8.173542 TGCCTTCTATGAGATGTACGTATAAA 57.826 34.615 0.00 0.00 0.00 1.40
1691 1692 8.803235 TGCCTTCTATGAGATGTACGTATAAAT 58.197 33.333 0.00 0.00 0.00 1.40
1716 1717 7.735326 AATGTATAGTAAGTAGGGCTATGGG 57.265 40.000 0.00 0.00 0.00 4.00
1717 1718 5.586877 TGTATAGTAAGTAGGGCTATGGGG 58.413 45.833 0.00 0.00 0.00 4.96
1718 1719 2.417719 AGTAAGTAGGGCTATGGGGG 57.582 55.000 0.00 0.00 0.00 5.40
1719 1720 1.871006 AGTAAGTAGGGCTATGGGGGA 59.129 52.381 0.00 0.00 0.00 4.81
1720 1721 2.158143 AGTAAGTAGGGCTATGGGGGAG 60.158 54.545 0.00 0.00 0.00 4.30
1721 1722 0.949582 AAGTAGGGCTATGGGGGAGA 59.050 55.000 0.00 0.00 0.00 3.71
1722 1723 1.180803 AGTAGGGCTATGGGGGAGAT 58.819 55.000 0.00 0.00 0.00 2.75
1723 1724 1.203364 AGTAGGGCTATGGGGGAGATG 60.203 57.143 0.00 0.00 0.00 2.90
1724 1725 0.547712 TAGGGCTATGGGGGAGATGC 60.548 60.000 0.00 0.00 0.00 3.91
1725 1726 2.156098 GGGCTATGGGGGAGATGCA 61.156 63.158 0.00 0.00 0.00 3.96
1726 1727 1.719063 GGGCTATGGGGGAGATGCAA 61.719 60.000 0.00 0.00 0.00 4.08
1727 1728 0.407139 GGCTATGGGGGAGATGCAAT 59.593 55.000 0.00 0.00 0.00 3.56
1728 1729 1.542492 GCTATGGGGGAGATGCAATG 58.458 55.000 0.00 0.00 0.00 2.82
1729 1730 1.889699 GCTATGGGGGAGATGCAATGG 60.890 57.143 0.00 0.00 0.00 3.16
1730 1731 1.426598 CTATGGGGGAGATGCAATGGT 59.573 52.381 0.00 0.00 0.00 3.55
1731 1732 0.638292 ATGGGGGAGATGCAATGGTT 59.362 50.000 0.00 0.00 0.00 3.67
1732 1733 0.033208 TGGGGGAGATGCAATGGTTC 60.033 55.000 0.00 0.00 0.00 3.62
1733 1734 1.103398 GGGGGAGATGCAATGGTTCG 61.103 60.000 0.00 0.00 0.00 3.95
1734 1735 0.394352 GGGGAGATGCAATGGTTCGT 60.394 55.000 0.00 0.00 0.00 3.85
1735 1736 1.017387 GGGAGATGCAATGGTTCGTC 58.983 55.000 0.00 0.00 0.00 4.20
1736 1737 1.407437 GGGAGATGCAATGGTTCGTCT 60.407 52.381 0.00 0.00 0.00 4.18
1737 1738 1.936547 GGAGATGCAATGGTTCGTCTC 59.063 52.381 0.00 0.00 41.99 3.36
1738 1739 2.621338 GAGATGCAATGGTTCGTCTCA 58.379 47.619 5.10 0.00 42.19 3.27
1739 1740 2.349886 GAGATGCAATGGTTCGTCTCAC 59.650 50.000 5.10 0.00 42.19 3.51
1740 1741 1.061131 GATGCAATGGTTCGTCTCACG 59.939 52.381 0.00 0.00 44.19 4.35
1754 1755 3.637998 TCTCACGAGACACCAGTTTAC 57.362 47.619 0.00 0.00 31.41 2.01
1755 1756 3.220110 TCTCACGAGACACCAGTTTACT 58.780 45.455 0.00 0.00 31.41 2.24
1756 1757 4.392047 TCTCACGAGACACCAGTTTACTA 58.608 43.478 0.00 0.00 31.41 1.82
1757 1758 4.454847 TCTCACGAGACACCAGTTTACTAG 59.545 45.833 0.00 0.00 31.41 2.57
1758 1759 3.057736 TCACGAGACACCAGTTTACTAGC 60.058 47.826 0.00 0.00 0.00 3.42
1759 1760 3.057456 CACGAGACACCAGTTTACTAGCT 60.057 47.826 0.00 0.00 0.00 3.32
1760 1761 3.573110 ACGAGACACCAGTTTACTAGCTT 59.427 43.478 0.00 0.00 0.00 3.74
1761 1762 4.038883 ACGAGACACCAGTTTACTAGCTTT 59.961 41.667 0.00 0.00 0.00 3.51
1762 1763 5.242393 ACGAGACACCAGTTTACTAGCTTTA 59.758 40.000 0.00 0.00 0.00 1.85
1763 1764 5.572126 CGAGACACCAGTTTACTAGCTTTAC 59.428 44.000 0.00 0.00 0.00 2.01
1764 1765 6.415206 AGACACCAGTTTACTAGCTTTACA 57.585 37.500 0.00 0.00 0.00 2.41
1765 1766 6.221659 AGACACCAGTTTACTAGCTTTACAC 58.778 40.000 0.00 0.00 0.00 2.90
1766 1767 5.920903 ACACCAGTTTACTAGCTTTACACA 58.079 37.500 0.00 0.00 0.00 3.72
1767 1768 5.756833 ACACCAGTTTACTAGCTTTACACAC 59.243 40.000 0.00 0.00 0.00 3.82
1768 1769 5.989777 CACCAGTTTACTAGCTTTACACACT 59.010 40.000 0.00 0.00 0.00 3.55
1769 1770 6.482308 CACCAGTTTACTAGCTTTACACACTT 59.518 38.462 0.00 0.00 0.00 3.16
1770 1771 6.704937 ACCAGTTTACTAGCTTTACACACTTC 59.295 38.462 0.00 0.00 0.00 3.01
1771 1772 6.929606 CCAGTTTACTAGCTTTACACACTTCT 59.070 38.462 0.00 0.00 0.00 2.85
1772 1773 7.441458 CCAGTTTACTAGCTTTACACACTTCTT 59.559 37.037 0.00 0.00 0.00 2.52
1773 1774 8.827677 CAGTTTACTAGCTTTACACACTTCTTT 58.172 33.333 0.00 0.00 0.00 2.52
1776 1777 9.820725 TTTACTAGCTTTACACACTTCTTTACA 57.179 29.630 0.00 0.00 0.00 2.41
1777 1778 9.820725 TTACTAGCTTTACACACTTCTTTACAA 57.179 29.630 0.00 0.00 0.00 2.41
1778 1779 8.726870 ACTAGCTTTACACACTTCTTTACAAA 57.273 30.769 0.00 0.00 0.00 2.83
1779 1780 9.169592 ACTAGCTTTACACACTTCTTTACAAAA 57.830 29.630 0.00 0.00 0.00 2.44
1780 1781 9.651718 CTAGCTTTACACACTTCTTTACAAAAG 57.348 33.333 0.00 0.00 0.00 2.27
1781 1782 8.276252 AGCTTTACACACTTCTTTACAAAAGA 57.724 30.769 0.00 0.00 0.00 2.52
1782 1783 8.736244 AGCTTTACACACTTCTTTACAAAAGAA 58.264 29.630 12.78 12.78 35.25 2.52
1783 1784 9.349145 GCTTTACACACTTCTTTACAAAAGAAA 57.651 29.630 13.98 0.00 36.01 2.52
1808 1809 9.935241 AATTGTATTCAATAGTCATATCGAGCT 57.065 29.630 0.00 0.00 42.60 4.09
1811 1812 9.232473 TGTATTCAATAGTCATATCGAGCTAGT 57.768 33.333 0.00 0.00 0.00 2.57
1814 1815 8.617290 TTCAATAGTCATATCGAGCTAGTACA 57.383 34.615 0.00 0.00 0.00 2.90
1815 1816 8.617290 TCAATAGTCATATCGAGCTAGTACAA 57.383 34.615 0.00 0.00 0.00 2.41
1816 1817 8.722394 TCAATAGTCATATCGAGCTAGTACAAG 58.278 37.037 0.00 0.00 0.00 3.16
1817 1818 5.365403 AGTCATATCGAGCTAGTACAAGC 57.635 43.478 0.00 0.00 43.11 4.01
1818 1819 4.822350 AGTCATATCGAGCTAGTACAAGCA 59.178 41.667 0.00 0.00 45.30 3.91
1819 1820 5.299531 AGTCATATCGAGCTAGTACAAGCAA 59.700 40.000 0.00 0.00 45.30 3.91
1820 1821 6.015856 AGTCATATCGAGCTAGTACAAGCAAT 60.016 38.462 0.00 0.00 45.30 3.56
1821 1822 6.088749 GTCATATCGAGCTAGTACAAGCAATG 59.911 42.308 0.00 0.00 45.30 2.82
1822 1823 4.655762 ATCGAGCTAGTACAAGCAATGA 57.344 40.909 0.00 0.00 45.30 2.57
1823 1824 4.033990 TCGAGCTAGTACAAGCAATGAG 57.966 45.455 0.00 0.00 45.30 2.90
1824 1825 3.694566 TCGAGCTAGTACAAGCAATGAGA 59.305 43.478 0.00 0.00 45.30 3.27
1825 1826 4.041049 CGAGCTAGTACAAGCAATGAGAG 58.959 47.826 0.00 0.00 45.30 3.20
1826 1827 4.201960 CGAGCTAGTACAAGCAATGAGAGA 60.202 45.833 0.00 0.00 45.30 3.10
1827 1828 5.655488 GAGCTAGTACAAGCAATGAGAGAA 58.345 41.667 0.00 0.00 45.30 2.87
1828 1829 6.232581 AGCTAGTACAAGCAATGAGAGAAT 57.767 37.500 0.00 0.00 45.30 2.40
1829 1830 7.353414 AGCTAGTACAAGCAATGAGAGAATA 57.647 36.000 0.00 0.00 45.30 1.75
1830 1831 7.206687 AGCTAGTACAAGCAATGAGAGAATAC 58.793 38.462 0.00 0.00 45.30 1.89
1831 1832 6.422400 GCTAGTACAAGCAATGAGAGAATACC 59.578 42.308 0.00 0.00 42.30 2.73
1832 1833 5.675538 AGTACAAGCAATGAGAGAATACCC 58.324 41.667 0.00 0.00 0.00 3.69
1833 1834 3.891049 ACAAGCAATGAGAGAATACCCC 58.109 45.455 0.00 0.00 0.00 4.95
1834 1835 2.874701 CAAGCAATGAGAGAATACCCCG 59.125 50.000 0.00 0.00 0.00 5.73
1835 1836 2.398588 AGCAATGAGAGAATACCCCGA 58.601 47.619 0.00 0.00 0.00 5.14
1836 1837 2.103263 AGCAATGAGAGAATACCCCGAC 59.897 50.000 0.00 0.00 0.00 4.79
1837 1838 2.103263 GCAATGAGAGAATACCCCGACT 59.897 50.000 0.00 0.00 0.00 4.18
1838 1839 3.800604 GCAATGAGAGAATACCCCGACTC 60.801 52.174 0.00 0.00 0.00 3.36
1839 1840 2.820728 TGAGAGAATACCCCGACTCA 57.179 50.000 0.00 0.00 33.06 3.41
1840 1841 2.656002 TGAGAGAATACCCCGACTCAG 58.344 52.381 0.00 0.00 32.04 3.35
1841 1842 1.338655 GAGAGAATACCCCGACTCAGC 59.661 57.143 0.00 0.00 32.59 4.26
1842 1843 1.112113 GAGAATACCCCGACTCAGCA 58.888 55.000 0.00 0.00 0.00 4.41
1843 1844 1.689273 GAGAATACCCCGACTCAGCAT 59.311 52.381 0.00 0.00 0.00 3.79
1844 1845 2.891580 GAGAATACCCCGACTCAGCATA 59.108 50.000 0.00 0.00 0.00 3.14
1845 1846 3.305720 AGAATACCCCGACTCAGCATAA 58.694 45.455 0.00 0.00 0.00 1.90
1846 1847 3.069729 AGAATACCCCGACTCAGCATAAC 59.930 47.826 0.00 0.00 0.00 1.89
1847 1848 1.855295 TACCCCGACTCAGCATAACA 58.145 50.000 0.00 0.00 0.00 2.41
1848 1849 0.981183 ACCCCGACTCAGCATAACAA 59.019 50.000 0.00 0.00 0.00 2.83
1849 1850 1.066143 ACCCCGACTCAGCATAACAAG 60.066 52.381 0.00 0.00 0.00 3.16
1850 1851 1.207089 CCCCGACTCAGCATAACAAGA 59.793 52.381 0.00 0.00 0.00 3.02
1851 1852 2.158900 CCCCGACTCAGCATAACAAGAT 60.159 50.000 0.00 0.00 0.00 2.40
1852 1853 2.868583 CCCGACTCAGCATAACAAGATG 59.131 50.000 0.00 0.00 0.00 2.90
1863 1864 5.550232 CATAACAAGATGCACACAGCTAA 57.450 39.130 0.00 0.00 43.13 3.09
1864 1865 3.904136 AACAAGATGCACACAGCTAAC 57.096 42.857 0.00 0.00 43.13 2.34
1865 1866 2.849942 ACAAGATGCACACAGCTAACA 58.150 42.857 0.00 0.00 43.13 2.41
1866 1867 2.549754 ACAAGATGCACACAGCTAACAC 59.450 45.455 0.00 0.00 43.13 3.32
1867 1868 1.432514 AGATGCACACAGCTAACACG 58.567 50.000 0.00 0.00 41.81 4.49
1868 1869 1.148310 GATGCACACAGCTAACACGT 58.852 50.000 0.00 0.00 45.94 4.49
1869 1870 1.531149 GATGCACACAGCTAACACGTT 59.469 47.619 0.00 0.00 45.94 3.99
1870 1871 1.374560 TGCACACAGCTAACACGTTT 58.625 45.000 0.00 0.00 45.94 3.60
1871 1872 2.552031 TGCACACAGCTAACACGTTTA 58.448 42.857 0.00 0.00 45.94 2.01
1872 1873 2.937149 TGCACACAGCTAACACGTTTAA 59.063 40.909 0.00 0.00 45.94 1.52
1873 1874 3.001838 TGCACACAGCTAACACGTTTAAG 59.998 43.478 0.00 0.00 45.94 1.85
1874 1875 3.246699 GCACACAGCTAACACGTTTAAGA 59.753 43.478 0.00 0.00 41.15 2.10
1875 1876 4.758561 CACACAGCTAACACGTTTAAGAC 58.241 43.478 0.00 0.00 0.00 3.01
1876 1877 3.805971 ACACAGCTAACACGTTTAAGACC 59.194 43.478 0.00 0.00 0.00 3.85
1877 1878 3.054878 ACAGCTAACACGTTTAAGACCG 58.945 45.455 0.00 0.00 0.00 4.79
1878 1879 3.243501 ACAGCTAACACGTTTAAGACCGA 60.244 43.478 0.00 0.00 0.00 4.69
1879 1880 3.120782 CAGCTAACACGTTTAAGACCGAC 59.879 47.826 0.00 0.00 0.00 4.79
1880 1881 3.005155 AGCTAACACGTTTAAGACCGACT 59.995 43.478 0.00 0.00 0.00 4.18
1881 1882 3.737774 GCTAACACGTTTAAGACCGACTT 59.262 43.478 0.00 0.00 42.04 3.01
1882 1883 4.209911 GCTAACACGTTTAAGACCGACTTT 59.790 41.667 0.00 0.00 39.72 2.66
1883 1884 5.277011 GCTAACACGTTTAAGACCGACTTTT 60.277 40.000 0.00 0.00 39.72 2.27
1884 1885 5.550232 AACACGTTTAAGACCGACTTTTT 57.450 34.783 0.00 0.00 39.72 1.94
1885 1886 5.147767 ACACGTTTAAGACCGACTTTTTC 57.852 39.130 0.00 0.00 39.72 2.29
1886 1887 4.872124 ACACGTTTAAGACCGACTTTTTCT 59.128 37.500 0.00 0.00 39.72 2.52
1887 1888 5.195379 CACGTTTAAGACCGACTTTTTCTG 58.805 41.667 0.00 0.00 39.72 3.02
1888 1889 5.005971 CACGTTTAAGACCGACTTTTTCTGA 59.994 40.000 0.00 0.00 39.72 3.27
1889 1890 5.006068 ACGTTTAAGACCGACTTTTTCTGAC 59.994 40.000 0.75 0.00 39.72 3.51
1890 1891 5.233689 CGTTTAAGACCGACTTTTTCTGACT 59.766 40.000 0.75 0.00 39.72 3.41
1891 1892 6.238022 CGTTTAAGACCGACTTTTTCTGACTT 60.238 38.462 0.75 0.00 39.72 3.01
1892 1893 7.043192 CGTTTAAGACCGACTTTTTCTGACTTA 60.043 37.037 0.75 0.00 39.72 2.24
1893 1894 7.941795 TTAAGACCGACTTTTTCTGACTTAG 57.058 36.000 0.75 0.00 39.72 2.18
1894 1895 5.532664 AGACCGACTTTTTCTGACTTAGT 57.467 39.130 0.00 0.00 0.00 2.24
1895 1896 5.290386 AGACCGACTTTTTCTGACTTAGTG 58.710 41.667 0.00 0.00 0.00 2.74
1896 1897 5.019785 ACCGACTTTTTCTGACTTAGTGT 57.980 39.130 0.00 0.00 0.00 3.55
1897 1898 5.425630 ACCGACTTTTTCTGACTTAGTGTT 58.574 37.500 0.00 0.00 0.00 3.32
1898 1899 6.576185 ACCGACTTTTTCTGACTTAGTGTTA 58.424 36.000 0.00 0.00 0.00 2.41
1899 1900 6.700520 ACCGACTTTTTCTGACTTAGTGTTAG 59.299 38.462 0.00 0.00 34.04 2.34
1900 1901 6.346678 CCGACTTTTTCTGACTTAGTGTTAGC 60.347 42.308 0.00 0.00 32.94 3.09
1901 1902 6.421202 CGACTTTTTCTGACTTAGTGTTAGCT 59.579 38.462 0.00 0.00 32.94 3.32
1902 1903 7.042658 CGACTTTTTCTGACTTAGTGTTAGCTT 60.043 37.037 0.00 0.00 32.94 3.74
1903 1904 8.507524 ACTTTTTCTGACTTAGTGTTAGCTTT 57.492 30.769 0.00 0.00 32.94 3.51
1904 1905 9.609346 ACTTTTTCTGACTTAGTGTTAGCTTTA 57.391 29.630 0.00 0.00 32.94 1.85
1905 1906 9.865484 CTTTTTCTGACTTAGTGTTAGCTTTAC 57.135 33.333 0.00 0.00 32.94 2.01
1906 1907 8.951787 TTTTCTGACTTAGTGTTAGCTTTACA 57.048 30.769 0.00 0.00 32.94 2.41
1907 1908 9.555727 TTTTCTGACTTAGTGTTAGCTTTACAT 57.444 29.630 0.00 0.00 32.94 2.29
1910 1911 9.803315 TCTGACTTAGTGTTAGCTTTACATATG 57.197 33.333 0.00 0.00 32.94 1.78
1911 1912 8.942338 TGACTTAGTGTTAGCTTTACATATGG 57.058 34.615 7.80 0.00 0.00 2.74
1912 1913 7.494625 TGACTTAGTGTTAGCTTTACATATGGC 59.505 37.037 7.80 0.38 0.00 4.40
1913 1914 7.335627 ACTTAGTGTTAGCTTTACATATGGCA 58.664 34.615 7.80 0.00 0.00 4.92
1914 1915 7.827236 ACTTAGTGTTAGCTTTACATATGGCAA 59.173 33.333 7.80 0.00 0.00 4.52
1915 1916 8.746052 TTAGTGTTAGCTTTACATATGGCAAT 57.254 30.769 7.80 0.00 0.00 3.56
1916 1917 7.645058 AGTGTTAGCTTTACATATGGCAATT 57.355 32.000 7.80 0.00 0.00 2.32
1917 1918 8.746052 AGTGTTAGCTTTACATATGGCAATTA 57.254 30.769 7.80 0.00 0.00 1.40
1918 1919 9.184523 AGTGTTAGCTTTACATATGGCAATTAA 57.815 29.630 7.80 0.00 0.00 1.40
1919 1920 9.965824 GTGTTAGCTTTACATATGGCAATTAAT 57.034 29.630 7.80 0.00 0.00 1.40
1927 1928 9.703892 TTTACATATGGCAATTAATAACATGGC 57.296 29.630 7.80 4.84 38.68 4.40
1928 1929 7.543359 ACATATGGCAATTAATAACATGGCT 57.457 32.000 7.80 2.50 38.95 4.75
1929 1930 8.648698 ACATATGGCAATTAATAACATGGCTA 57.351 30.769 7.80 4.14 38.95 3.93
1930 1931 8.742777 ACATATGGCAATTAATAACATGGCTAG 58.257 33.333 7.80 0.00 38.95 3.42
1931 1932 5.452078 TGGCAATTAATAACATGGCTAGC 57.548 39.130 6.04 6.04 38.95 3.42
1932 1933 4.892345 TGGCAATTAATAACATGGCTAGCA 59.108 37.500 18.24 2.97 38.95 3.49
1933 1934 5.539574 TGGCAATTAATAACATGGCTAGCAT 59.460 36.000 18.24 5.44 38.95 3.79
1934 1935 6.095377 GGCAATTAATAACATGGCTAGCATC 58.905 40.000 18.24 0.00 35.66 3.91
1935 1936 6.095377 GCAATTAATAACATGGCTAGCATCC 58.905 40.000 18.24 0.00 0.00 3.51
1936 1937 6.624423 CAATTAATAACATGGCTAGCATCCC 58.376 40.000 18.24 0.00 0.00 3.85
1937 1938 3.882102 AATAACATGGCTAGCATCCCA 57.118 42.857 18.24 5.37 35.21 4.37
1938 1939 2.936919 TAACATGGCTAGCATCCCAG 57.063 50.000 18.24 2.27 34.01 4.45
1939 1940 0.184451 AACATGGCTAGCATCCCAGG 59.816 55.000 18.24 9.37 38.76 4.45
1940 1941 0.695462 ACATGGCTAGCATCCCAGGA 60.695 55.000 18.24 0.00 36.47 3.86
1941 1942 0.697079 CATGGCTAGCATCCCAGGAT 59.303 55.000 18.24 0.00 35.01 3.24
1942 1943 0.990374 ATGGCTAGCATCCCAGGATC 59.010 55.000 18.24 0.00 34.01 3.36
1943 1944 0.400381 TGGCTAGCATCCCAGGATCA 60.400 55.000 18.24 0.00 31.62 2.92
1944 1945 0.767375 GGCTAGCATCCCAGGATCAA 59.233 55.000 18.24 0.00 31.62 2.57
1945 1946 1.143684 GGCTAGCATCCCAGGATCAAA 59.856 52.381 18.24 0.00 31.62 2.69
1946 1947 2.224967 GGCTAGCATCCCAGGATCAAAT 60.225 50.000 18.24 0.00 31.62 2.32
1947 1948 3.009473 GGCTAGCATCCCAGGATCAAATA 59.991 47.826 18.24 0.00 31.62 1.40
1948 1949 4.507335 GGCTAGCATCCCAGGATCAAATAA 60.507 45.833 18.24 0.00 31.62 1.40
1949 1950 4.457257 GCTAGCATCCCAGGATCAAATAAC 59.543 45.833 10.63 0.00 31.62 1.89
1950 1951 4.803329 AGCATCCCAGGATCAAATAACT 57.197 40.909 0.00 0.00 31.62 2.24
1951 1952 4.723309 AGCATCCCAGGATCAAATAACTC 58.277 43.478 0.00 0.00 31.62 3.01
1952 1953 3.823304 GCATCCCAGGATCAAATAACTCC 59.177 47.826 0.00 0.00 31.62 3.85
1953 1954 4.401925 CATCCCAGGATCAAATAACTCCC 58.598 47.826 0.00 0.00 31.62 4.30
1954 1955 2.783510 TCCCAGGATCAAATAACTCCCC 59.216 50.000 0.00 0.00 0.00 4.81
1955 1956 2.513738 CCCAGGATCAAATAACTCCCCA 59.486 50.000 0.00 0.00 0.00 4.96
1956 1957 3.052944 CCCAGGATCAAATAACTCCCCAA 60.053 47.826 0.00 0.00 0.00 4.12
1957 1958 4.571792 CCCAGGATCAAATAACTCCCCAAA 60.572 45.833 0.00 0.00 0.00 3.28
1958 1959 4.402474 CCAGGATCAAATAACTCCCCAAAC 59.598 45.833 0.00 0.00 0.00 2.93
1959 1960 5.264395 CAGGATCAAATAACTCCCCAAACT 58.736 41.667 0.00 0.00 0.00 2.66
1960 1961 5.358160 CAGGATCAAATAACTCCCCAAACTC 59.642 44.000 0.00 0.00 0.00 3.01
1961 1962 5.254032 AGGATCAAATAACTCCCCAAACTCT 59.746 40.000 0.00 0.00 0.00 3.24
1962 1963 5.952347 GGATCAAATAACTCCCCAAACTCTT 59.048 40.000 0.00 0.00 0.00 2.85
1963 1964 6.095580 GGATCAAATAACTCCCCAAACTCTTC 59.904 42.308 0.00 0.00 0.00 2.87
1964 1965 5.947663 TCAAATAACTCCCCAAACTCTTCA 58.052 37.500 0.00 0.00 0.00 3.02
1965 1966 6.552008 TCAAATAACTCCCCAAACTCTTCAT 58.448 36.000 0.00 0.00 0.00 2.57
1966 1967 7.010160 TCAAATAACTCCCCAAACTCTTCATT 58.990 34.615 0.00 0.00 0.00 2.57
1967 1968 7.508977 TCAAATAACTCCCCAAACTCTTCATTT 59.491 33.333 0.00 0.00 0.00 2.32
1968 1969 7.468141 AATAACTCCCCAAACTCTTCATTTC 57.532 36.000 0.00 0.00 0.00 2.17
1969 1970 4.731313 ACTCCCCAAACTCTTCATTTCT 57.269 40.909 0.00 0.00 0.00 2.52
1970 1971 5.843019 ACTCCCCAAACTCTTCATTTCTA 57.157 39.130 0.00 0.00 0.00 2.10
1971 1972 6.200878 ACTCCCCAAACTCTTCATTTCTAA 57.799 37.500 0.00 0.00 0.00 2.10
1972 1973 6.610830 ACTCCCCAAACTCTTCATTTCTAAA 58.389 36.000 0.00 0.00 0.00 1.85
1973 1974 7.066781 ACTCCCCAAACTCTTCATTTCTAAAA 58.933 34.615 0.00 0.00 0.00 1.52
1974 1975 7.730332 ACTCCCCAAACTCTTCATTTCTAAAAT 59.270 33.333 0.00 0.00 0.00 1.82
1975 1976 7.895759 TCCCCAAACTCTTCATTTCTAAAATG 58.104 34.615 6.14 6.14 0.00 2.32
1976 1977 7.508977 TCCCCAAACTCTTCATTTCTAAAATGT 59.491 33.333 11.10 0.00 0.00 2.71
1977 1978 8.802267 CCCCAAACTCTTCATTTCTAAAATGTA 58.198 33.333 11.10 2.82 0.00 2.29
1988 1989 9.638239 TCATTTCTAAAATGTATTTTGACTGCC 57.362 29.630 11.72 0.00 40.00 4.85
1989 1990 9.643693 CATTTCTAAAATGTATTTTGACTGCCT 57.356 29.630 11.72 0.00 40.00 4.75
2062 2063 9.448587 AATAGAAACATGGGTTAGATAGTACCT 57.551 33.333 0.00 0.00 35.82 3.08
2064 2065 8.480133 AGAAACATGGGTTAGATAGTACCTAG 57.520 38.462 0.00 0.00 35.82 3.02
2065 2066 8.066247 AGAAACATGGGTTAGATAGTACCTAGT 58.934 37.037 0.00 0.00 35.82 2.57
2066 2067 7.598759 AACATGGGTTAGATAGTACCTAGTG 57.401 40.000 0.00 0.00 34.87 2.74
2067 2068 6.680540 ACATGGGTTAGATAGTACCTAGTGT 58.319 40.000 0.00 0.00 34.75 3.55
2068 2069 6.550108 ACATGGGTTAGATAGTACCTAGTGTG 59.450 42.308 0.00 0.00 34.75 3.82
2069 2070 6.331577 TGGGTTAGATAGTACCTAGTGTGA 57.668 41.667 0.00 0.00 34.75 3.58
2070 2071 6.734532 TGGGTTAGATAGTACCTAGTGTGAA 58.265 40.000 0.00 0.00 34.75 3.18
2071 2072 7.184161 TGGGTTAGATAGTACCTAGTGTGAAA 58.816 38.462 0.00 0.00 34.75 2.69
2072 2073 7.341256 TGGGTTAGATAGTACCTAGTGTGAAAG 59.659 40.741 0.00 0.00 34.75 2.62
2073 2074 7.341512 GGGTTAGATAGTACCTAGTGTGAAAGT 59.658 40.741 0.00 0.00 34.75 2.66
2074 2075 8.747471 GGTTAGATAGTACCTAGTGTGAAAGTT 58.253 37.037 0.00 0.00 0.00 2.66
2075 2076 9.570488 GTTAGATAGTACCTAGTGTGAAAGTTG 57.430 37.037 0.00 0.00 0.00 3.16
2076 2077 6.631962 AGATAGTACCTAGTGTGAAAGTTGC 58.368 40.000 0.00 0.00 0.00 4.17
2077 2078 4.682778 AGTACCTAGTGTGAAAGTTGCA 57.317 40.909 0.00 0.00 0.00 4.08
2078 2079 5.228945 AGTACCTAGTGTGAAAGTTGCAT 57.771 39.130 0.00 0.00 0.00 3.96
2079 2080 4.997395 AGTACCTAGTGTGAAAGTTGCATG 59.003 41.667 0.00 0.00 0.00 4.06
2080 2081 2.554032 ACCTAGTGTGAAAGTTGCATGC 59.446 45.455 11.82 11.82 0.00 4.06
2081 2082 2.816087 CCTAGTGTGAAAGTTGCATGCT 59.184 45.455 20.33 0.00 0.00 3.79
2082 2083 3.120060 CCTAGTGTGAAAGTTGCATGCTC 60.120 47.826 20.33 12.01 0.00 4.26
2083 2084 2.300433 AGTGTGAAAGTTGCATGCTCA 58.700 42.857 20.33 10.93 0.00 4.26
2084 2085 2.292569 AGTGTGAAAGTTGCATGCTCAG 59.707 45.455 20.33 0.00 0.00 3.35
2085 2086 1.001048 TGTGAAAGTTGCATGCTCAGC 60.001 47.619 20.33 0.97 0.00 4.26
2086 2087 0.599558 TGAAAGTTGCATGCTCAGCC 59.400 50.000 20.33 4.56 0.00 4.85
2087 2088 0.886563 GAAAGTTGCATGCTCAGCCT 59.113 50.000 20.33 4.39 0.00 4.58
2088 2089 2.086869 GAAAGTTGCATGCTCAGCCTA 58.913 47.619 20.33 0.00 0.00 3.93
2089 2090 2.431954 AAGTTGCATGCTCAGCCTAT 57.568 45.000 20.33 0.00 0.00 2.57
2090 2091 2.431954 AGTTGCATGCTCAGCCTATT 57.568 45.000 20.33 0.00 0.00 1.73
2091 2092 3.565764 AGTTGCATGCTCAGCCTATTA 57.434 42.857 20.33 0.00 0.00 0.98
2092 2093 3.209410 AGTTGCATGCTCAGCCTATTAC 58.791 45.455 20.33 1.85 0.00 1.89
2093 2094 2.945008 GTTGCATGCTCAGCCTATTACA 59.055 45.455 20.33 0.00 0.00 2.41
2094 2095 2.842457 TGCATGCTCAGCCTATTACAG 58.158 47.619 20.33 0.00 0.00 2.74
2108 2109 1.803334 TTACAGGATTCCACACACGC 58.197 50.000 5.29 0.00 0.00 5.34
2109 2110 0.973632 TACAGGATTCCACACACGCT 59.026 50.000 5.29 0.00 0.00 5.07
2110 2111 0.973632 ACAGGATTCCACACACGCTA 59.026 50.000 5.29 0.00 0.00 4.26
2111 2112 1.555075 ACAGGATTCCACACACGCTAT 59.445 47.619 5.29 0.00 0.00 2.97
2112 2113 1.935873 CAGGATTCCACACACGCTATG 59.064 52.381 5.29 0.00 0.00 2.23
2113 2114 1.555075 AGGATTCCACACACGCTATGT 59.445 47.619 5.29 0.00 44.81 2.29
2114 2115 2.764010 AGGATTCCACACACGCTATGTA 59.236 45.455 5.29 0.00 40.64 2.29
2115 2116 2.864343 GGATTCCACACACGCTATGTAC 59.136 50.000 0.00 0.00 40.64 2.90
2116 2117 2.373540 TTCCACACACGCTATGTACC 57.626 50.000 0.00 0.00 40.64 3.34
2117 2118 1.258676 TCCACACACGCTATGTACCA 58.741 50.000 0.00 0.00 40.64 3.25
2118 2119 1.828595 TCCACACACGCTATGTACCAT 59.171 47.619 0.00 0.00 40.64 3.55
2119 2120 2.235155 TCCACACACGCTATGTACCATT 59.765 45.455 0.00 0.00 40.64 3.16
2120 2121 3.447944 TCCACACACGCTATGTACCATTA 59.552 43.478 0.00 0.00 40.64 1.90
2121 2122 4.081586 TCCACACACGCTATGTACCATTAA 60.082 41.667 0.00 0.00 40.64 1.40
2122 2123 4.270084 CCACACACGCTATGTACCATTAAG 59.730 45.833 0.00 0.00 40.64 1.85
2123 2124 5.106442 CACACACGCTATGTACCATTAAGA 58.894 41.667 0.00 0.00 40.64 2.10
2124 2125 5.005394 CACACACGCTATGTACCATTAAGAC 59.995 44.000 0.00 0.00 40.64 3.01
2125 2126 5.106442 CACACGCTATGTACCATTAAGACA 58.894 41.667 0.00 0.00 40.64 3.41
2126 2127 5.232202 CACACGCTATGTACCATTAAGACAG 59.768 44.000 0.00 0.00 40.64 3.51
2127 2128 5.126545 ACACGCTATGTACCATTAAGACAGA 59.873 40.000 0.00 0.00 40.88 3.41
2128 2129 6.183360 ACACGCTATGTACCATTAAGACAGAT 60.183 38.462 0.00 0.00 40.88 2.90
2129 2130 6.701841 CACGCTATGTACCATTAAGACAGATT 59.298 38.462 0.00 0.00 0.00 2.40
2130 2131 7.224753 CACGCTATGTACCATTAAGACAGATTT 59.775 37.037 0.00 0.00 0.00 2.17
2131 2132 7.224753 ACGCTATGTACCATTAAGACAGATTTG 59.775 37.037 0.00 0.00 0.00 2.32
2132 2133 7.224753 CGCTATGTACCATTAAGACAGATTTGT 59.775 37.037 0.00 0.00 41.18 2.83
2143 2144 2.632377 ACAGATTTGTCTGCGTATGGG 58.368 47.619 5.40 0.00 41.19 4.00
2144 2145 2.236146 ACAGATTTGTCTGCGTATGGGA 59.764 45.455 5.40 0.00 41.19 4.37
2145 2146 3.270027 CAGATTTGTCTGCGTATGGGAA 58.730 45.455 0.00 0.00 0.00 3.97
2146 2147 3.689161 CAGATTTGTCTGCGTATGGGAAA 59.311 43.478 0.00 0.00 0.00 3.13
2147 2148 3.941483 AGATTTGTCTGCGTATGGGAAAG 59.059 43.478 0.00 0.00 0.00 2.62
2148 2149 2.851263 TTGTCTGCGTATGGGAAAGT 57.149 45.000 0.00 0.00 0.00 2.66
2149 2150 2.093306 TGTCTGCGTATGGGAAAGTG 57.907 50.000 0.00 0.00 0.00 3.16
2150 2151 1.346395 TGTCTGCGTATGGGAAAGTGT 59.654 47.619 0.00 0.00 0.00 3.55
2151 2152 2.563620 TGTCTGCGTATGGGAAAGTGTA 59.436 45.455 0.00 0.00 0.00 2.90
2152 2153 3.196901 TGTCTGCGTATGGGAAAGTGTAT 59.803 43.478 0.00 0.00 0.00 2.29
2153 2154 4.189231 GTCTGCGTATGGGAAAGTGTATT 58.811 43.478 0.00 0.00 0.00 1.89
2154 2155 4.634443 GTCTGCGTATGGGAAAGTGTATTT 59.366 41.667 0.00 0.00 0.00 1.40
2155 2156 5.123344 GTCTGCGTATGGGAAAGTGTATTTT 59.877 40.000 0.00 0.00 0.00 1.82
2156 2157 5.708230 TCTGCGTATGGGAAAGTGTATTTTT 59.292 36.000 0.00 0.00 0.00 1.94
2187 2188 9.997172 AGATCCAATAAAAATAAAGAGTTCCCT 57.003 29.630 0.00 0.00 0.00 4.20
2202 2203 9.549984 AAAGAGTTCCCTAGTTTCTATTAGACT 57.450 33.333 0.00 0.00 0.00 3.24
2203 2204 9.549984 AAGAGTTCCCTAGTTTCTATTAGACTT 57.450 33.333 0.00 0.00 0.00 3.01
2204 2205 8.973182 AGAGTTCCCTAGTTTCTATTAGACTTG 58.027 37.037 0.00 0.00 0.00 3.16
2205 2206 8.667592 AGTTCCCTAGTTTCTATTAGACTTGT 57.332 34.615 0.00 0.00 0.00 3.16
2206 2207 8.751242 AGTTCCCTAGTTTCTATTAGACTTGTC 58.249 37.037 0.00 0.00 0.00 3.18
2207 2208 8.751242 GTTCCCTAGTTTCTATTAGACTTGTCT 58.249 37.037 8.41 8.41 0.00 3.41
2208 2209 9.986157 TTCCCTAGTTTCTATTAGACTTGTCTA 57.014 33.333 6.41 6.41 0.00 2.59
2236 2237 9.726438 AAATATGTATGCCTTAACAGATCCTAC 57.274 33.333 0.00 0.00 27.89 3.18
2237 2238 6.747414 ATGTATGCCTTAACAGATCCTACA 57.253 37.500 0.00 0.00 0.00 2.74
2238 2239 6.553953 TGTATGCCTTAACAGATCCTACAA 57.446 37.500 0.00 0.00 0.00 2.41
2239 2240 6.953101 TGTATGCCTTAACAGATCCTACAAA 58.047 36.000 0.00 0.00 0.00 2.83
2240 2241 7.398829 TGTATGCCTTAACAGATCCTACAAAA 58.601 34.615 0.00 0.00 0.00 2.44
2241 2242 8.052748 TGTATGCCTTAACAGATCCTACAAAAT 58.947 33.333 0.00 0.00 0.00 1.82
2242 2243 7.573968 ATGCCTTAACAGATCCTACAAAATC 57.426 36.000 0.00 0.00 0.00 2.17
2243 2244 6.721318 TGCCTTAACAGATCCTACAAAATCT 58.279 36.000 0.00 0.00 32.44 2.40
2244 2245 7.857456 TGCCTTAACAGATCCTACAAAATCTA 58.143 34.615 0.00 0.00 31.10 1.98
2245 2246 8.325787 TGCCTTAACAGATCCTACAAAATCTAA 58.674 33.333 0.00 0.00 31.10 2.10
2246 2247 9.343539 GCCTTAACAGATCCTACAAAATCTAAT 57.656 33.333 0.00 0.00 31.10 1.73
2251 2252 8.970859 ACAGATCCTACAAAATCTAATCTTGG 57.029 34.615 0.00 0.00 31.10 3.61
2252 2253 8.552296 ACAGATCCTACAAAATCTAATCTTGGT 58.448 33.333 0.00 0.00 31.10 3.67
2253 2254 9.401058 CAGATCCTACAAAATCTAATCTTGGTT 57.599 33.333 0.00 0.00 31.10 3.67
2254 2255 9.981460 AGATCCTACAAAATCTAATCTTGGTTT 57.019 29.630 0.00 0.00 30.50 3.27
2261 2262 8.957466 ACAAAATCTAATCTTGGTTTAGTAGCC 58.043 33.333 0.00 0.00 0.00 3.93
2262 2263 9.178758 CAAAATCTAATCTTGGTTTAGTAGCCT 57.821 33.333 0.00 0.00 0.00 4.58
2263 2264 8.738645 AAATCTAATCTTGGTTTAGTAGCCTG 57.261 34.615 0.00 0.00 0.00 4.85
2264 2265 7.676683 ATCTAATCTTGGTTTAGTAGCCTGA 57.323 36.000 0.00 0.00 0.00 3.86
2265 2266 7.490657 TCTAATCTTGGTTTAGTAGCCTGAA 57.509 36.000 0.00 0.00 0.00 3.02
2266 2267 7.328737 TCTAATCTTGGTTTAGTAGCCTGAAC 58.671 38.462 0.00 0.00 36.67 3.18
2267 2268 4.967084 TCTTGGTTTAGTAGCCTGAACA 57.033 40.909 0.00 0.00 38.56 3.18
2268 2269 5.499004 TCTTGGTTTAGTAGCCTGAACAT 57.501 39.130 0.00 0.00 38.56 2.71
2269 2270 5.488341 TCTTGGTTTAGTAGCCTGAACATC 58.512 41.667 0.00 0.00 38.56 3.06
2270 2271 4.216411 TGGTTTAGTAGCCTGAACATCC 57.784 45.455 0.00 0.00 38.56 3.51
2271 2272 3.585289 TGGTTTAGTAGCCTGAACATCCA 59.415 43.478 0.00 0.00 38.56 3.41
2272 2273 4.227300 TGGTTTAGTAGCCTGAACATCCAT 59.773 41.667 0.00 0.00 38.56 3.41
2273 2274 5.193679 GGTTTAGTAGCCTGAACATCCATT 58.806 41.667 0.00 0.00 38.56 3.16
2274 2275 5.066505 GGTTTAGTAGCCTGAACATCCATTG 59.933 44.000 0.00 0.00 38.56 2.82
2275 2276 5.692115 TTAGTAGCCTGAACATCCATTGA 57.308 39.130 0.00 0.00 0.00 2.57
2276 2277 4.574674 AGTAGCCTGAACATCCATTGAA 57.425 40.909 0.00 0.00 0.00 2.69
2277 2278 4.265073 AGTAGCCTGAACATCCATTGAAC 58.735 43.478 0.00 0.00 0.00 3.18
2278 2279 2.450476 AGCCTGAACATCCATTGAACC 58.550 47.619 0.00 0.00 0.00 3.62
2279 2280 2.170166 GCCTGAACATCCATTGAACCA 58.830 47.619 0.00 0.00 0.00 3.67
2280 2281 2.094545 GCCTGAACATCCATTGAACCAC 60.095 50.000 0.00 0.00 0.00 4.16
2281 2282 3.156293 CCTGAACATCCATTGAACCACA 58.844 45.455 0.00 0.00 0.00 4.17
2282 2283 3.573538 CCTGAACATCCATTGAACCACAA 59.426 43.478 0.00 0.00 42.95 3.33
2283 2284 4.039004 CCTGAACATCCATTGAACCACAAA 59.961 41.667 0.00 0.00 42.03 2.83
2284 2285 5.453057 CCTGAACATCCATTGAACCACAAAA 60.453 40.000 0.00 0.00 42.03 2.44
2285 2286 6.172136 TGAACATCCATTGAACCACAAAAT 57.828 33.333 0.00 0.00 42.03 1.82
2286 2287 5.990386 TGAACATCCATTGAACCACAAAATG 59.010 36.000 0.00 0.00 42.03 2.32
2287 2288 5.804944 ACATCCATTGAACCACAAAATGA 57.195 34.783 0.00 0.00 42.03 2.57
2288 2289 6.363167 ACATCCATTGAACCACAAAATGAT 57.637 33.333 0.00 0.00 42.03 2.45
2289 2290 6.167685 ACATCCATTGAACCACAAAATGATG 58.832 36.000 0.00 0.00 42.03 3.07
2290 2291 5.804944 TCCATTGAACCACAAAATGATGT 57.195 34.783 0.00 0.00 42.03 3.06
2291 2292 6.172136 TCCATTGAACCACAAAATGATGTT 57.828 33.333 0.00 0.00 42.03 2.71
2292 2293 6.590068 TCCATTGAACCACAAAATGATGTTT 58.410 32.000 0.00 0.00 42.03 2.83
2293 2294 7.052873 TCCATTGAACCACAAAATGATGTTTT 58.947 30.769 0.00 0.00 42.03 2.43
2294 2295 7.555554 TCCATTGAACCACAAAATGATGTTTTT 59.444 29.630 0.00 0.00 42.03 1.94
2295 2296 8.834465 CCATTGAACCACAAAATGATGTTTTTA 58.166 29.630 0.00 0.00 42.03 1.52
2296 2297 9.649024 CATTGAACCACAAAATGATGTTTTTAC 57.351 29.630 0.00 0.00 42.03 2.01
2297 2298 8.777865 TTGAACCACAAAATGATGTTTTTACA 57.222 26.923 0.00 0.00 35.39 2.41
2298 2299 8.190888 TGAACCACAAAATGATGTTTTTACAC 57.809 30.769 0.00 0.00 0.00 2.90
2299 2300 7.278868 TGAACCACAAAATGATGTTTTTACACC 59.721 33.333 0.00 0.00 0.00 4.16
2300 2301 5.751028 ACCACAAAATGATGTTTTTACACCG 59.249 36.000 0.00 0.00 0.00 4.94
2301 2302 5.980116 CCACAAAATGATGTTTTTACACCGA 59.020 36.000 0.00 0.00 0.00 4.69
2302 2303 6.143758 CCACAAAATGATGTTTTTACACCGAG 59.856 38.462 0.00 0.00 0.00 4.63
2303 2304 6.143758 CACAAAATGATGTTTTTACACCGAGG 59.856 38.462 0.00 0.00 0.00 4.63
2304 2305 6.183360 ACAAAATGATGTTTTTACACCGAGGT 60.183 34.615 0.00 0.00 0.00 3.85
2305 2306 7.013464 ACAAAATGATGTTTTTACACCGAGGTA 59.987 33.333 0.00 0.00 0.00 3.08
2306 2307 6.490566 AATGATGTTTTTACACCGAGGTAC 57.509 37.500 0.00 0.00 0.00 3.34
2308 2309 6.343716 TGATGTTTTTACACCGAGGTACTA 57.656 37.500 0.00 0.00 41.55 1.82
2309 2310 6.757237 TGATGTTTTTACACCGAGGTACTAA 58.243 36.000 0.00 0.00 41.55 2.24
2310 2311 7.215789 TGATGTTTTTACACCGAGGTACTAAA 58.784 34.615 0.00 0.00 41.55 1.85
2311 2312 7.385752 TGATGTTTTTACACCGAGGTACTAAAG 59.614 37.037 0.00 0.00 41.55 1.85
2312 2313 6.581712 TGTTTTTACACCGAGGTACTAAAGT 58.418 36.000 0.00 0.00 41.55 2.66
2313 2314 6.701400 TGTTTTTACACCGAGGTACTAAAGTC 59.299 38.462 0.00 0.00 41.55 3.01
2314 2315 6.403866 TTTTACACCGAGGTACTAAAGTCA 57.596 37.500 0.00 0.00 41.55 3.41
2315 2316 6.594788 TTTACACCGAGGTACTAAAGTCAT 57.405 37.500 0.00 0.00 41.55 3.06
2316 2317 7.701539 TTTACACCGAGGTACTAAAGTCATA 57.298 36.000 0.00 0.00 41.55 2.15
2317 2318 7.701539 TTACACCGAGGTACTAAAGTCATAA 57.298 36.000 0.00 0.00 41.55 1.90
2318 2319 6.594788 ACACCGAGGTACTAAAGTCATAAA 57.405 37.500 0.00 0.00 41.55 1.40
2319 2320 6.393171 ACACCGAGGTACTAAAGTCATAAAC 58.607 40.000 0.00 0.00 41.55 2.01
2320 2321 6.015180 ACACCGAGGTACTAAAGTCATAAACA 60.015 38.462 0.00 0.00 41.55 2.83
2321 2322 6.530534 CACCGAGGTACTAAAGTCATAAACAG 59.469 42.308 0.00 0.00 41.55 3.16
2322 2323 5.519206 CCGAGGTACTAAAGTCATAAACAGC 59.481 44.000 0.00 0.00 41.55 4.40
2323 2324 5.519206 CGAGGTACTAAAGTCATAAACAGCC 59.481 44.000 0.00 0.00 41.55 4.85
2324 2325 6.622427 AGGTACTAAAGTCATAAACAGCCT 57.378 37.500 0.00 0.00 36.02 4.58
2325 2326 7.017319 AGGTACTAAAGTCATAAACAGCCTT 57.983 36.000 0.00 0.00 36.02 4.35
2326 2327 8.142485 AGGTACTAAAGTCATAAACAGCCTTA 57.858 34.615 0.00 0.00 36.02 2.69
2327 2328 8.039538 AGGTACTAAAGTCATAAACAGCCTTAC 58.960 37.037 0.00 0.00 36.02 2.34
2328 2329 7.279536 GGTACTAAAGTCATAAACAGCCTTACC 59.720 40.741 0.00 0.00 0.00 2.85
2329 2330 6.178324 ACTAAAGTCATAAACAGCCTTACCC 58.822 40.000 0.00 0.00 0.00 3.69
2330 2331 4.929146 AAGTCATAAACAGCCTTACCCT 57.071 40.909 0.00 0.00 0.00 4.34
2331 2332 4.929146 AGTCATAAACAGCCTTACCCTT 57.071 40.909 0.00 0.00 0.00 3.95
2332 2333 5.256806 AGTCATAAACAGCCTTACCCTTT 57.743 39.130 0.00 0.00 0.00 3.11
2333 2334 5.010282 AGTCATAAACAGCCTTACCCTTTG 58.990 41.667 0.00 0.00 0.00 2.77
2334 2335 4.157840 GTCATAAACAGCCTTACCCTTTGG 59.842 45.833 0.00 0.00 37.80 3.28
2344 2345 4.213630 CCCTTTGGGTGGCACATT 57.786 55.556 20.82 0.00 44.52 2.71
2345 2346 3.372557 CCCTTTGGGTGGCACATTA 57.627 52.632 20.82 1.48 44.52 1.90
2346 2347 0.894835 CCCTTTGGGTGGCACATTAC 59.105 55.000 20.82 6.93 44.52 1.89
2347 2348 1.626686 CCTTTGGGTGGCACATTACA 58.373 50.000 20.82 9.56 44.52 2.41
2348 2349 2.178580 CCTTTGGGTGGCACATTACAT 58.821 47.619 20.82 0.00 44.52 2.29
2349 2350 3.360867 CCTTTGGGTGGCACATTACATA 58.639 45.455 20.82 6.86 44.52 2.29
2350 2351 3.766591 CCTTTGGGTGGCACATTACATAA 59.233 43.478 20.82 8.47 44.52 1.90
2351 2352 4.381505 CCTTTGGGTGGCACATTACATAAC 60.382 45.833 20.82 0.00 44.52 1.89
2352 2353 3.441500 TGGGTGGCACATTACATAACA 57.558 42.857 20.82 1.02 44.52 2.41
2353 2354 3.974719 TGGGTGGCACATTACATAACAT 58.025 40.909 20.82 0.00 44.52 2.71
2354 2355 4.348486 TGGGTGGCACATTACATAACATT 58.652 39.130 20.82 0.00 44.52 2.71
2355 2356 4.774726 TGGGTGGCACATTACATAACATTT 59.225 37.500 20.82 0.00 44.52 2.32
2356 2357 5.105554 TGGGTGGCACATTACATAACATTTC 60.106 40.000 20.82 0.00 44.52 2.17
2357 2358 5.105554 GGGTGGCACATTACATAACATTTCA 60.106 40.000 20.82 0.00 44.52 2.69
2358 2359 5.804979 GGTGGCACATTACATAACATTTCAC 59.195 40.000 20.82 0.00 44.52 3.18
2359 2360 6.350110 GGTGGCACATTACATAACATTTCACT 60.350 38.462 20.82 0.00 44.52 3.41
2360 2361 7.148154 GGTGGCACATTACATAACATTTCACTA 60.148 37.037 20.82 0.00 44.52 2.74
2361 2362 7.696453 GTGGCACATTACATAACATTTCACTAC 59.304 37.037 13.86 0.00 44.52 2.73
2362 2363 7.391833 TGGCACATTACATAACATTTCACTACA 59.608 33.333 0.00 0.00 0.00 2.74
2363 2364 8.405531 GGCACATTACATAACATTTCACTACAT 58.594 33.333 0.00 0.00 0.00 2.29
2364 2365 9.225201 GCACATTACATAACATTTCACTACATG 57.775 33.333 0.00 0.00 0.00 3.21
2365 2366 9.720667 CACATTACATAACATTTCACTACATGG 57.279 33.333 0.00 0.00 0.00 3.66
2366 2367 8.405531 ACATTACATAACATTTCACTACATGGC 58.594 33.333 0.00 0.00 0.00 4.40
2367 2368 7.929941 TTACATAACATTTCACTACATGGCA 57.070 32.000 0.00 0.00 0.00 4.92
2368 2369 6.194796 ACATAACATTTCACTACATGGCAC 57.805 37.500 0.00 0.00 0.00 5.01
2369 2370 5.945784 ACATAACATTTCACTACATGGCACT 59.054 36.000 0.00 0.00 0.00 4.40
2370 2371 6.434028 ACATAACATTTCACTACATGGCACTT 59.566 34.615 0.00 0.00 0.00 3.16
2371 2372 5.376854 AACATTTCACTACATGGCACTTC 57.623 39.130 0.00 0.00 0.00 3.01
2372 2373 4.655963 ACATTTCACTACATGGCACTTCT 58.344 39.130 0.00 0.00 0.00 2.85
2373 2374 5.072741 ACATTTCACTACATGGCACTTCTT 58.927 37.500 0.00 0.00 0.00 2.52
2374 2375 5.536161 ACATTTCACTACATGGCACTTCTTT 59.464 36.000 0.00 0.00 0.00 2.52
2375 2376 6.040842 ACATTTCACTACATGGCACTTCTTTT 59.959 34.615 0.00 0.00 0.00 2.27
2376 2377 5.437289 TTCACTACATGGCACTTCTTTTG 57.563 39.130 0.00 0.00 0.00 2.44
2377 2378 4.460263 TCACTACATGGCACTTCTTTTGT 58.540 39.130 0.00 0.00 0.00 2.83
2378 2379 4.887071 TCACTACATGGCACTTCTTTTGTT 59.113 37.500 0.00 0.00 0.00 2.83
2379 2380 4.977963 CACTACATGGCACTTCTTTTGTTG 59.022 41.667 0.00 0.00 0.00 3.33
2380 2381 4.644685 ACTACATGGCACTTCTTTTGTTGT 59.355 37.500 0.00 0.00 0.00 3.32
2381 2382 5.825679 ACTACATGGCACTTCTTTTGTTGTA 59.174 36.000 0.00 0.00 0.00 2.41
2382 2383 5.789643 ACATGGCACTTCTTTTGTTGTAT 57.210 34.783 0.00 0.00 0.00 2.29
2383 2384 6.892658 ACATGGCACTTCTTTTGTTGTATA 57.107 33.333 0.00 0.00 0.00 1.47
2384 2385 7.466746 ACATGGCACTTCTTTTGTTGTATAT 57.533 32.000 0.00 0.00 0.00 0.86
2385 2386 7.315142 ACATGGCACTTCTTTTGTTGTATATG 58.685 34.615 0.00 0.00 0.00 1.78
2386 2387 6.266168 TGGCACTTCTTTTGTTGTATATGG 57.734 37.500 0.00 0.00 0.00 2.74
2387 2388 5.102313 GGCACTTCTTTTGTTGTATATGGC 58.898 41.667 0.00 0.00 0.00 4.40
2388 2389 5.105756 GGCACTTCTTTTGTTGTATATGGCT 60.106 40.000 0.00 0.00 0.00 4.75
2389 2390 6.389906 GCACTTCTTTTGTTGTATATGGCTT 58.610 36.000 0.00 0.00 0.00 4.35
2390 2391 6.868339 GCACTTCTTTTGTTGTATATGGCTTT 59.132 34.615 0.00 0.00 0.00 3.51
2391 2392 7.384932 GCACTTCTTTTGTTGTATATGGCTTTT 59.615 33.333 0.00 0.00 0.00 2.27
2392 2393 8.915654 CACTTCTTTTGTTGTATATGGCTTTTC 58.084 33.333 0.00 0.00 0.00 2.29
2393 2394 8.088365 ACTTCTTTTGTTGTATATGGCTTTTCC 58.912 33.333 0.00 0.00 0.00 3.13
2394 2395 6.616947 TCTTTTGTTGTATATGGCTTTTCCG 58.383 36.000 0.00 0.00 37.80 4.30
2395 2396 4.974368 TTGTTGTATATGGCTTTTCCGG 57.026 40.909 0.00 0.00 37.80 5.14
2396 2397 3.958018 TGTTGTATATGGCTTTTCCGGT 58.042 40.909 0.00 0.00 37.80 5.28
2397 2398 5.100344 TGTTGTATATGGCTTTTCCGGTA 57.900 39.130 0.00 0.00 37.80 4.02
2398 2399 5.498393 TGTTGTATATGGCTTTTCCGGTAA 58.502 37.500 0.00 0.00 37.80 2.85
2399 2400 5.944599 TGTTGTATATGGCTTTTCCGGTAAA 59.055 36.000 6.07 6.07 37.80 2.01
2400 2401 6.433404 TGTTGTATATGGCTTTTCCGGTAAAA 59.567 34.615 7.70 9.14 37.80 1.52
2401 2402 7.122948 TGTTGTATATGGCTTTTCCGGTAAAAT 59.877 33.333 7.70 1.62 36.49 1.82
2402 2403 7.266922 TGTATATGGCTTTTCCGGTAAAATC 57.733 36.000 7.70 6.16 36.49 2.17
2403 2404 6.829298 TGTATATGGCTTTTCCGGTAAAATCA 59.171 34.615 7.70 8.85 36.49 2.57
2404 2405 6.783708 ATATGGCTTTTCCGGTAAAATCAA 57.216 33.333 7.70 1.05 36.49 2.57
2405 2406 4.513198 TGGCTTTTCCGGTAAAATCAAG 57.487 40.909 7.70 0.00 36.49 3.02
2406 2407 4.145807 TGGCTTTTCCGGTAAAATCAAGA 58.854 39.130 7.70 0.00 36.49 3.02
2407 2408 4.022676 TGGCTTTTCCGGTAAAATCAAGAC 60.023 41.667 7.70 0.00 36.49 3.01
2408 2409 4.482386 GCTTTTCCGGTAAAATCAAGACC 58.518 43.478 7.70 0.00 36.49 3.85
2418 2419 7.474398 GGTAAAATCAAGACCGGTAGTAATC 57.526 40.000 7.34 0.00 0.00 1.75
2419 2420 7.270779 GGTAAAATCAAGACCGGTAGTAATCT 58.729 38.462 7.34 0.00 0.00 2.40
2420 2421 7.437565 GGTAAAATCAAGACCGGTAGTAATCTC 59.562 40.741 7.34 0.00 0.00 2.75
2421 2422 6.793505 AAATCAAGACCGGTAGTAATCTCT 57.206 37.500 7.34 0.00 0.00 3.10
2422 2423 5.776173 ATCAAGACCGGTAGTAATCTCTG 57.224 43.478 7.34 1.18 0.00 3.35
2423 2424 4.851843 TCAAGACCGGTAGTAATCTCTGA 58.148 43.478 7.34 3.56 0.00 3.27
2424 2425 5.258841 TCAAGACCGGTAGTAATCTCTGAA 58.741 41.667 7.34 0.00 0.00 3.02
2425 2426 5.357314 TCAAGACCGGTAGTAATCTCTGAAG 59.643 44.000 7.34 0.00 0.00 3.02
2426 2427 5.113446 AGACCGGTAGTAATCTCTGAAGA 57.887 43.478 7.34 0.00 35.54 2.87
2427 2428 5.507637 AGACCGGTAGTAATCTCTGAAGAA 58.492 41.667 7.34 0.00 34.49 2.52
2428 2429 6.130569 AGACCGGTAGTAATCTCTGAAGAAT 58.869 40.000 7.34 0.00 34.49 2.40
2429 2430 7.288560 AGACCGGTAGTAATCTCTGAAGAATA 58.711 38.462 7.34 0.00 34.49 1.75
2430 2431 7.229106 AGACCGGTAGTAATCTCTGAAGAATAC 59.771 40.741 7.34 0.00 37.92 1.89
2431 2432 6.832384 ACCGGTAGTAATCTCTGAAGAATACA 59.168 38.462 4.49 0.00 39.44 2.29
2432 2433 7.506261 ACCGGTAGTAATCTCTGAAGAATACAT 59.494 37.037 4.49 0.00 39.44 2.29
2433 2434 7.810282 CCGGTAGTAATCTCTGAAGAATACATG 59.190 40.741 0.00 0.00 39.44 3.21
2434 2435 8.353684 CGGTAGTAATCTCTGAAGAATACATGT 58.646 37.037 2.69 2.69 39.44 3.21
2435 2436 9.469807 GGTAGTAATCTCTGAAGAATACATGTG 57.530 37.037 9.11 0.00 39.44 3.21
2436 2437 9.469807 GTAGTAATCTCTGAAGAATACATGTGG 57.530 37.037 9.11 0.00 39.44 4.17
2437 2438 8.311395 AGTAATCTCTGAAGAATACATGTGGA 57.689 34.615 9.11 0.00 39.44 4.02
2438 2439 8.420222 AGTAATCTCTGAAGAATACATGTGGAG 58.580 37.037 9.11 3.65 39.44 3.86
2439 2440 6.805016 ATCTCTGAAGAATACATGTGGAGT 57.195 37.500 9.11 0.00 34.49 3.85
2440 2441 6.611613 TCTCTGAAGAATACATGTGGAGTT 57.388 37.500 9.11 0.00 0.00 3.01
2441 2442 7.009179 TCTCTGAAGAATACATGTGGAGTTT 57.991 36.000 9.11 0.00 0.00 2.66
2442 2443 7.099764 TCTCTGAAGAATACATGTGGAGTTTC 58.900 38.462 9.11 6.77 0.00 2.78
2443 2444 6.768483 TCTGAAGAATACATGTGGAGTTTCA 58.232 36.000 9.11 10.69 0.00 2.69
2444 2445 7.223584 TCTGAAGAATACATGTGGAGTTTCAA 58.776 34.615 9.11 2.04 0.00 2.69
2445 2446 7.719193 TCTGAAGAATACATGTGGAGTTTCAAA 59.281 33.333 9.11 0.00 0.00 2.69
2446 2447 7.874940 TGAAGAATACATGTGGAGTTTCAAAG 58.125 34.615 9.11 0.00 0.00 2.77
2447 2448 7.719193 TGAAGAATACATGTGGAGTTTCAAAGA 59.281 33.333 9.11 0.00 0.00 2.52
2448 2449 8.463930 AAGAATACATGTGGAGTTTCAAAGAA 57.536 30.769 9.11 0.00 0.00 2.52
2449 2450 8.463930 AGAATACATGTGGAGTTTCAAAGAAA 57.536 30.769 9.11 0.00 0.00 2.52
2450 2451 8.571336 AGAATACATGTGGAGTTTCAAAGAAAG 58.429 33.333 9.11 0.00 0.00 2.62
2451 2452 8.463930 AATACATGTGGAGTTTCAAAGAAAGA 57.536 30.769 9.11 0.00 0.00 2.52
2452 2453 6.966534 ACATGTGGAGTTTCAAAGAAAGAT 57.033 33.333 0.00 0.00 0.00 2.40
2453 2454 9.739276 ATACATGTGGAGTTTCAAAGAAAGATA 57.261 29.630 9.11 0.00 0.00 1.98
2454 2455 8.641498 ACATGTGGAGTTTCAAAGAAAGATAT 57.359 30.769 0.00 0.00 0.00 1.63
2455 2456 8.734386 ACATGTGGAGTTTCAAAGAAAGATATC 58.266 33.333 0.00 0.00 0.00 1.63
2456 2457 8.733458 CATGTGGAGTTTCAAAGAAAGATATCA 58.267 33.333 5.32 0.00 0.00 2.15
2457 2458 8.690203 TGTGGAGTTTCAAAGAAAGATATCAA 57.310 30.769 5.32 0.00 0.00 2.57
2458 2459 9.130661 TGTGGAGTTTCAAAGAAAGATATCAAA 57.869 29.630 5.32 0.00 0.00 2.69
2459 2460 9.965824 GTGGAGTTTCAAAGAAAGATATCAAAA 57.034 29.630 5.32 0.00 0.00 2.44
2480 2481 9.173021 TCAAAATATATGAGTGTGTTGGTAAGG 57.827 33.333 0.00 0.00 0.00 2.69
2481 2482 9.173021 CAAAATATATGAGTGTGTTGGTAAGGA 57.827 33.333 0.00 0.00 0.00 3.36
2482 2483 8.732746 AAATATATGAGTGTGTTGGTAAGGAC 57.267 34.615 0.00 0.00 0.00 3.85
2483 2484 5.755409 ATATGAGTGTGTTGGTAAGGACA 57.245 39.130 0.00 0.00 0.00 4.02
2484 2485 3.469008 TGAGTGTGTTGGTAAGGACAG 57.531 47.619 0.00 0.00 0.00 3.51
2485 2486 3.035363 TGAGTGTGTTGGTAAGGACAGA 58.965 45.455 0.00 0.00 0.00 3.41
2486 2487 3.181469 TGAGTGTGTTGGTAAGGACAGAC 60.181 47.826 0.00 0.00 39.53 3.51
2487 2488 3.039011 AGTGTGTTGGTAAGGACAGACT 58.961 45.455 1.07 1.07 43.13 3.24
2488 2489 3.454812 AGTGTGTTGGTAAGGACAGACTT 59.545 43.478 1.07 0.00 44.85 3.01
2489 2490 3.560068 GTGTGTTGGTAAGGACAGACTTG 59.440 47.826 0.00 0.00 37.16 3.16
2490 2491 3.452990 TGTGTTGGTAAGGACAGACTTGA 59.547 43.478 0.00 0.00 32.02 3.02
2491 2492 4.102524 TGTGTTGGTAAGGACAGACTTGAT 59.897 41.667 0.00 0.00 32.02 2.57
2492 2493 5.063880 GTGTTGGTAAGGACAGACTTGATT 58.936 41.667 0.00 0.00 32.02 2.57
2493 2494 6.183361 TGTGTTGGTAAGGACAGACTTGATTA 60.183 38.462 0.00 0.00 32.02 1.75
2494 2495 6.369065 GTGTTGGTAAGGACAGACTTGATTAG 59.631 42.308 0.00 0.00 32.02 1.73
2495 2496 6.042781 TGTTGGTAAGGACAGACTTGATTAGT 59.957 38.462 0.00 0.00 40.71 2.24
2496 2497 7.233962 TGTTGGTAAGGACAGACTTGATTAGTA 59.766 37.037 0.00 0.00 37.17 1.82
2497 2498 7.166691 TGGTAAGGACAGACTTGATTAGTAC 57.833 40.000 0.00 0.00 37.17 2.73
2498 2499 6.722590 TGGTAAGGACAGACTTGATTAGTACA 59.277 38.462 0.00 0.00 37.17 2.90
2499 2500 7.233962 TGGTAAGGACAGACTTGATTAGTACAA 59.766 37.037 0.00 0.00 37.17 2.41
2500 2501 7.760340 GGTAAGGACAGACTTGATTAGTACAAG 59.240 40.741 0.00 0.00 46.69 3.16
2501 2502 5.725362 AGGACAGACTTGATTAGTACAAGC 58.275 41.667 0.00 0.00 45.66 4.01
2502 2503 4.563184 GGACAGACTTGATTAGTACAAGCG 59.437 45.833 0.00 0.00 45.66 4.68
2503 2504 4.495422 ACAGACTTGATTAGTACAAGCGG 58.505 43.478 0.00 0.00 45.66 5.52
2504 2505 4.021368 ACAGACTTGATTAGTACAAGCGGT 60.021 41.667 0.00 0.00 45.66 5.68
2505 2506 5.184479 ACAGACTTGATTAGTACAAGCGGTA 59.816 40.000 0.00 0.00 45.66 4.02
2506 2507 6.097356 CAGACTTGATTAGTACAAGCGGTAA 58.903 40.000 0.00 0.00 45.66 2.85
2507 2508 6.253727 CAGACTTGATTAGTACAAGCGGTAAG 59.746 42.308 0.00 0.00 45.66 2.34
2508 2509 6.152323 AGACTTGATTAGTACAAGCGGTAAGA 59.848 38.462 0.00 0.00 45.66 2.10
2509 2510 6.694447 ACTTGATTAGTACAAGCGGTAAGAA 58.306 36.000 0.00 0.00 45.66 2.52
2510 2511 7.156673 ACTTGATTAGTACAAGCGGTAAGAAA 58.843 34.615 0.00 0.00 45.66 2.52
2511 2512 7.822822 ACTTGATTAGTACAAGCGGTAAGAAAT 59.177 33.333 0.00 0.00 45.66 2.17
2512 2513 7.534085 TGATTAGTACAAGCGGTAAGAAATG 57.466 36.000 0.00 0.00 32.72 2.32
2513 2514 6.537301 TGATTAGTACAAGCGGTAAGAAATGG 59.463 38.462 0.00 0.00 32.72 3.16
2514 2515 4.546829 AGTACAAGCGGTAAGAAATGGA 57.453 40.909 0.00 0.00 32.72 3.41
2515 2516 5.099042 AGTACAAGCGGTAAGAAATGGAT 57.901 39.130 0.00 0.00 32.72 3.41
2516 2517 6.229936 AGTACAAGCGGTAAGAAATGGATA 57.770 37.500 0.00 0.00 32.72 2.59
2517 2518 6.646267 AGTACAAGCGGTAAGAAATGGATAA 58.354 36.000 0.00 0.00 32.72 1.75
2518 2519 7.280356 AGTACAAGCGGTAAGAAATGGATAAT 58.720 34.615 0.00 0.00 32.72 1.28
2519 2520 7.773690 AGTACAAGCGGTAAGAAATGGATAATT 59.226 33.333 0.00 0.00 32.72 1.40
2520 2521 7.404671 ACAAGCGGTAAGAAATGGATAATTT 57.595 32.000 0.00 0.00 41.33 1.82
2536 2537 8.873215 TGGATAATTTCTATCGTTTCTCTGAC 57.127 34.615 0.00 0.00 0.00 3.51
2537 2538 8.696374 TGGATAATTTCTATCGTTTCTCTGACT 58.304 33.333 0.00 0.00 0.00 3.41
2538 2539 9.535878 GGATAATTTCTATCGTTTCTCTGACTT 57.464 33.333 0.00 0.00 0.00 3.01
2542 2543 9.495572 AATTTCTATCGTTTCTCTGACTTCTTT 57.504 29.630 0.00 0.00 0.00 2.52
2543 2544 8.522178 TTTCTATCGTTTCTCTGACTTCTTTC 57.478 34.615 0.00 0.00 0.00 2.62
2544 2545 6.622549 TCTATCGTTTCTCTGACTTCTTTCC 58.377 40.000 0.00 0.00 0.00 3.13
2545 2546 4.665833 TCGTTTCTCTGACTTCTTTCCA 57.334 40.909 0.00 0.00 0.00 3.53
2546 2547 5.018539 TCGTTTCTCTGACTTCTTTCCAA 57.981 39.130 0.00 0.00 0.00 3.53
2547 2548 4.809426 TCGTTTCTCTGACTTCTTTCCAAC 59.191 41.667 0.00 0.00 0.00 3.77
2548 2549 4.024809 CGTTTCTCTGACTTCTTTCCAACC 60.025 45.833 0.00 0.00 0.00 3.77
2549 2550 3.771577 TCTCTGACTTCTTTCCAACCC 57.228 47.619 0.00 0.00 0.00 4.11
2550 2551 3.045634 TCTCTGACTTCTTTCCAACCCA 58.954 45.455 0.00 0.00 0.00 4.51
2551 2552 3.142174 CTCTGACTTCTTTCCAACCCAC 58.858 50.000 0.00 0.00 0.00 4.61
2552 2553 2.777692 TCTGACTTCTTTCCAACCCACT 59.222 45.455 0.00 0.00 0.00 4.00
2553 2554 3.202151 TCTGACTTCTTTCCAACCCACTT 59.798 43.478 0.00 0.00 0.00 3.16
2554 2555 3.954258 CTGACTTCTTTCCAACCCACTTT 59.046 43.478 0.00 0.00 0.00 2.66
2555 2556 3.951680 TGACTTCTTTCCAACCCACTTTC 59.048 43.478 0.00 0.00 0.00 2.62
2556 2557 3.296854 ACTTCTTTCCAACCCACTTTCC 58.703 45.455 0.00 0.00 0.00 3.13
2557 2558 3.052869 ACTTCTTTCCAACCCACTTTCCT 60.053 43.478 0.00 0.00 0.00 3.36
2558 2559 4.167307 ACTTCTTTCCAACCCACTTTCCTA 59.833 41.667 0.00 0.00 0.00 2.94
2559 2560 5.162980 ACTTCTTTCCAACCCACTTTCCTAT 60.163 40.000 0.00 0.00 0.00 2.57
2560 2561 5.333566 TCTTTCCAACCCACTTTCCTATT 57.666 39.130 0.00 0.00 0.00 1.73
2561 2562 5.711698 TCTTTCCAACCCACTTTCCTATTT 58.288 37.500 0.00 0.00 0.00 1.40
2562 2563 6.140377 TCTTTCCAACCCACTTTCCTATTTT 58.860 36.000 0.00 0.00 0.00 1.82
2563 2564 6.613679 TCTTTCCAACCCACTTTCCTATTTTT 59.386 34.615 0.00 0.00 0.00 1.94
2564 2565 5.799827 TCCAACCCACTTTCCTATTTTTG 57.200 39.130 0.00 0.00 0.00 2.44
2565 2566 5.212745 TCCAACCCACTTTCCTATTTTTGT 58.787 37.500 0.00 0.00 0.00 2.83
2566 2567 6.374588 TCCAACCCACTTTCCTATTTTTGTA 58.625 36.000 0.00 0.00 0.00 2.41
2567 2568 7.013834 TCCAACCCACTTTCCTATTTTTGTAT 58.986 34.615 0.00 0.00 0.00 2.29
2568 2569 8.171400 TCCAACCCACTTTCCTATTTTTGTATA 58.829 33.333 0.00 0.00 0.00 1.47
2569 2570 8.466798 CCAACCCACTTTCCTATTTTTGTATAG 58.533 37.037 0.00 0.00 0.00 1.31
2570 2571 8.466798 CAACCCACTTTCCTATTTTTGTATAGG 58.533 37.037 0.00 0.00 45.73 2.57
2592 2593 4.974591 GAAATTTTCCATCTCACGGTCAG 58.025 43.478 0.00 0.00 0.00 3.51
2593 2594 3.981071 ATTTTCCATCTCACGGTCAGA 57.019 42.857 0.00 0.00 0.00 3.27
2594 2595 3.762407 TTTTCCATCTCACGGTCAGAA 57.238 42.857 0.00 0.00 0.00 3.02
2595 2596 3.319137 TTTCCATCTCACGGTCAGAAG 57.681 47.619 0.00 0.00 0.00 2.85
2596 2597 1.924731 TCCATCTCACGGTCAGAAGT 58.075 50.000 0.00 0.00 0.00 3.01
2597 2598 1.819288 TCCATCTCACGGTCAGAAGTC 59.181 52.381 0.00 0.00 0.00 3.01
2598 2599 1.134965 CCATCTCACGGTCAGAAGTCC 60.135 57.143 0.00 0.00 0.00 3.85
2599 2600 1.546029 CATCTCACGGTCAGAAGTCCA 59.454 52.381 0.00 0.00 0.00 4.02
2600 2601 1.924731 TCTCACGGTCAGAAGTCCAT 58.075 50.000 0.00 0.00 0.00 3.41
2601 2602 2.248248 TCTCACGGTCAGAAGTCCATT 58.752 47.619 0.00 0.00 0.00 3.16
2602 2603 3.427573 TCTCACGGTCAGAAGTCCATTA 58.572 45.455 0.00 0.00 0.00 1.90
2603 2604 3.830178 TCTCACGGTCAGAAGTCCATTAA 59.170 43.478 0.00 0.00 0.00 1.40
2604 2605 4.282449 TCTCACGGTCAGAAGTCCATTAAA 59.718 41.667 0.00 0.00 0.00 1.52
2605 2606 5.046591 TCTCACGGTCAGAAGTCCATTAAAT 60.047 40.000 0.00 0.00 0.00 1.40
2606 2607 5.556915 TCACGGTCAGAAGTCCATTAAATT 58.443 37.500 0.00 0.00 0.00 1.82
2607 2608 6.001460 TCACGGTCAGAAGTCCATTAAATTT 58.999 36.000 0.00 0.00 0.00 1.82
2608 2609 6.148811 TCACGGTCAGAAGTCCATTAAATTTC 59.851 38.462 0.00 0.00 0.00 2.17
2609 2610 6.149474 CACGGTCAGAAGTCCATTAAATTTCT 59.851 38.462 0.00 0.00 0.00 2.52
2610 2611 6.371825 ACGGTCAGAAGTCCATTAAATTTCTC 59.628 38.462 0.00 0.00 0.00 2.87
2611 2612 6.371548 CGGTCAGAAGTCCATTAAATTTCTCA 59.628 38.462 0.00 0.00 0.00 3.27
2612 2613 7.094805 CGGTCAGAAGTCCATTAAATTTCTCAA 60.095 37.037 0.00 0.00 0.00 3.02
2613 2614 8.743714 GGTCAGAAGTCCATTAAATTTCTCAAT 58.256 33.333 0.00 0.00 0.00 2.57
2616 2617 8.866956 CAGAAGTCCATTAAATTTCTCAATTGC 58.133 33.333 0.00 0.00 32.57 3.56
2617 2618 8.587608 AGAAGTCCATTAAATTTCTCAATTGCA 58.412 29.630 0.00 0.00 32.57 4.08
2618 2619 9.374838 GAAGTCCATTAAATTTCTCAATTGCAT 57.625 29.630 0.00 0.00 32.57 3.96
2619 2620 8.937634 AGTCCATTAAATTTCTCAATTGCATC 57.062 30.769 0.00 0.00 32.57 3.91
2620 2621 7.983484 AGTCCATTAAATTTCTCAATTGCATCC 59.017 33.333 0.00 0.00 32.57 3.51
2621 2622 7.983484 GTCCATTAAATTTCTCAATTGCATCCT 59.017 33.333 0.00 0.00 32.57 3.24
2622 2623 8.542080 TCCATTAAATTTCTCAATTGCATCCTT 58.458 29.630 0.00 0.00 32.57 3.36
2623 2624 8.823818 CCATTAAATTTCTCAATTGCATCCTTC 58.176 33.333 0.00 0.00 32.57 3.46
2624 2625 8.537223 CATTAAATTTCTCAATTGCATCCTTCG 58.463 33.333 0.00 0.00 32.57 3.79
2625 2626 3.492421 TTTCTCAATTGCATCCTTCGC 57.508 42.857 0.00 0.00 0.00 4.70
2626 2627 1.382522 TCTCAATTGCATCCTTCGCC 58.617 50.000 0.00 0.00 0.00 5.54
2627 2628 1.065199 TCTCAATTGCATCCTTCGCCT 60.065 47.619 0.00 0.00 0.00 5.52
2628 2629 1.332997 CTCAATTGCATCCTTCGCCTC 59.667 52.381 0.00 0.00 0.00 4.70
2629 2630 1.097232 CAATTGCATCCTTCGCCTCA 58.903 50.000 0.00 0.00 0.00 3.86
2630 2631 1.098050 AATTGCATCCTTCGCCTCAC 58.902 50.000 0.00 0.00 0.00 3.51
2631 2632 0.035152 ATTGCATCCTTCGCCTCACA 60.035 50.000 0.00 0.00 0.00 3.58
2632 2633 0.250684 TTGCATCCTTCGCCTCACAA 60.251 50.000 0.00 0.00 0.00 3.33
2633 2634 0.250684 TGCATCCTTCGCCTCACAAA 60.251 50.000 0.00 0.00 0.00 2.83
2634 2635 0.881118 GCATCCTTCGCCTCACAAAA 59.119 50.000 0.00 0.00 0.00 2.44
2635 2636 1.135575 GCATCCTTCGCCTCACAAAAG 60.136 52.381 0.00 0.00 0.00 2.27
2636 2637 2.154462 CATCCTTCGCCTCACAAAAGT 58.846 47.619 0.00 0.00 0.00 2.66
2637 2638 3.334691 CATCCTTCGCCTCACAAAAGTA 58.665 45.455 0.00 0.00 0.00 2.24
2638 2639 3.040147 TCCTTCGCCTCACAAAAGTAG 57.960 47.619 0.00 0.00 0.00 2.57
2639 2640 2.631062 TCCTTCGCCTCACAAAAGTAGA 59.369 45.455 0.00 0.00 0.00 2.59
2640 2641 3.070446 TCCTTCGCCTCACAAAAGTAGAA 59.930 43.478 0.00 0.00 0.00 2.10
2641 2642 3.433615 CCTTCGCCTCACAAAAGTAGAAG 59.566 47.826 0.00 0.00 35.11 2.85
2642 2643 3.040147 TCGCCTCACAAAAGTAGAAGG 57.960 47.619 0.00 0.00 0.00 3.46
2643 2644 2.076863 CGCCTCACAAAAGTAGAAGGG 58.923 52.381 0.00 0.00 0.00 3.95
2644 2645 2.550208 CGCCTCACAAAAGTAGAAGGGT 60.550 50.000 0.00 0.00 0.00 4.34
2645 2646 3.487372 GCCTCACAAAAGTAGAAGGGTT 58.513 45.455 0.00 0.00 0.00 4.11
2646 2647 3.253432 GCCTCACAAAAGTAGAAGGGTTG 59.747 47.826 0.00 0.00 0.00 3.77
2647 2648 3.821033 CCTCACAAAAGTAGAAGGGTTGG 59.179 47.826 0.00 0.00 0.00 3.77
2648 2649 3.219281 TCACAAAAGTAGAAGGGTTGGC 58.781 45.455 0.00 0.00 0.00 4.52
2649 2650 2.296190 CACAAAAGTAGAAGGGTTGGCC 59.704 50.000 0.00 0.00 0.00 5.36
2650 2651 1.539827 CAAAAGTAGAAGGGTTGGCCG 59.460 52.381 0.00 0.00 34.97 6.13
2651 2652 0.037734 AAAGTAGAAGGGTTGGCCGG 59.962 55.000 0.00 0.00 34.97 6.13
2652 2653 1.131928 AAGTAGAAGGGTTGGCCGGT 61.132 55.000 1.90 0.00 34.97 5.28
2653 2654 1.131928 AGTAGAAGGGTTGGCCGGTT 61.132 55.000 1.90 0.00 34.97 4.44
2654 2655 0.958876 GTAGAAGGGTTGGCCGGTTG 60.959 60.000 1.90 0.00 34.97 3.77
2655 2656 2.132089 TAGAAGGGTTGGCCGGTTGG 62.132 60.000 1.90 0.00 38.77 3.77
2656 2657 4.614036 AAGGGTTGGCCGGTTGGG 62.614 66.667 1.90 0.00 39.58 4.12
2664 2665 3.625745 GGCCGGTTGGGTCATATAG 57.374 57.895 1.90 0.00 41.38 1.31
2665 2666 1.053424 GGCCGGTTGGGTCATATAGA 58.947 55.000 1.90 0.00 41.38 1.98
2666 2667 1.418637 GGCCGGTTGGGTCATATAGAA 59.581 52.381 1.90 0.00 41.38 2.10
2667 2668 2.158726 GGCCGGTTGGGTCATATAGAAA 60.159 50.000 1.90 0.00 41.38 2.52
2668 2669 3.497942 GGCCGGTTGGGTCATATAGAAAT 60.498 47.826 1.90 0.00 41.38 2.17
2669 2670 4.142038 GCCGGTTGGGTCATATAGAAATT 58.858 43.478 1.90 0.00 38.44 1.82
2670 2671 5.310451 GCCGGTTGGGTCATATAGAAATTA 58.690 41.667 1.90 0.00 38.44 1.40
2671 2672 5.411669 GCCGGTTGGGTCATATAGAAATTAG 59.588 44.000 1.90 0.00 38.44 1.73
2672 2673 5.938125 CCGGTTGGGTCATATAGAAATTAGG 59.062 44.000 0.00 0.00 0.00 2.69
2673 2674 5.411669 CGGTTGGGTCATATAGAAATTAGGC 59.588 44.000 0.00 0.00 0.00 3.93
2674 2675 6.303839 GGTTGGGTCATATAGAAATTAGGCA 58.696 40.000 0.00 0.00 0.00 4.75
2675 2676 6.206829 GGTTGGGTCATATAGAAATTAGGCAC 59.793 42.308 0.00 0.00 0.00 5.01
2676 2677 6.763715 TGGGTCATATAGAAATTAGGCACT 57.236 37.500 0.00 0.00 46.37 4.40
2677 2678 6.769512 TGGGTCATATAGAAATTAGGCACTC 58.230 40.000 0.00 0.00 41.75 3.51
2678 2679 6.558775 TGGGTCATATAGAAATTAGGCACTCT 59.441 38.462 0.00 0.00 41.75 3.24
2679 2680 7.100409 GGGTCATATAGAAATTAGGCACTCTC 58.900 42.308 0.00 0.00 41.75 3.20
2680 2681 6.809196 GGTCATATAGAAATTAGGCACTCTCG 59.191 42.308 0.00 0.00 41.75 4.04
2681 2682 6.809196 GTCATATAGAAATTAGGCACTCTCGG 59.191 42.308 0.00 0.00 41.75 4.63
2682 2683 6.493802 TCATATAGAAATTAGGCACTCTCGGT 59.506 38.462 0.00 0.00 41.75 4.69
2690 2691 2.031012 CACTCTCGGTGCTTGCCA 59.969 61.111 0.00 0.00 39.22 4.92
2691 2692 2.031163 ACTCTCGGTGCTTGCCAC 59.969 61.111 0.00 0.00 43.90 5.01
2692 2693 2.345244 CTCTCGGTGCTTGCCACT 59.655 61.111 0.00 0.00 44.08 4.00
2693 2694 1.302033 CTCTCGGTGCTTGCCACTT 60.302 57.895 0.00 0.00 44.08 3.16
2694 2695 0.037326 CTCTCGGTGCTTGCCACTTA 60.037 55.000 0.00 0.00 44.08 2.24
2695 2696 0.037326 TCTCGGTGCTTGCCACTTAG 60.037 55.000 0.00 0.00 44.08 2.18
2696 2697 0.320771 CTCGGTGCTTGCCACTTAGT 60.321 55.000 0.00 0.00 44.08 2.24
2697 2698 0.602638 TCGGTGCTTGCCACTTAGTG 60.603 55.000 5.22 5.22 44.08 2.74
2698 2699 0.884704 CGGTGCTTGCCACTTAGTGT 60.885 55.000 11.68 0.00 44.08 3.55
2699 2700 0.593128 GGTGCTTGCCACTTAGTGTG 59.407 55.000 11.68 4.24 44.08 3.82
2710 2711 4.946784 CACTTAGTGTGGTTTCATAGGC 57.053 45.455 3.88 0.00 42.68 3.93
2711 2712 4.323417 CACTTAGTGTGGTTTCATAGGCA 58.677 43.478 3.88 0.00 42.68 4.75
2712 2713 4.759693 CACTTAGTGTGGTTTCATAGGCAA 59.240 41.667 3.88 0.00 42.68 4.52
2713 2714 5.240623 CACTTAGTGTGGTTTCATAGGCAAA 59.759 40.000 3.88 0.00 42.68 3.68
2714 2715 5.830991 ACTTAGTGTGGTTTCATAGGCAAAA 59.169 36.000 0.00 0.00 0.00 2.44
2715 2716 6.493458 ACTTAGTGTGGTTTCATAGGCAAAAT 59.507 34.615 0.00 0.00 0.00 1.82
2716 2717 5.138125 AGTGTGGTTTCATAGGCAAAATG 57.862 39.130 0.00 0.00 0.00 2.32
2717 2718 4.588528 AGTGTGGTTTCATAGGCAAAATGT 59.411 37.500 0.00 0.00 0.00 2.71
2718 2719 5.070313 AGTGTGGTTTCATAGGCAAAATGTT 59.930 36.000 0.00 0.00 0.00 2.71
2719 2720 5.757808 GTGTGGTTTCATAGGCAAAATGTTT 59.242 36.000 0.00 0.00 0.00 2.83
2720 2721 6.926272 GTGTGGTTTCATAGGCAAAATGTTTA 59.074 34.615 0.00 0.00 0.00 2.01
2721 2722 7.439655 GTGTGGTTTCATAGGCAAAATGTTTAA 59.560 33.333 0.00 0.00 0.00 1.52
2722 2723 7.439655 TGTGGTTTCATAGGCAAAATGTTTAAC 59.560 33.333 0.00 0.00 0.00 2.01
2723 2724 7.439655 GTGGTTTCATAGGCAAAATGTTTAACA 59.560 33.333 0.00 0.00 0.00 2.41
2724 2725 7.655328 TGGTTTCATAGGCAAAATGTTTAACAG 59.345 33.333 3.63 0.00 0.00 3.16
2725 2726 7.117667 GGTTTCATAGGCAAAATGTTTAACAGG 59.882 37.037 3.63 0.00 0.00 4.00
2726 2727 6.279513 TCATAGGCAAAATGTTTAACAGGG 57.720 37.500 3.63 0.00 0.00 4.45
2727 2728 5.777732 TCATAGGCAAAATGTTTAACAGGGT 59.222 36.000 3.63 0.00 0.00 4.34
2728 2729 6.268847 TCATAGGCAAAATGTTTAACAGGGTT 59.731 34.615 3.63 0.00 0.00 4.11
2729 2730 5.366482 AGGCAAAATGTTTAACAGGGTTT 57.634 34.783 3.63 1.68 0.00 3.27
2730 2731 5.364778 AGGCAAAATGTTTAACAGGGTTTC 58.635 37.500 3.63 0.00 0.00 2.78
2731 2732 5.130311 AGGCAAAATGTTTAACAGGGTTTCT 59.870 36.000 3.63 0.00 0.00 2.52
2732 2733 5.465390 GGCAAAATGTTTAACAGGGTTTCTC 59.535 40.000 3.63 0.00 0.00 2.87
2733 2734 6.045955 GCAAAATGTTTAACAGGGTTTCTCA 58.954 36.000 3.63 0.00 0.00 3.27
2734 2735 6.019075 GCAAAATGTTTAACAGGGTTTCTCAC 60.019 38.462 3.63 0.00 0.00 3.51
2735 2736 6.783708 AAATGTTTAACAGGGTTTCTCACA 57.216 33.333 3.63 0.00 0.00 3.58
2736 2737 6.976934 AATGTTTAACAGGGTTTCTCACAT 57.023 33.333 3.63 0.00 0.00 3.21
2737 2738 6.976934 ATGTTTAACAGGGTTTCTCACATT 57.023 33.333 3.63 0.00 0.00 2.71
2738 2739 6.385649 TGTTTAACAGGGTTTCTCACATTC 57.614 37.500 0.00 0.00 0.00 2.67
2739 2740 6.126409 TGTTTAACAGGGTTTCTCACATTCT 58.874 36.000 0.00 0.00 0.00 2.40
2740 2741 6.262273 TGTTTAACAGGGTTTCTCACATTCTC 59.738 38.462 0.00 0.00 0.00 2.87
2741 2742 4.713792 AACAGGGTTTCTCACATTCTCT 57.286 40.909 0.00 0.00 0.00 3.10
2742 2743 4.713792 ACAGGGTTTCTCACATTCTCTT 57.286 40.909 0.00 0.00 0.00 2.85
2743 2744 4.646572 ACAGGGTTTCTCACATTCTCTTC 58.353 43.478 0.00 0.00 0.00 2.87
2744 2745 4.349342 ACAGGGTTTCTCACATTCTCTTCT 59.651 41.667 0.00 0.00 0.00 2.85
2745 2746 4.934602 CAGGGTTTCTCACATTCTCTTCTC 59.065 45.833 0.00 0.00 0.00 2.87
2746 2747 4.843516 AGGGTTTCTCACATTCTCTTCTCT 59.156 41.667 0.00 0.00 0.00 3.10
2747 2748 5.046663 AGGGTTTCTCACATTCTCTTCTCTC 60.047 44.000 0.00 0.00 0.00 3.20
2748 2749 5.046663 GGGTTTCTCACATTCTCTTCTCTCT 60.047 44.000 0.00 0.00 0.00 3.10
2749 2750 6.099341 GGTTTCTCACATTCTCTTCTCTCTC 58.901 44.000 0.00 0.00 0.00 3.20
2750 2751 6.295011 GGTTTCTCACATTCTCTTCTCTCTCA 60.295 42.308 0.00 0.00 0.00 3.27
2751 2752 6.907853 TTCTCACATTCTCTTCTCTCTCAA 57.092 37.500 0.00 0.00 0.00 3.02
2752 2753 6.266168 TCTCACATTCTCTTCTCTCTCAAC 57.734 41.667 0.00 0.00 0.00 3.18
2753 2754 5.772169 TCTCACATTCTCTTCTCTCTCAACA 59.228 40.000 0.00 0.00 0.00 3.33
2754 2755 6.266330 TCTCACATTCTCTTCTCTCTCAACAA 59.734 38.462 0.00 0.00 0.00 2.83
2755 2756 6.219473 TCACATTCTCTTCTCTCTCAACAAC 58.781 40.000 0.00 0.00 0.00 3.32
2756 2757 5.987953 CACATTCTCTTCTCTCTCAACAACA 59.012 40.000 0.00 0.00 0.00 3.33
2757 2758 6.481313 CACATTCTCTTCTCTCTCAACAACAA 59.519 38.462 0.00 0.00 0.00 2.83
2758 2759 6.705381 ACATTCTCTTCTCTCTCAACAACAAG 59.295 38.462 0.00 0.00 0.00 3.16
2759 2760 6.471233 TTCTCTTCTCTCTCAACAACAAGA 57.529 37.500 0.00 0.00 0.00 3.02
2760 2761 5.837437 TCTCTTCTCTCTCAACAACAAGAC 58.163 41.667 0.00 0.00 0.00 3.01
2761 2762 4.950050 TCTTCTCTCTCAACAACAAGACC 58.050 43.478 0.00 0.00 0.00 3.85
2762 2763 4.651503 TCTTCTCTCTCAACAACAAGACCT 59.348 41.667 0.00 0.00 0.00 3.85
2763 2764 5.129485 TCTTCTCTCTCAACAACAAGACCTT 59.871 40.000 0.00 0.00 0.00 3.50
2764 2765 6.323996 TCTTCTCTCTCAACAACAAGACCTTA 59.676 38.462 0.00 0.00 0.00 2.69
2765 2766 6.090483 TCTCTCTCAACAACAAGACCTTAG 57.910 41.667 0.00 0.00 0.00 2.18
2766 2767 5.598830 TCTCTCTCAACAACAAGACCTTAGT 59.401 40.000 0.00 0.00 0.00 2.24
2767 2768 5.601662 TCTCTCAACAACAAGACCTTAGTG 58.398 41.667 0.00 0.00 0.00 2.74
2768 2769 5.128827 TCTCTCAACAACAAGACCTTAGTGT 59.871 40.000 0.00 0.00 0.00 3.55
2769 2770 5.741011 TCTCAACAACAAGACCTTAGTGTT 58.259 37.500 5.09 5.09 35.91 3.32
2777 2778 4.623932 AAGACCTTAGTGTTGAGATGCA 57.376 40.909 0.00 0.00 0.00 3.96
2778 2779 4.623932 AGACCTTAGTGTTGAGATGCAA 57.376 40.909 0.00 0.00 0.00 4.08
2779 2780 4.573900 AGACCTTAGTGTTGAGATGCAAG 58.426 43.478 0.00 0.00 37.12 4.01
2780 2781 3.077359 ACCTTAGTGTTGAGATGCAAGC 58.923 45.455 0.00 0.00 37.12 4.01
2781 2782 3.076621 CCTTAGTGTTGAGATGCAAGCA 58.923 45.455 0.00 0.00 37.12 3.91
2782 2783 3.693085 CCTTAGTGTTGAGATGCAAGCAT 59.307 43.478 7.35 7.35 37.12 3.79
2783 2784 4.438336 CCTTAGTGTTGAGATGCAAGCATG 60.438 45.833 12.94 0.00 37.12 4.06
2784 2785 2.786777 AGTGTTGAGATGCAAGCATGA 58.213 42.857 12.94 0.00 37.12 3.07
2785 2786 3.353557 AGTGTTGAGATGCAAGCATGAT 58.646 40.909 12.94 0.46 37.12 2.45
2786 2787 3.377485 AGTGTTGAGATGCAAGCATGATC 59.623 43.478 12.94 10.52 37.12 2.92
2787 2788 2.686405 TGTTGAGATGCAAGCATGATCC 59.314 45.455 12.94 0.00 37.12 3.36
2788 2789 1.589803 TGAGATGCAAGCATGATCCG 58.410 50.000 12.94 0.00 36.70 4.18
2789 2790 0.237761 GAGATGCAAGCATGATCCGC 59.762 55.000 12.94 0.00 36.70 5.54
2790 2791 0.464916 AGATGCAAGCATGATCCGCA 60.465 50.000 12.94 10.05 36.70 5.69
2791 2792 0.040336 GATGCAAGCATGATCCGCAG 60.040 55.000 12.94 0.84 36.70 5.18
2792 2793 0.464916 ATGCAAGCATGATCCGCAGA 60.465 50.000 12.72 0.00 35.79 4.26
2793 2794 1.354506 GCAAGCATGATCCGCAGAC 59.645 57.895 0.00 0.00 0.00 3.51
2794 2795 2.020131 CAAGCATGATCCGCAGACC 58.980 57.895 0.00 0.00 0.00 3.85
2795 2796 0.745486 CAAGCATGATCCGCAGACCA 60.745 55.000 0.00 0.00 0.00 4.02
2796 2797 0.035152 AAGCATGATCCGCAGACCAA 60.035 50.000 0.00 0.00 0.00 3.67
2797 2798 0.182061 AGCATGATCCGCAGACCAAT 59.818 50.000 0.00 0.00 0.00 3.16
2798 2799 0.590195 GCATGATCCGCAGACCAATC 59.410 55.000 0.00 0.00 0.00 2.67
2799 2800 1.957668 CATGATCCGCAGACCAATCA 58.042 50.000 0.00 0.00 33.04 2.57
2800 2801 1.600957 CATGATCCGCAGACCAATCAC 59.399 52.381 0.00 0.00 31.41 3.06
2801 2802 0.612744 TGATCCGCAGACCAATCACA 59.387 50.000 0.00 0.00 0.00 3.58
2802 2803 1.210234 TGATCCGCAGACCAATCACAT 59.790 47.619 0.00 0.00 0.00 3.21
2803 2804 1.600957 GATCCGCAGACCAATCACATG 59.399 52.381 0.00 0.00 0.00 3.21
2804 2805 1.026182 TCCGCAGACCAATCACATGC 61.026 55.000 0.00 0.00 0.00 4.06
2805 2806 1.307355 CCGCAGACCAATCACATGCA 61.307 55.000 0.00 0.00 36.70 3.96
2806 2807 0.522626 CGCAGACCAATCACATGCAA 59.477 50.000 0.00 0.00 36.70 4.08
2807 2808 1.730121 CGCAGACCAATCACATGCAAC 60.730 52.381 0.00 0.00 36.70 4.17
2808 2809 1.270274 GCAGACCAATCACATGCAACA 59.730 47.619 0.00 0.00 36.88 3.33
2809 2810 2.094390 GCAGACCAATCACATGCAACAT 60.094 45.455 0.00 0.00 36.88 2.71
2810 2811 3.129113 GCAGACCAATCACATGCAACATA 59.871 43.478 0.00 0.00 36.88 2.29
2811 2812 4.732647 GCAGACCAATCACATGCAACATAG 60.733 45.833 0.00 0.00 36.88 2.23
2812 2813 3.949754 AGACCAATCACATGCAACATAGG 59.050 43.478 0.00 0.00 0.00 2.57
2813 2814 3.696051 GACCAATCACATGCAACATAGGT 59.304 43.478 0.00 0.00 0.00 3.08
2814 2815 4.088634 ACCAATCACATGCAACATAGGTT 58.911 39.130 0.00 0.00 37.87 3.50
2815 2816 5.260424 ACCAATCACATGCAACATAGGTTA 58.740 37.500 0.00 0.00 34.87 2.85
2816 2817 5.125417 ACCAATCACATGCAACATAGGTTAC 59.875 40.000 0.00 0.00 34.87 2.50
2817 2818 5.125257 CCAATCACATGCAACATAGGTTACA 59.875 40.000 0.00 0.00 34.89 2.41
2818 2819 5.818136 ATCACATGCAACATAGGTTACAC 57.182 39.130 0.00 0.00 33.28 2.90
2819 2820 4.646572 TCACATGCAACATAGGTTACACA 58.353 39.130 0.00 0.00 33.28 3.72
2820 2821 4.454161 TCACATGCAACATAGGTTACACAC 59.546 41.667 0.00 0.00 33.28 3.82
2821 2822 4.215185 CACATGCAACATAGGTTACACACA 59.785 41.667 0.00 0.00 33.28 3.72
2822 2823 4.824537 ACATGCAACATAGGTTACACACAA 59.175 37.500 0.00 0.00 33.28 3.33
2823 2824 4.822036 TGCAACATAGGTTACACACAAC 57.178 40.909 0.00 0.00 34.87 3.32
2824 2825 4.200092 TGCAACATAGGTTACACACAACA 58.800 39.130 0.00 0.00 34.87 3.33
2825 2826 4.824537 TGCAACATAGGTTACACACAACAT 59.175 37.500 0.00 0.00 34.87 2.71
2826 2827 5.300539 TGCAACATAGGTTACACACAACATT 59.699 36.000 0.00 0.00 34.87 2.71
2827 2828 6.486993 TGCAACATAGGTTACACACAACATTA 59.513 34.615 0.00 0.00 34.87 1.90
2828 2829 7.175816 TGCAACATAGGTTACACACAACATTAT 59.824 33.333 0.00 0.00 34.87 1.28
2829 2830 8.026607 GCAACATAGGTTACACACAACATTATT 58.973 33.333 0.00 0.00 34.87 1.40
2830 2831 9.906660 CAACATAGGTTACACACAACATTATTT 57.093 29.630 0.00 0.00 34.87 1.40
2839 2840 9.712305 TTACACACAACATTATTTTTATTGGGG 57.288 29.630 0.00 0.00 0.00 4.96
2840 2841 7.740805 ACACACAACATTATTTTTATTGGGGT 58.259 30.769 0.00 0.00 0.00 4.95
2841 2842 7.659390 ACACACAACATTATTTTTATTGGGGTG 59.341 33.333 0.00 0.00 36.54 4.61
2842 2843 7.118971 CACACAACATTATTTTTATTGGGGTGG 59.881 37.037 0.00 0.00 31.54 4.61
2843 2844 7.164803 CACAACATTATTTTTATTGGGGTGGT 58.835 34.615 0.00 0.00 0.00 4.16
2844 2845 7.333174 CACAACATTATTTTTATTGGGGTGGTC 59.667 37.037 0.00 0.00 0.00 4.02
2845 2846 6.215495 ACATTATTTTTATTGGGGTGGTCG 57.785 37.500 0.00 0.00 0.00 4.79
2846 2847 5.128008 ACATTATTTTTATTGGGGTGGTCGG 59.872 40.000 0.00 0.00 0.00 4.79
2847 2848 2.973983 TTTTTATTGGGGTGGTCGGA 57.026 45.000 0.00 0.00 0.00 4.55
2848 2849 2.973983 TTTTATTGGGGTGGTCGGAA 57.026 45.000 0.00 0.00 0.00 4.30
2849 2850 2.973983 TTTATTGGGGTGGTCGGAAA 57.026 45.000 0.00 0.00 0.00 3.13
2850 2851 2.973983 TTATTGGGGTGGTCGGAAAA 57.026 45.000 0.00 0.00 0.00 2.29
2851 2852 2.203470 TATTGGGGTGGTCGGAAAAC 57.797 50.000 0.00 0.00 0.00 2.43
2852 2853 0.481128 ATTGGGGTGGTCGGAAAACT 59.519 50.000 0.00 0.00 0.00 2.66
2853 2854 0.259356 TTGGGGTGGTCGGAAAACTT 59.741 50.000 0.00 0.00 0.00 2.66
2854 2855 0.179012 TGGGGTGGTCGGAAAACTTC 60.179 55.000 0.00 0.00 0.00 3.01
2855 2856 0.892358 GGGGTGGTCGGAAAACTTCC 60.892 60.000 0.00 0.00 46.62 3.46
2863 2864 3.842069 GGAAAACTTCCCACCACCT 57.158 52.632 0.00 0.00 44.30 4.00
2864 2865 2.963599 GGAAAACTTCCCACCACCTA 57.036 50.000 0.00 0.00 44.30 3.08
2865 2866 2.791655 GGAAAACTTCCCACCACCTAG 58.208 52.381 0.00 0.00 44.30 3.02
2866 2867 2.554564 GGAAAACTTCCCACCACCTAGG 60.555 54.545 7.41 7.41 44.30 3.02
2867 2868 2.127651 AAACTTCCCACCACCTAGGA 57.872 50.000 17.98 0.00 41.22 2.94
2868 2869 2.361085 AACTTCCCACCACCTAGGAT 57.639 50.000 17.98 0.00 41.22 3.24
2869 2870 3.502051 AACTTCCCACCACCTAGGATA 57.498 47.619 17.98 0.00 41.22 2.59
2870 2871 3.047695 ACTTCCCACCACCTAGGATAG 57.952 52.381 17.98 5.82 41.22 2.08
2871 2872 2.318207 ACTTCCCACCACCTAGGATAGT 59.682 50.000 17.98 6.53 41.22 2.12
2872 2873 3.534747 ACTTCCCACCACCTAGGATAGTA 59.465 47.826 17.98 0.00 41.22 1.82
2873 2874 4.172241 ACTTCCCACCACCTAGGATAGTAT 59.828 45.833 17.98 0.00 41.22 2.12
2874 2875 5.377769 ACTTCCCACCACCTAGGATAGTATA 59.622 44.000 17.98 0.00 41.22 1.47
2875 2876 5.266709 TCCCACCACCTAGGATAGTATAC 57.733 47.826 17.98 0.00 41.22 1.47
2876 2877 4.924484 TCCCACCACCTAGGATAGTATACT 59.076 45.833 17.98 10.87 41.22 2.12
2877 2878 6.100527 TCCCACCACCTAGGATAGTATACTA 58.899 44.000 17.98 14.87 41.22 1.82
2878 2879 6.567650 TCCCACCACCTAGGATAGTATACTAA 59.432 42.308 17.98 0.00 41.22 2.24
2879 2880 7.243381 TCCCACCACCTAGGATAGTATACTAAT 59.757 40.741 17.98 8.42 41.22 1.73
2880 2881 8.563502 CCCACCACCTAGGATAGTATACTAATA 58.436 40.741 17.98 9.05 41.22 0.98
2907 2908 9.638239 TTCAATAAATTGCAAGTGACCTTAATC 57.362 29.630 4.94 0.00 37.68 1.75
2908 2909 9.023962 TCAATAAATTGCAAGTGACCTTAATCT 57.976 29.630 4.94 0.00 37.68 2.40
2909 2910 9.294030 CAATAAATTGCAAGTGACCTTAATCTC 57.706 33.333 4.94 0.00 0.00 2.75
2910 2911 5.904362 AATTGCAAGTGACCTTAATCTCC 57.096 39.130 4.94 0.00 0.00 3.71
2911 2912 2.972625 TGCAAGTGACCTTAATCTCCG 58.027 47.619 0.00 0.00 0.00 4.63
2912 2913 2.280628 GCAAGTGACCTTAATCTCCGG 58.719 52.381 0.00 0.00 0.00 5.14
2913 2914 2.093658 GCAAGTGACCTTAATCTCCGGA 60.094 50.000 2.93 2.93 0.00 5.14
2914 2915 3.522553 CAAGTGACCTTAATCTCCGGAC 58.477 50.000 0.00 0.00 0.00 4.79
2915 2916 2.816411 AGTGACCTTAATCTCCGGACA 58.184 47.619 0.00 0.00 0.00 4.02
2916 2917 3.170717 AGTGACCTTAATCTCCGGACAA 58.829 45.455 0.00 0.00 0.00 3.18
2917 2918 3.195825 AGTGACCTTAATCTCCGGACAAG 59.804 47.826 0.00 1.58 0.00 3.16
2918 2919 2.093658 TGACCTTAATCTCCGGACAAGC 60.094 50.000 0.00 0.00 0.00 4.01
2919 2920 1.906574 ACCTTAATCTCCGGACAAGCA 59.093 47.619 0.00 0.00 0.00 3.91
2920 2921 2.093447 ACCTTAATCTCCGGACAAGCAG 60.093 50.000 0.00 0.00 0.00 4.24
2921 2922 2.093447 CCTTAATCTCCGGACAAGCAGT 60.093 50.000 0.00 0.00 0.00 4.40
2922 2923 2.961526 TAATCTCCGGACAAGCAGTC 57.038 50.000 0.00 1.04 46.83 3.51
2929 2930 4.703703 GACAAGCAGTCCCTCCAC 57.296 61.111 0.00 0.00 41.56 4.02
2930 2931 1.754745 GACAAGCAGTCCCTCCACA 59.245 57.895 0.00 0.00 41.56 4.17
2931 2932 0.321122 GACAAGCAGTCCCTCCACAG 60.321 60.000 0.00 0.00 41.56 3.66
2932 2933 1.673665 CAAGCAGTCCCTCCACAGC 60.674 63.158 0.00 0.00 0.00 4.40
2933 2934 2.149383 AAGCAGTCCCTCCACAGCA 61.149 57.895 0.00 0.00 31.41 4.41
2934 2935 2.359230 GCAGTCCCTCCACAGCAC 60.359 66.667 0.00 0.00 0.00 4.40
2935 2936 3.150949 CAGTCCCTCCACAGCACA 58.849 61.111 0.00 0.00 0.00 4.57
2936 2937 1.451504 CAGTCCCTCCACAGCACAA 59.548 57.895 0.00 0.00 0.00 3.33
2937 2938 0.179020 CAGTCCCTCCACAGCACAAA 60.179 55.000 0.00 0.00 0.00 2.83
2938 2939 0.109342 AGTCCCTCCACAGCACAAAG 59.891 55.000 0.00 0.00 0.00 2.77
2939 2940 0.179018 GTCCCTCCACAGCACAAAGT 60.179 55.000 0.00 0.00 0.00 2.66
2940 2941 0.179020 TCCCTCCACAGCACAAAGTG 60.179 55.000 0.00 0.00 36.51 3.16
2946 2947 2.480224 CACAGCACAAAGTGGTTCTG 57.520 50.000 0.00 1.07 41.72 3.02
2947 2948 2.016318 CACAGCACAAAGTGGTTCTGA 58.984 47.619 9.27 0.00 41.72 3.27
2948 2949 2.620115 CACAGCACAAAGTGGTTCTGAT 59.380 45.455 9.27 0.00 41.72 2.90
2949 2950 3.814842 CACAGCACAAAGTGGTTCTGATA 59.185 43.478 9.27 0.00 41.72 2.15
2950 2951 4.456911 CACAGCACAAAGTGGTTCTGATAT 59.543 41.667 9.27 0.00 41.72 1.63
2951 2952 5.643348 CACAGCACAAAGTGGTTCTGATATA 59.357 40.000 9.27 0.00 41.72 0.86
2952 2953 6.317140 CACAGCACAAAGTGGTTCTGATATAT 59.683 38.462 9.27 0.00 41.72 0.86
2953 2954 6.886459 ACAGCACAAAGTGGTTCTGATATATT 59.114 34.615 9.27 0.00 41.72 1.28
2954 2955 7.394359 ACAGCACAAAGTGGTTCTGATATATTT 59.606 33.333 9.27 0.00 41.72 1.40
2955 2956 8.246180 CAGCACAAAGTGGTTCTGATATATTTT 58.754 33.333 0.00 0.00 41.72 1.82
2956 2957 9.461312 AGCACAAAGTGGTTCTGATATATTTTA 57.539 29.630 0.00 0.00 41.72 1.52
2982 2983 9.920946 ATCTGTTTTCCTAATTGGTATACACAT 57.079 29.630 5.01 0.00 37.07 3.21
2983 2984 9.173021 TCTGTTTTCCTAATTGGTATACACATG 57.827 33.333 5.01 0.00 37.07 3.21
2984 2985 8.871629 TGTTTTCCTAATTGGTATACACATGT 57.128 30.769 5.01 0.00 37.07 3.21
2985 2986 9.961264 TGTTTTCCTAATTGGTATACACATGTA 57.039 29.630 5.01 0.00 37.07 2.29
2995 2996 9.905713 ATTGGTATACACATGTAAGATTTGAGT 57.094 29.630 5.01 0.00 33.76 3.41
2996 2997 8.716646 TGGTATACACATGTAAGATTTGAGTG 57.283 34.615 5.01 0.00 33.76 3.51
2997 2998 8.318412 TGGTATACACATGTAAGATTTGAGTGT 58.682 33.333 5.01 0.00 41.15 3.55
2998 2999 9.811995 GGTATACACATGTAAGATTTGAGTGTA 57.188 33.333 5.01 0.00 42.78 2.90
3001 3002 7.672983 ACACATGTAAGATTTGAGTGTAAGG 57.327 36.000 0.00 0.00 37.01 2.69
3002 3003 7.224297 ACACATGTAAGATTTGAGTGTAAGGT 58.776 34.615 0.00 0.00 37.01 3.50
3003 3004 7.719633 ACACATGTAAGATTTGAGTGTAAGGTT 59.280 33.333 0.00 0.00 37.01 3.50
3004 3005 8.567948 CACATGTAAGATTTGAGTGTAAGGTTT 58.432 33.333 0.00 0.00 0.00 3.27
3005 3006 8.567948 ACATGTAAGATTTGAGTGTAAGGTTTG 58.432 33.333 0.00 0.00 0.00 2.93
3006 3007 6.966021 TGTAAGATTTGAGTGTAAGGTTTGC 58.034 36.000 0.00 0.00 0.00 3.68
3007 3008 6.770785 TGTAAGATTTGAGTGTAAGGTTTGCT 59.229 34.615 0.00 0.00 0.00 3.91
3008 3009 6.715347 AAGATTTGAGTGTAAGGTTTGCTT 57.285 33.333 0.00 0.00 0.00 3.91
3009 3010 6.715347 AGATTTGAGTGTAAGGTTTGCTTT 57.285 33.333 0.00 0.00 0.00 3.51
3010 3011 7.112452 AGATTTGAGTGTAAGGTTTGCTTTT 57.888 32.000 0.00 0.00 0.00 2.27
3011 3012 8.232913 AGATTTGAGTGTAAGGTTTGCTTTTA 57.767 30.769 0.00 0.00 0.00 1.52
3012 3013 8.135529 AGATTTGAGTGTAAGGTTTGCTTTTAC 58.864 33.333 0.00 0.00 0.00 2.01
3013 3014 6.761099 TTGAGTGTAAGGTTTGCTTTTACA 57.239 33.333 0.00 0.00 35.56 2.41
3014 3015 6.371809 TGAGTGTAAGGTTTGCTTTTACAG 57.628 37.500 0.00 0.00 37.80 2.74
3015 3016 5.298276 TGAGTGTAAGGTTTGCTTTTACAGG 59.702 40.000 0.00 0.00 37.80 4.00
3016 3017 5.442391 AGTGTAAGGTTTGCTTTTACAGGA 58.558 37.500 0.00 0.00 37.80 3.86
3017 3018 6.068670 AGTGTAAGGTTTGCTTTTACAGGAT 58.931 36.000 0.00 0.00 37.80 3.24
3018 3019 6.016276 AGTGTAAGGTTTGCTTTTACAGGATG 60.016 38.462 0.00 0.00 46.00 3.51
3053 3054 9.627123 TTTTTCCCTCCAGACATACTATATTTG 57.373 33.333 0.00 0.00 0.00 2.32
3054 3055 6.360370 TCCCTCCAGACATACTATATTTGC 57.640 41.667 0.00 0.00 0.00 3.68
3055 3056 5.047306 TCCCTCCAGACATACTATATTTGCG 60.047 44.000 0.00 0.00 0.00 4.85
3056 3057 4.627467 CCTCCAGACATACTATATTTGCGC 59.373 45.833 0.00 0.00 0.00 6.09
3057 3058 5.468540 TCCAGACATACTATATTTGCGCT 57.531 39.130 9.73 0.00 0.00 5.92
3058 3059 5.853936 TCCAGACATACTATATTTGCGCTT 58.146 37.500 9.73 0.00 0.00 4.68
3059 3060 6.288294 TCCAGACATACTATATTTGCGCTTT 58.712 36.000 9.73 0.00 0.00 3.51
3060 3061 6.765989 TCCAGACATACTATATTTGCGCTTTT 59.234 34.615 9.73 0.00 0.00 2.27
3061 3062 6.852853 CCAGACATACTATATTTGCGCTTTTG 59.147 38.462 9.73 0.00 0.00 2.44
3062 3063 6.358030 CAGACATACTATATTTGCGCTTTTGC 59.642 38.462 9.73 0.00 43.23 3.68
3063 3064 5.519722 ACATACTATATTTGCGCTTTTGCC 58.480 37.500 9.73 0.00 43.93 4.52
3064 3065 5.067153 ACATACTATATTTGCGCTTTTGCCA 59.933 36.000 9.73 0.00 43.93 4.92
3065 3066 4.654091 ACTATATTTGCGCTTTTGCCAT 57.346 36.364 9.73 0.00 43.93 4.40
3066 3067 4.610945 ACTATATTTGCGCTTTTGCCATC 58.389 39.130 9.73 0.00 43.93 3.51
3067 3068 3.806625 ATATTTGCGCTTTTGCCATCT 57.193 38.095 9.73 0.00 43.93 2.90
3068 3069 1.717194 ATTTGCGCTTTTGCCATCTG 58.283 45.000 9.73 0.00 43.93 2.90
3069 3070 0.319727 TTTGCGCTTTTGCCATCTGG 60.320 50.000 9.73 0.00 43.93 3.86
3070 3071 1.177895 TTGCGCTTTTGCCATCTGGA 61.178 50.000 9.73 0.00 43.93 3.86
3071 3072 1.153958 GCGCTTTTGCCATCTGGAC 60.154 57.895 0.00 0.00 43.93 4.02
3072 3073 1.865788 GCGCTTTTGCCATCTGGACA 61.866 55.000 0.00 0.00 43.93 4.02
3073 3074 0.109597 CGCTTTTGCCATCTGGACAC 60.110 55.000 0.00 0.00 43.93 3.67
3074 3075 0.244721 GCTTTTGCCATCTGGACACC 59.755 55.000 0.00 0.00 40.15 4.16
3075 3076 1.619654 CTTTTGCCATCTGGACACCA 58.380 50.000 0.00 0.00 37.39 4.17
3076 3077 2.173519 CTTTTGCCATCTGGACACCAT 58.826 47.619 0.00 0.00 37.39 3.55
3077 3078 1.838112 TTTGCCATCTGGACACCATC 58.162 50.000 0.00 0.00 37.39 3.51
3089 3090 2.607187 GACACCATCCAACACTAGACG 58.393 52.381 0.00 0.00 0.00 4.18
3090 3091 1.968493 ACACCATCCAACACTAGACGT 59.032 47.619 0.00 0.00 0.00 4.34
3092 3093 2.029380 CACCATCCAACACTAGACGTGA 60.029 50.000 0.00 0.00 46.81 4.35
3093 3094 2.832129 ACCATCCAACACTAGACGTGAT 59.168 45.455 0.00 0.00 46.81 3.06
3094 3095 3.119101 ACCATCCAACACTAGACGTGATC 60.119 47.826 0.00 0.00 46.81 2.92
3095 3096 2.913777 TCCAACACTAGACGTGATCG 57.086 50.000 0.00 0.00 46.81 3.69
3105 3106 2.476051 CGTGATCGTTGCAGCACC 59.524 61.111 0.00 0.00 0.00 5.01
3106 3107 2.870372 GTGATCGTTGCAGCACCC 59.130 61.111 0.00 0.00 0.00 4.61
3107 3108 1.672356 GTGATCGTTGCAGCACCCT 60.672 57.895 0.00 0.00 0.00 4.34
3108 3109 1.672030 TGATCGTTGCAGCACCCTG 60.672 57.895 0.00 0.00 42.13 4.45
3109 3110 1.375908 GATCGTTGCAGCACCCTGA 60.376 57.895 0.00 0.00 41.77 3.86
3110 3111 0.955428 GATCGTTGCAGCACCCTGAA 60.955 55.000 0.00 0.00 41.77 3.02
3111 3112 0.537143 ATCGTTGCAGCACCCTGAAA 60.537 50.000 0.00 0.00 41.77 2.69
3112 3113 0.537143 TCGTTGCAGCACCCTGAAAT 60.537 50.000 0.00 0.00 38.83 2.17
3113 3114 1.164411 CGTTGCAGCACCCTGAAATA 58.836 50.000 0.00 0.00 38.83 1.40
3114 3115 1.135689 CGTTGCAGCACCCTGAAATAC 60.136 52.381 0.00 0.00 38.83 1.89
3115 3116 1.885887 GTTGCAGCACCCTGAAATACA 59.114 47.619 0.00 0.00 38.83 2.29
3116 3117 2.284754 TGCAGCACCCTGAAATACAA 57.715 45.000 0.00 0.00 41.77 2.41
3117 3118 2.591923 TGCAGCACCCTGAAATACAAA 58.408 42.857 0.00 0.00 41.77 2.83
3118 3119 2.961741 TGCAGCACCCTGAAATACAAAA 59.038 40.909 0.00 0.00 41.77 2.44
3119 3120 3.577848 TGCAGCACCCTGAAATACAAAAT 59.422 39.130 0.00 0.00 41.77 1.82
3120 3121 4.769488 TGCAGCACCCTGAAATACAAAATA 59.231 37.500 0.00 0.00 41.77 1.40
3121 3122 5.421693 TGCAGCACCCTGAAATACAAAATAT 59.578 36.000 0.00 0.00 41.77 1.28
3122 3123 6.605194 TGCAGCACCCTGAAATACAAAATATA 59.395 34.615 0.00 0.00 41.77 0.86
3123 3124 7.287466 TGCAGCACCCTGAAATACAAAATATAT 59.713 33.333 0.00 0.00 41.77 0.86
3124 3125 7.596248 GCAGCACCCTGAAATACAAAATATATG 59.404 37.037 0.00 0.00 41.77 1.78
3125 3126 8.084073 CAGCACCCTGAAATACAAAATATATGG 58.916 37.037 0.00 0.00 41.77 2.74
3126 3127 7.784550 AGCACCCTGAAATACAAAATATATGGT 59.215 33.333 0.00 0.00 0.00 3.55
3127 3128 7.867403 GCACCCTGAAATACAAAATATATGGTG 59.133 37.037 0.00 0.00 39.88 4.17
3128 3129 7.867403 CACCCTGAAATACAAAATATATGGTGC 59.133 37.037 0.00 0.00 31.72 5.01
3129 3130 7.563188 ACCCTGAAATACAAAATATATGGTGCA 59.437 33.333 0.00 0.00 0.00 4.57
3130 3131 8.420222 CCCTGAAATACAAAATATATGGTGCAA 58.580 33.333 0.00 0.00 0.00 4.08
3131 3132 9.248291 CCTGAAATACAAAATATATGGTGCAAC 57.752 33.333 0.00 0.00 0.00 4.17
3132 3133 9.800433 CTGAAATACAAAATATATGGTGCAACA 57.200 29.630 7.04 7.04 39.98 3.33
3139 3140 9.499479 ACAAAATATATGGTGCAACATTTTGAA 57.501 25.926 32.48 15.45 42.08 2.69
3148 3149 9.723601 ATGGTGCAACATTTTGAAATATTACTT 57.276 25.926 12.64 0.00 39.98 2.24
3149 3150 8.986847 TGGTGCAACATTTTGAAATATTACTTG 58.013 29.630 0.00 0.00 39.98 3.16
3150 3151 9.202273 GGTGCAACATTTTGAAATATTACTTGA 57.798 29.630 0.00 0.00 39.98 3.02
3174 3175 9.322773 TGAAAAATTGAAAATGTTCTACATGCA 57.677 25.926 0.00 0.00 37.97 3.96
3179 3180 7.655236 TTGAAAATGTTCTACATGCAAATGG 57.345 32.000 0.00 0.00 37.97 3.16
3180 3181 6.757237 TGAAAATGTTCTACATGCAAATGGT 58.243 32.000 0.00 0.00 37.97 3.55
3181 3182 6.645827 TGAAAATGTTCTACATGCAAATGGTG 59.354 34.615 0.00 0.00 37.97 4.17
3182 3183 5.726980 AATGTTCTACATGCAAATGGTGT 57.273 34.783 0.00 0.00 37.97 4.16
3183 3184 4.764679 TGTTCTACATGCAAATGGTGTC 57.235 40.909 0.00 0.00 0.00 3.67
3184 3185 3.505680 TGTTCTACATGCAAATGGTGTCC 59.494 43.478 0.00 0.00 0.00 4.02
3185 3186 3.431673 TCTACATGCAAATGGTGTCCA 57.568 42.857 0.00 0.00 38.19 4.02
3186 3187 3.760738 TCTACATGCAAATGGTGTCCAA 58.239 40.909 0.00 0.00 36.95 3.53
3187 3188 4.148079 TCTACATGCAAATGGTGTCCAAA 58.852 39.130 0.00 0.00 36.95 3.28
3188 3189 3.110447 ACATGCAAATGGTGTCCAAAC 57.890 42.857 0.00 0.00 36.95 2.93
3189 3190 2.433604 ACATGCAAATGGTGTCCAAACA 59.566 40.909 0.00 0.00 36.95 2.83
3190 3191 3.118482 ACATGCAAATGGTGTCCAAACAA 60.118 39.130 0.00 0.00 36.95 2.83
3191 3192 3.616956 TGCAAATGGTGTCCAAACAAA 57.383 38.095 0.00 0.00 36.95 2.83
3192 3193 3.942829 TGCAAATGGTGTCCAAACAAAA 58.057 36.364 0.00 0.00 36.95 2.44
3193 3194 4.326826 TGCAAATGGTGTCCAAACAAAAA 58.673 34.783 0.00 0.00 36.95 1.94
3194 3195 4.946157 TGCAAATGGTGTCCAAACAAAAAT 59.054 33.333 0.00 0.00 36.95 1.82
3195 3196 5.163683 TGCAAATGGTGTCCAAACAAAAATG 60.164 36.000 0.00 0.00 36.95 2.32
3196 3197 5.065731 GCAAATGGTGTCCAAACAAAAATGA 59.934 36.000 0.00 0.00 36.95 2.57
3197 3198 6.404074 GCAAATGGTGTCCAAACAAAAATGAA 60.404 34.615 0.00 0.00 36.95 2.57
3198 3199 7.681543 GCAAATGGTGTCCAAACAAAAATGAAT 60.682 33.333 0.00 0.00 36.95 2.57
3199 3200 7.878547 AATGGTGTCCAAACAAAAATGAATT 57.121 28.000 0.00 0.00 36.95 2.17