Multiple sequence alignment - TraesCS6B01G012400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G012400 chr6B 100.000 3999 0 0 1 3999 7556309 7552311 0.000000e+00 7385.0
1 TraesCS6B01G012400 chr5B 89.007 564 47 2 280 828 513853692 513853129 0.000000e+00 684.0
2 TraesCS6B01G012400 chr5B 90.476 168 16 0 1502 1669 262533786 262533619 5.200000e-54 222.0
3 TraesCS6B01G012400 chr5B 91.667 60 5 0 275 334 534112111 534112052 2.560000e-12 84.2
4 TraesCS6B01G012400 chr1A 89.787 470 34 2 276 731 10844409 10843940 1.240000e-164 590.0
5 TraesCS6B01G012400 chr1A 89.787 470 34 2 276 731 10899364 10898895 1.240000e-164 590.0
6 TraesCS6B01G012400 chr1A 92.276 246 18 1 1 246 72862433 72862677 8.230000e-92 348.0
7 TraesCS6B01G012400 chr4D 91.185 363 14 4 484 828 127559800 127560162 1.010000e-130 477.0
8 TraesCS6B01G012400 chr4D 90.634 363 16 4 484 828 40820311 40819949 2.180000e-127 466.0
9 TraesCS6B01G012400 chr4D 92.237 219 10 1 275 486 40820627 40820409 1.810000e-78 303.0
10 TraesCS6B01G012400 chr4D 92.202 218 9 2 276 486 127559486 127559702 6.500000e-78 302.0
11 TraesCS6B01G012400 chr4D 97.297 37 1 0 877 913 380252187 380252223 3.340000e-06 63.9
12 TraesCS6B01G012400 chr5D 90.083 363 18 4 484 828 548626957 548627319 4.710000e-124 455.0
13 TraesCS6B01G012400 chr5D 92.237 219 10 1 275 486 548626641 548626859 1.810000e-78 303.0
14 TraesCS6B01G012400 chr5D 90.303 165 16 0 1502 1666 5112186 5112350 2.420000e-52 217.0
15 TraesCS6B01G012400 chr5D 86.538 52 4 2 2895 2943 22440517 22440466 2.000000e-03 54.7
16 TraesCS6B01G012400 chr6A 90.580 276 20 3 1 276 550376805 550377074 1.060000e-95 361.0
17 TraesCS6B01G012400 chr6A 89.697 165 17 0 1502 1666 458217874 458217710 1.130000e-50 211.0
18 TraesCS6B01G012400 chr7A 90.253 277 19 4 1 276 44739030 44738761 4.920000e-94 355.0
19 TraesCS6B01G012400 chr3B 90.672 268 19 2 9 276 796634595 796634856 6.360000e-93 351.0
20 TraesCS6B01G012400 chr3A 91.284 218 12 1 276 486 13512618 13512401 1.410000e-74 291.0
21 TraesCS6B01G012400 chr3A 94.304 158 9 0 671 828 13511790 13511633 3.990000e-60 243.0
22 TraesCS6B01G012400 chr3A 88.038 209 9 7 484 676 13512303 13512095 2.400000e-57 233.0
23 TraesCS6B01G012400 chr3A 81.057 227 25 7 504 715 24460177 24460400 8.890000e-37 165.0
24 TraesCS6B01G012400 chr3A 92.308 39 3 0 876 914 547130736 547130774 5.580000e-04 56.5
25 TraesCS6B01G012400 chr2A 89.908 218 15 2 276 486 48553059 48552842 1.420000e-69 274.0
26 TraesCS6B01G012400 chr2A 94.304 158 9 0 671 828 48552230 48552073 3.990000e-60 243.0
27 TraesCS6B01G012400 chr2A 87.736 212 8 7 484 677 48552744 48552533 8.640000e-57 231.0
28 TraesCS6B01G012400 chr2A 89.595 173 18 0 1498 1670 469790032 469790204 1.870000e-53 220.0
29 TraesCS6B01G012400 chr2A 90.840 131 9 3 280 409 769558122 769557994 5.310000e-39 172.0
30 TraesCS6B01G012400 chr2A 100.000 28 0 0 886 913 650622439 650622412 7.000000e-03 52.8
31 TraesCS6B01G012400 chr7D 90.303 165 16 0 1502 1666 363148833 363148997 2.420000e-52 217.0
32 TraesCS6B01G012400 chr7D 89.286 168 18 0 1499 1666 172255273 172255440 1.130000e-50 211.0
33 TraesCS6B01G012400 chr7D 78.305 295 35 8 504 783 17213410 17213690 3.200000e-36 163.0
34 TraesCS6B01G012400 chr7D 86.567 67 5 4 880 946 579758855 579758793 1.990000e-08 71.3
35 TraesCS6B01G012400 chr7D 97.143 35 1 0 879 913 219834543 219834509 4.320000e-05 60.2
36 TraesCS6B01G012400 chr7D 97.143 35 1 0 880 914 598614018 598614052 4.320000e-05 60.2
37 TraesCS6B01G012400 chr3D 88.889 171 18 1 1498 1668 550509429 550509598 4.050000e-50 209.0
38 TraesCS6B01G012400 chr3D 97.297 37 1 0 877 913 409018894 409018930 3.340000e-06 63.9
39 TraesCS6B01G012400 chr1D 87.778 180 21 1 1502 1680 220154134 220154313 4.050000e-50 209.0
40 TraesCS6B01G012400 chr1D 87.027 185 22 2 1496 1680 458805546 458805364 1.460000e-49 207.0
41 TraesCS6B01G012400 chr7B 80.822 292 23 5 11 276 131571577 131571293 8.770000e-47 198.0
42 TraesCS6B01G012400 chr7B 93.103 87 6 0 3148 3234 531993160 531993246 1.170000e-25 128.0
43 TraesCS6B01G012400 chr2B 76.677 313 49 16 3388 3683 140247977 140247672 6.920000e-33 152.0
44 TraesCS6B01G012400 chr6D 86.047 129 16 2 570 698 409744447 409744573 1.940000e-28 137.0
45 TraesCS6B01G012400 chr5A 93.103 87 6 0 3148 3234 73038414 73038500 1.170000e-25 128.0
46 TraesCS6B01G012400 chr4B 89.024 82 7 1 423 502 466641650 466641569 2.540000e-17 100.0
47 TraesCS6B01G012400 chr4B 100.000 30 0 0 884 913 399148108 399148079 5.580000e-04 56.5
48 TraesCS6B01G012400 chr1B 94.872 39 1 1 877 914 667833975 667833937 4.320000e-05 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G012400 chr6B 7552311 7556309 3998 True 7385.000000 7385 100.000000 1 3999 1 chr6B.!!$R1 3998
1 TraesCS6B01G012400 chr5B 513853129 513853692 563 True 684.000000 684 89.007000 280 828 1 chr5B.!!$R2 548
2 TraesCS6B01G012400 chr4D 127559486 127560162 676 False 389.500000 477 91.693500 276 828 2 chr4D.!!$F2 552
3 TraesCS6B01G012400 chr4D 40819949 40820627 678 True 384.500000 466 91.435500 275 828 2 chr4D.!!$R1 553
4 TraesCS6B01G012400 chr5D 548626641 548627319 678 False 379.000000 455 91.160000 275 828 2 chr5D.!!$F2 553
5 TraesCS6B01G012400 chr3A 13511633 13512618 985 True 255.666667 291 91.208667 276 828 3 chr3A.!!$R1 552
6 TraesCS6B01G012400 chr2A 48552073 48553059 986 True 249.333333 274 90.649333 276 828 3 chr2A.!!$R3 552


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
942 1379 0.030501 ATATTGTGGGACGGGAGGGA 60.031 55.0 0.0 0.0 0.00 4.20 F
1250 1687 0.034477 CAAGGACGCCATTAACCCCT 60.034 55.0 0.0 0.0 0.00 4.79 F
2431 2868 0.036022 AGAGAACACCAAGAGGCTGC 59.964 55.0 0.0 0.0 39.06 5.25 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2434 2871 0.03438 TCCTCCTCCTCGTACACCAG 60.034 60.0 0.0 0.0 0.00 4.00 R
2435 2872 0.03438 CTCCTCCTCCTCGTACACCA 60.034 60.0 0.0 0.0 0.00 4.17 R
3464 3901 0.10576 AACATGGACAGGCCCAAACA 60.106 50.0 0.0 0.0 40.04 2.83 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 6.854496 TTATTTGCATACTGGGACGATAAC 57.146 37.500 0.00 0.00 0.00 1.89
24 25 3.897141 TTGCATACTGGGACGATAACA 57.103 42.857 0.00 0.00 0.00 2.41
25 26 3.897141 TGCATACTGGGACGATAACAA 57.103 42.857 0.00 0.00 0.00 2.83
26 27 4.209307 TGCATACTGGGACGATAACAAA 57.791 40.909 0.00 0.00 0.00 2.83
27 28 4.580868 TGCATACTGGGACGATAACAAAA 58.419 39.130 0.00 0.00 0.00 2.44
28 29 4.393680 TGCATACTGGGACGATAACAAAAC 59.606 41.667 0.00 0.00 0.00 2.43
29 30 4.493545 GCATACTGGGACGATAACAAAACG 60.494 45.833 0.00 0.00 0.00 3.60
30 31 2.419667 ACTGGGACGATAACAAAACGG 58.580 47.619 0.00 0.00 0.00 4.44
31 32 1.129811 CTGGGACGATAACAAAACGGC 59.870 52.381 0.00 0.00 0.00 5.68
32 33 1.158434 GGGACGATAACAAAACGGCA 58.842 50.000 0.00 0.00 36.73 5.69
33 34 1.135888 GGGACGATAACAAAACGGCAC 60.136 52.381 0.00 0.00 36.73 5.01
34 35 1.532007 GGACGATAACAAAACGGCACA 59.468 47.619 0.00 0.00 36.73 4.57
35 36 2.567067 GACGATAACAAAACGGCACAC 58.433 47.619 0.00 0.00 35.00 3.82
45 46 3.561429 CGGCACACGTACATGCTT 58.439 55.556 15.65 0.00 41.74 3.91
46 47 1.419922 CGGCACACGTACATGCTTC 59.580 57.895 15.65 2.85 41.74 3.86
47 48 1.288419 CGGCACACGTACATGCTTCA 61.288 55.000 15.65 0.00 41.74 3.02
48 49 0.871722 GGCACACGTACATGCTTCAA 59.128 50.000 15.65 0.00 41.74 2.69
49 50 1.265635 GGCACACGTACATGCTTCAAA 59.734 47.619 15.65 0.00 41.74 2.69
50 51 2.287308 GGCACACGTACATGCTTCAAAA 60.287 45.455 15.65 0.00 41.74 2.44
51 52 3.367607 GCACACGTACATGCTTCAAAAA 58.632 40.909 10.48 0.00 38.84 1.94
52 53 3.421888 GCACACGTACATGCTTCAAAAAG 59.578 43.478 10.48 0.00 38.84 2.27
53 54 4.788201 GCACACGTACATGCTTCAAAAAGA 60.788 41.667 10.48 0.00 38.84 2.52
54 55 5.451908 CACACGTACATGCTTCAAAAAGAT 58.548 37.500 0.00 0.00 34.14 2.40
55 56 6.598525 CACACGTACATGCTTCAAAAAGATA 58.401 36.000 0.00 0.00 34.14 1.98
56 57 7.243487 CACACGTACATGCTTCAAAAAGATAT 58.757 34.615 0.00 0.00 34.14 1.63
57 58 7.216881 CACACGTACATGCTTCAAAAAGATATG 59.783 37.037 0.00 0.00 35.97 1.78
58 59 6.688385 CACGTACATGCTTCAAAAAGATATGG 59.312 38.462 0.00 0.00 35.03 2.74
59 60 6.597672 ACGTACATGCTTCAAAAAGATATGGA 59.402 34.615 0.00 0.00 35.03 3.41
60 61 7.283127 ACGTACATGCTTCAAAAAGATATGGAT 59.717 33.333 0.00 0.00 35.03 3.41
61 62 7.588854 CGTACATGCTTCAAAAAGATATGGATG 59.411 37.037 0.00 0.00 35.03 3.51
62 63 7.649533 ACATGCTTCAAAAAGATATGGATGA 57.350 32.000 0.00 0.00 35.03 2.92
63 64 7.486647 ACATGCTTCAAAAAGATATGGATGAC 58.513 34.615 0.00 0.00 35.03 3.06
64 65 7.123098 ACATGCTTCAAAAAGATATGGATGACA 59.877 33.333 0.00 0.00 35.03 3.58
65 66 7.649533 TGCTTCAAAAAGATATGGATGACAT 57.350 32.000 0.00 0.00 37.89 3.06
66 67 7.485810 TGCTTCAAAAAGATATGGATGACATG 58.514 34.615 0.00 0.00 36.06 3.21
67 68 7.339976 TGCTTCAAAAAGATATGGATGACATGA 59.660 33.333 0.00 0.00 36.06 3.07
68 69 7.861372 GCTTCAAAAAGATATGGATGACATGAG 59.139 37.037 0.00 0.00 36.06 2.90
69 70 7.268199 TCAAAAAGATATGGATGACATGAGC 57.732 36.000 0.00 0.00 40.82 4.26
70 71 7.058525 TCAAAAAGATATGGATGACATGAGCT 58.941 34.615 0.00 0.00 40.82 4.09
71 72 8.212995 TCAAAAAGATATGGATGACATGAGCTA 58.787 33.333 0.00 0.00 40.82 3.32
72 73 8.843262 CAAAAAGATATGGATGACATGAGCTAA 58.157 33.333 0.00 0.00 40.82 3.09
73 74 8.618702 AAAAGATATGGATGACATGAGCTAAG 57.381 34.615 0.00 0.00 40.82 2.18
74 75 6.931790 AGATATGGATGACATGAGCTAAGT 57.068 37.500 0.00 0.00 40.82 2.24
75 76 6.699366 AGATATGGATGACATGAGCTAAGTG 58.301 40.000 0.00 0.00 40.82 3.16
76 77 6.496218 AGATATGGATGACATGAGCTAAGTGA 59.504 38.462 0.00 0.00 40.82 3.41
77 78 4.824479 TGGATGACATGAGCTAAGTGAA 57.176 40.909 0.00 0.00 0.00 3.18
78 79 4.763073 TGGATGACATGAGCTAAGTGAAG 58.237 43.478 0.00 0.00 0.00 3.02
79 80 4.223700 TGGATGACATGAGCTAAGTGAAGT 59.776 41.667 0.00 0.00 0.00 3.01
80 81 4.808364 GGATGACATGAGCTAAGTGAAGTC 59.192 45.833 0.00 0.00 0.00 3.01
81 82 4.871933 TGACATGAGCTAAGTGAAGTCA 57.128 40.909 0.00 0.00 32.91 3.41
82 83 5.213891 TGACATGAGCTAAGTGAAGTCAA 57.786 39.130 0.00 0.00 32.46 3.18
83 84 5.610398 TGACATGAGCTAAGTGAAGTCAAA 58.390 37.500 0.00 0.00 32.46 2.69
84 85 5.466728 TGACATGAGCTAAGTGAAGTCAAAC 59.533 40.000 0.00 0.00 32.46 2.93
85 86 5.368145 ACATGAGCTAAGTGAAGTCAAACA 58.632 37.500 0.00 0.00 0.00 2.83
86 87 6.000219 ACATGAGCTAAGTGAAGTCAAACAT 59.000 36.000 0.00 0.00 0.00 2.71
87 88 7.161404 ACATGAGCTAAGTGAAGTCAAACATA 58.839 34.615 0.00 0.00 0.00 2.29
88 89 7.118390 ACATGAGCTAAGTGAAGTCAAACATAC 59.882 37.037 0.00 0.00 0.00 2.39
89 90 6.521162 TGAGCTAAGTGAAGTCAAACATACA 58.479 36.000 0.00 0.00 0.00 2.29
90 91 7.161404 TGAGCTAAGTGAAGTCAAACATACAT 58.839 34.615 0.00 0.00 0.00 2.29
91 92 7.661437 TGAGCTAAGTGAAGTCAAACATACATT 59.339 33.333 0.00 0.00 0.00 2.71
92 93 7.810658 AGCTAAGTGAAGTCAAACATACATTG 58.189 34.615 0.00 0.00 0.00 2.82
93 94 7.445402 AGCTAAGTGAAGTCAAACATACATTGT 59.555 33.333 0.00 0.00 41.53 2.71
94 95 7.746475 GCTAAGTGAAGTCAAACATACATTGTC 59.254 37.037 0.00 0.00 37.68 3.18
95 96 6.560253 AGTGAAGTCAAACATACATTGTCC 57.440 37.500 0.00 0.00 37.68 4.02
96 97 6.061441 AGTGAAGTCAAACATACATTGTCCA 58.939 36.000 0.00 0.00 37.68 4.02
97 98 6.545666 AGTGAAGTCAAACATACATTGTCCAA 59.454 34.615 0.00 0.00 37.68 3.53
98 99 7.068103 AGTGAAGTCAAACATACATTGTCCAAA 59.932 33.333 0.00 0.00 37.68 3.28
99 100 7.867403 GTGAAGTCAAACATACATTGTCCAAAT 59.133 33.333 0.00 0.00 37.68 2.32
100 101 8.081633 TGAAGTCAAACATACATTGTCCAAATC 58.918 33.333 0.00 0.00 37.68 2.17
101 102 7.523293 AGTCAAACATACATTGTCCAAATCA 57.477 32.000 0.00 0.00 37.68 2.57
102 103 7.596494 AGTCAAACATACATTGTCCAAATCAG 58.404 34.615 0.00 0.00 37.68 2.90
103 104 7.448161 AGTCAAACATACATTGTCCAAATCAGA 59.552 33.333 0.00 0.00 37.68 3.27
104 105 8.081633 GTCAAACATACATTGTCCAAATCAGAA 58.918 33.333 0.00 0.00 37.68 3.02
105 106 8.637099 TCAAACATACATTGTCCAAATCAGAAA 58.363 29.630 0.00 0.00 37.68 2.52
106 107 9.426837 CAAACATACATTGTCCAAATCAGAAAT 57.573 29.630 0.00 0.00 37.68 2.17
109 110 9.466497 ACATACATTGTCCAAATCAGAAATACT 57.534 29.630 0.00 0.00 30.89 2.12
110 111 9.726232 CATACATTGTCCAAATCAGAAATACTG 57.274 33.333 0.00 0.00 46.97 2.74
140 141 7.823745 ACCAATGATGATTACTAACCAATCC 57.176 36.000 0.00 0.00 32.46 3.01
141 142 7.353525 ACCAATGATGATTACTAACCAATCCA 58.646 34.615 0.00 0.00 32.46 3.41
142 143 8.006564 ACCAATGATGATTACTAACCAATCCAT 58.993 33.333 0.00 0.00 32.46 3.41
143 144 8.301720 CCAATGATGATTACTAACCAATCCATG 58.698 37.037 0.00 0.00 32.46 3.66
165 166 3.957468 GCTATTATGCCACTGTTTCAGC 58.043 45.455 0.00 0.00 34.37 4.26
166 167 3.378112 GCTATTATGCCACTGTTTCAGCA 59.622 43.478 0.00 0.00 40.00 4.41
167 168 3.855689 ATTATGCCACTGTTTCAGCAC 57.144 42.857 0.00 0.00 38.21 4.40
168 169 2.566833 TATGCCACTGTTTCAGCACT 57.433 45.000 0.00 0.00 38.21 4.40
169 170 1.242076 ATGCCACTGTTTCAGCACTC 58.758 50.000 0.00 0.00 38.21 3.51
170 171 0.107263 TGCCACTGTTTCAGCACTCA 60.107 50.000 0.00 0.00 34.37 3.41
171 172 1.024271 GCCACTGTTTCAGCACTCAA 58.976 50.000 0.00 0.00 34.37 3.02
172 173 1.405105 GCCACTGTTTCAGCACTCAAA 59.595 47.619 0.00 0.00 34.37 2.69
173 174 2.796032 GCCACTGTTTCAGCACTCAAAC 60.796 50.000 0.00 0.00 34.37 2.93
174 175 2.539547 CCACTGTTTCAGCACTCAAACG 60.540 50.000 0.00 0.00 35.59 3.60
175 176 2.351418 CACTGTTTCAGCACTCAAACGA 59.649 45.455 0.00 0.00 35.59 3.85
176 177 3.002656 CACTGTTTCAGCACTCAAACGAT 59.997 43.478 0.00 0.00 35.59 3.73
177 178 3.627577 ACTGTTTCAGCACTCAAACGATT 59.372 39.130 0.00 0.00 35.59 3.34
178 179 4.814234 ACTGTTTCAGCACTCAAACGATTA 59.186 37.500 0.00 0.00 35.59 1.75
179 180 5.090652 TGTTTCAGCACTCAAACGATTAC 57.909 39.130 0.00 0.00 35.59 1.89
180 181 4.024387 TGTTTCAGCACTCAAACGATTACC 60.024 41.667 0.00 0.00 35.59 2.85
181 182 3.394674 TCAGCACTCAAACGATTACCA 57.605 42.857 0.00 0.00 0.00 3.25
182 183 3.325870 TCAGCACTCAAACGATTACCAG 58.674 45.455 0.00 0.00 0.00 4.00
183 184 2.416547 CAGCACTCAAACGATTACCAGG 59.583 50.000 0.00 0.00 0.00 4.45
184 185 2.301870 AGCACTCAAACGATTACCAGGA 59.698 45.455 0.00 0.00 0.00 3.86
185 186 3.055094 AGCACTCAAACGATTACCAGGAT 60.055 43.478 0.00 0.00 0.00 3.24
186 187 4.161565 AGCACTCAAACGATTACCAGGATA 59.838 41.667 0.00 0.00 0.00 2.59
187 188 4.873827 GCACTCAAACGATTACCAGGATAA 59.126 41.667 0.00 0.00 0.00 1.75
188 189 5.527582 GCACTCAAACGATTACCAGGATAAT 59.472 40.000 0.00 0.00 0.00 1.28
189 190 6.292919 GCACTCAAACGATTACCAGGATAATC 60.293 42.308 0.00 2.81 37.94 1.75
190 191 6.761242 CACTCAAACGATTACCAGGATAATCA 59.239 38.462 16.08 2.87 40.27 2.57
191 192 7.279981 CACTCAAACGATTACCAGGATAATCAA 59.720 37.037 16.08 2.85 40.27 2.57
192 193 7.827236 ACTCAAACGATTACCAGGATAATCAAA 59.173 33.333 16.08 3.06 40.27 2.69
193 194 8.568676 TCAAACGATTACCAGGATAATCAAAA 57.431 30.769 16.08 2.00 40.27 2.44
194 195 8.673711 TCAAACGATTACCAGGATAATCAAAAG 58.326 33.333 16.08 7.27 40.27 2.27
195 196 6.619801 ACGATTACCAGGATAATCAAAAGC 57.380 37.500 16.08 0.00 40.27 3.51
196 197 6.119536 ACGATTACCAGGATAATCAAAAGCA 58.880 36.000 16.08 0.00 40.27 3.91
197 198 6.038271 ACGATTACCAGGATAATCAAAAGCAC 59.962 38.462 16.08 0.00 40.27 4.40
198 199 6.513393 CGATTACCAGGATAATCAAAAGCACC 60.513 42.308 16.08 0.00 40.27 5.01
199 200 3.365472 ACCAGGATAATCAAAAGCACCC 58.635 45.455 0.00 0.00 0.00 4.61
200 201 3.011708 ACCAGGATAATCAAAAGCACCCT 59.988 43.478 0.00 0.00 0.00 4.34
201 202 3.633986 CCAGGATAATCAAAAGCACCCTC 59.366 47.826 0.00 0.00 0.00 4.30
202 203 3.313526 CAGGATAATCAAAAGCACCCTCG 59.686 47.826 0.00 0.00 0.00 4.63
203 204 2.618709 GGATAATCAAAAGCACCCTCGG 59.381 50.000 0.00 0.00 0.00 4.63
204 205 2.871096 TAATCAAAAGCACCCTCGGT 57.129 45.000 0.00 0.00 35.62 4.69
213 214 2.122547 ACCCTCGGTGTCCAGGTT 60.123 61.111 0.00 0.00 32.98 3.50
214 215 2.214920 ACCCTCGGTGTCCAGGTTC 61.215 63.158 0.00 0.00 32.98 3.62
215 216 2.214216 CCCTCGGTGTCCAGGTTCA 61.214 63.158 0.00 0.00 0.00 3.18
216 217 1.752198 CCTCGGTGTCCAGGTTCAA 59.248 57.895 0.00 0.00 0.00 2.69
217 218 0.320771 CCTCGGTGTCCAGGTTCAAG 60.321 60.000 0.00 0.00 0.00 3.02
218 219 0.679505 CTCGGTGTCCAGGTTCAAGA 59.320 55.000 0.00 0.00 0.00 3.02
219 220 1.070134 CTCGGTGTCCAGGTTCAAGAA 59.930 52.381 0.00 0.00 0.00 2.52
220 221 1.487142 TCGGTGTCCAGGTTCAAGAAA 59.513 47.619 0.00 0.00 0.00 2.52
221 222 2.092861 TCGGTGTCCAGGTTCAAGAAAA 60.093 45.455 0.00 0.00 0.00 2.29
222 223 2.685897 CGGTGTCCAGGTTCAAGAAAAA 59.314 45.455 0.00 0.00 0.00 1.94
223 224 3.317993 CGGTGTCCAGGTTCAAGAAAAAT 59.682 43.478 0.00 0.00 0.00 1.82
224 225 4.620982 GGTGTCCAGGTTCAAGAAAAATG 58.379 43.478 0.00 0.00 0.00 2.32
225 226 4.051237 GTGTCCAGGTTCAAGAAAAATGC 58.949 43.478 0.00 0.00 0.00 3.56
226 227 3.703556 TGTCCAGGTTCAAGAAAAATGCA 59.296 39.130 0.00 0.00 0.00 3.96
227 228 4.051237 GTCCAGGTTCAAGAAAAATGCAC 58.949 43.478 0.00 0.00 0.00 4.57
228 229 3.069443 TCCAGGTTCAAGAAAAATGCACC 59.931 43.478 0.00 0.00 34.75 5.01
229 230 3.181467 CCAGGTTCAAGAAAAATGCACCA 60.181 43.478 0.00 0.00 36.67 4.17
230 231 4.053295 CAGGTTCAAGAAAAATGCACCAG 58.947 43.478 0.00 0.00 36.67 4.00
231 232 3.960102 AGGTTCAAGAAAAATGCACCAGA 59.040 39.130 0.00 0.00 36.67 3.86
232 233 4.405358 AGGTTCAAGAAAAATGCACCAGAA 59.595 37.500 0.00 0.00 36.67 3.02
233 234 5.104982 AGGTTCAAGAAAAATGCACCAGAAA 60.105 36.000 0.00 0.00 36.67 2.52
234 235 5.006649 GGTTCAAGAAAAATGCACCAGAAAC 59.993 40.000 0.00 0.00 34.69 2.78
235 236 4.692228 TCAAGAAAAATGCACCAGAAACC 58.308 39.130 0.00 0.00 0.00 3.27
236 237 4.161189 TCAAGAAAAATGCACCAGAAACCA 59.839 37.500 0.00 0.00 0.00 3.67
237 238 4.961438 AGAAAAATGCACCAGAAACCAT 57.039 36.364 0.00 0.00 0.00 3.55
238 239 4.634199 AGAAAAATGCACCAGAAACCATG 58.366 39.130 0.00 0.00 0.00 3.66
239 240 3.405823 AAAATGCACCAGAAACCATGG 57.594 42.857 11.19 11.19 43.87 3.66
240 241 1.269012 AATGCACCAGAAACCATGGG 58.731 50.000 18.09 0.00 42.48 4.00
241 242 1.259840 ATGCACCAGAAACCATGGGC 61.260 55.000 18.09 7.57 42.48 5.36
242 243 2.649129 GCACCAGAAACCATGGGCC 61.649 63.158 18.09 0.00 42.48 5.80
243 244 1.228831 CACCAGAAACCATGGGCCA 60.229 57.895 18.09 9.61 42.48 5.36
244 245 1.228862 ACCAGAAACCATGGGCCAC 60.229 57.895 18.09 4.57 42.48 5.01
245 246 1.984026 CCAGAAACCATGGGCCACC 60.984 63.158 18.09 0.13 33.94 4.61
246 247 2.035626 AGAAACCATGGGCCACCG 59.964 61.111 18.09 3.79 40.75 4.94
247 248 2.282887 GAAACCATGGGCCACCGT 60.283 61.111 18.09 4.60 40.75 4.83
248 249 1.001887 GAAACCATGGGCCACCGTA 60.002 57.895 18.09 0.00 40.75 4.02
249 250 1.303806 AAACCATGGGCCACCGTAC 60.304 57.895 18.09 0.00 40.75 3.67
250 251 2.774687 AAACCATGGGCCACCGTACC 62.775 60.000 18.09 0.00 40.75 3.34
251 252 3.407967 CCATGGGCCACCGTACCT 61.408 66.667 9.28 0.00 40.75 3.08
252 253 2.124736 CATGGGCCACCGTACCTG 60.125 66.667 9.28 0.00 40.75 4.00
253 254 3.407967 ATGGGCCACCGTACCTGG 61.408 66.667 9.28 0.00 40.75 4.45
254 255 3.935456 ATGGGCCACCGTACCTGGA 62.935 63.158 9.28 0.00 40.75 3.86
255 256 3.324108 GGGCCACCGTACCTGGAA 61.324 66.667 4.39 0.00 0.00 3.53
256 257 2.751688 GGCCACCGTACCTGGAAA 59.248 61.111 0.00 0.00 0.00 3.13
257 258 1.073548 GGCCACCGTACCTGGAAAA 59.926 57.895 0.00 0.00 0.00 2.29
258 259 1.239296 GGCCACCGTACCTGGAAAAC 61.239 60.000 0.00 0.00 0.00 2.43
259 260 0.535553 GCCACCGTACCTGGAAAACA 60.536 55.000 0.00 0.00 0.00 2.83
260 261 1.884928 GCCACCGTACCTGGAAAACAT 60.885 52.381 0.00 0.00 0.00 2.71
261 262 2.081462 CCACCGTACCTGGAAAACATC 58.919 52.381 0.00 0.00 0.00 3.06
278 279 4.987963 ACATCCCAGAATATGCATGAGA 57.012 40.909 10.16 0.00 0.00 3.27
349 350 1.008938 AGTCTGGCCCTCCACTTAGAT 59.991 52.381 0.00 0.00 37.47 1.98
369 370 9.945904 CTTAGATGGGTAGTTTAGTCTTTTCTT 57.054 33.333 0.00 0.00 0.00 2.52
437 445 4.651994 GCTGAATGTTACCGATCAAACAG 58.348 43.478 10.08 0.00 38.87 3.16
441 449 5.180492 TGAATGTTACCGATCAAACAGAACC 59.820 40.000 10.08 2.57 38.87 3.62
539 648 2.661979 GCAAGACGTTCGTTCATCAACC 60.662 50.000 0.00 0.00 0.00 3.77
564 673 4.737054 ACAAATTCTAATCAAAGCAGCCG 58.263 39.130 0.00 0.00 0.00 5.52
594 721 4.543590 ACTGAACCAAGTCGATCTGATT 57.456 40.909 0.00 0.00 0.00 2.57
616 743 1.666888 GCTGCACATTTGTACACCTGC 60.667 52.381 0.00 0.59 0.00 4.85
645 772 2.092323 CGTGATAGATCTCCGGCCATA 58.908 52.381 2.24 0.00 0.00 2.74
685 1122 1.135915 CTAGTCATCCTGCTTCAGCGT 59.864 52.381 0.00 0.00 45.83 5.07
714 1151 4.222114 GAGTTTCCAATTGCACGAGAAAG 58.778 43.478 0.00 0.00 0.00 2.62
828 1265 4.063967 CGCGGGCAGACCACAGTA 62.064 66.667 0.00 0.00 40.22 2.74
829 1266 2.584608 GCGGGCAGACCACAGTAT 59.415 61.111 0.00 0.00 40.22 2.12
830 1267 1.078426 GCGGGCAGACCACAGTATT 60.078 57.895 0.00 0.00 40.22 1.89
831 1268 0.177141 GCGGGCAGACCACAGTATTA 59.823 55.000 0.00 0.00 40.22 0.98
832 1269 1.406341 GCGGGCAGACCACAGTATTAA 60.406 52.381 0.00 0.00 40.22 1.40
833 1270 2.745152 GCGGGCAGACCACAGTATTAAT 60.745 50.000 0.00 0.00 40.22 1.40
834 1271 3.493699 GCGGGCAGACCACAGTATTAATA 60.494 47.826 0.00 0.00 40.22 0.98
835 1272 4.802918 GCGGGCAGACCACAGTATTAATAT 60.803 45.833 0.00 0.00 40.22 1.28
836 1273 4.929808 CGGGCAGACCACAGTATTAATATC 59.070 45.833 0.00 0.00 40.22 1.63
837 1274 5.510690 CGGGCAGACCACAGTATTAATATCA 60.511 44.000 0.00 0.00 40.22 2.15
838 1275 5.934625 GGGCAGACCACAGTATTAATATCAG 59.065 44.000 0.00 0.00 39.85 2.90
839 1276 5.409826 GGCAGACCACAGTATTAATATCAGC 59.590 44.000 0.00 0.16 35.26 4.26
840 1277 5.991606 GCAGACCACAGTATTAATATCAGCA 59.008 40.000 0.00 0.00 0.00 4.41
841 1278 6.652481 GCAGACCACAGTATTAATATCAGCAT 59.348 38.462 0.00 0.00 0.00 3.79
842 1279 7.173907 GCAGACCACAGTATTAATATCAGCATT 59.826 37.037 0.00 0.00 0.00 3.56
843 1280 9.710900 CAGACCACAGTATTAATATCAGCATTA 57.289 33.333 0.00 0.00 0.00 1.90
885 1322 4.595762 TTACCTCATATCAACTACGCCC 57.404 45.455 0.00 0.00 0.00 6.13
886 1323 2.679082 ACCTCATATCAACTACGCCCT 58.321 47.619 0.00 0.00 0.00 5.19
887 1324 2.628657 ACCTCATATCAACTACGCCCTC 59.371 50.000 0.00 0.00 0.00 4.30
888 1325 2.028930 CCTCATATCAACTACGCCCTCC 60.029 54.545 0.00 0.00 0.00 4.30
889 1326 1.611977 TCATATCAACTACGCCCTCCG 59.388 52.381 0.00 0.00 44.21 4.63
898 1335 2.108362 CGCCCTCCGTCCCATAAC 59.892 66.667 0.00 0.00 0.00 1.89
899 1336 2.727392 CGCCCTCCGTCCCATAACA 61.727 63.158 0.00 0.00 0.00 2.41
900 1337 1.837090 GCCCTCCGTCCCATAACAT 59.163 57.895 0.00 0.00 0.00 2.71
901 1338 1.053424 GCCCTCCGTCCCATAACATA 58.947 55.000 0.00 0.00 0.00 2.29
902 1339 1.418637 GCCCTCCGTCCCATAACATAA 59.581 52.381 0.00 0.00 0.00 1.90
903 1340 2.550208 GCCCTCCGTCCCATAACATAAG 60.550 54.545 0.00 0.00 0.00 1.73
904 1341 2.969950 CCCTCCGTCCCATAACATAAGA 59.030 50.000 0.00 0.00 0.00 2.10
905 1342 3.006967 CCCTCCGTCCCATAACATAAGAG 59.993 52.174 0.00 0.00 0.00 2.85
906 1343 3.555168 CCTCCGTCCCATAACATAAGAGC 60.555 52.174 0.00 0.00 0.00 4.09
907 1344 2.035449 TCCGTCCCATAACATAAGAGCG 59.965 50.000 0.00 0.00 0.00 5.03
908 1345 2.223971 CCGTCCCATAACATAAGAGCGT 60.224 50.000 0.00 0.00 0.00 5.07
909 1346 3.454375 CGTCCCATAACATAAGAGCGTT 58.546 45.455 0.00 0.00 0.00 4.84
910 1347 3.869246 CGTCCCATAACATAAGAGCGTTT 59.131 43.478 0.00 0.00 0.00 3.60
911 1348 4.331717 CGTCCCATAACATAAGAGCGTTTT 59.668 41.667 0.00 0.00 0.00 2.43
912 1349 5.163794 CGTCCCATAACATAAGAGCGTTTTT 60.164 40.000 0.00 0.00 0.00 1.94
935 1372 7.490962 TTTGAGCTATTTATATTGTGGGACG 57.509 36.000 0.00 0.00 0.00 4.79
936 1373 5.547465 TGAGCTATTTATATTGTGGGACGG 58.453 41.667 0.00 0.00 0.00 4.79
937 1374 4.906618 AGCTATTTATATTGTGGGACGGG 58.093 43.478 0.00 0.00 0.00 5.28
938 1375 4.595781 AGCTATTTATATTGTGGGACGGGA 59.404 41.667 0.00 0.00 0.00 5.14
939 1376 4.935808 GCTATTTATATTGTGGGACGGGAG 59.064 45.833 0.00 0.00 0.00 4.30
940 1377 3.849563 TTTATATTGTGGGACGGGAGG 57.150 47.619 0.00 0.00 0.00 4.30
941 1378 1.724545 TATATTGTGGGACGGGAGGG 58.275 55.000 0.00 0.00 0.00 4.30
942 1379 0.030501 ATATTGTGGGACGGGAGGGA 60.031 55.000 0.00 0.00 0.00 4.20
943 1380 0.689745 TATTGTGGGACGGGAGGGAG 60.690 60.000 0.00 0.00 0.00 4.30
944 1381 2.765705 ATTGTGGGACGGGAGGGAGT 62.766 60.000 0.00 0.00 0.00 3.85
945 1382 2.096707 TTGTGGGACGGGAGGGAGTA 62.097 60.000 0.00 0.00 0.00 2.59
946 1383 1.757340 GTGGGACGGGAGGGAGTAG 60.757 68.421 0.00 0.00 0.00 2.57
947 1384 2.838693 GGGACGGGAGGGAGTAGC 60.839 72.222 0.00 0.00 0.00 3.58
948 1385 2.043248 GGACGGGAGGGAGTAGCA 60.043 66.667 0.00 0.00 0.00 3.49
949 1386 2.128507 GGACGGGAGGGAGTAGCAG 61.129 68.421 0.00 0.00 0.00 4.24
950 1387 1.076923 GACGGGAGGGAGTAGCAGA 60.077 63.158 0.00 0.00 0.00 4.26
951 1388 0.468400 GACGGGAGGGAGTAGCAGAT 60.468 60.000 0.00 0.00 0.00 2.90
952 1389 0.851469 ACGGGAGGGAGTAGCAGATA 59.149 55.000 0.00 0.00 0.00 1.98
953 1390 1.217183 ACGGGAGGGAGTAGCAGATAA 59.783 52.381 0.00 0.00 0.00 1.75
954 1391 1.614413 CGGGAGGGAGTAGCAGATAAC 59.386 57.143 0.00 0.00 0.00 1.89
955 1392 2.679082 GGGAGGGAGTAGCAGATAACA 58.321 52.381 0.00 0.00 0.00 2.41
956 1393 2.365941 GGGAGGGAGTAGCAGATAACAC 59.634 54.545 0.00 0.00 0.00 3.32
957 1394 2.034812 GGAGGGAGTAGCAGATAACACG 59.965 54.545 0.00 0.00 0.00 4.49
958 1395 1.409427 AGGGAGTAGCAGATAACACGC 59.591 52.381 0.00 0.00 0.00 5.34
959 1396 1.136305 GGGAGTAGCAGATAACACGCA 59.864 52.381 0.00 0.00 0.00 5.24
960 1397 2.224066 GGGAGTAGCAGATAACACGCAT 60.224 50.000 0.00 0.00 0.00 4.73
961 1398 3.458189 GGAGTAGCAGATAACACGCATT 58.542 45.455 0.00 0.00 0.00 3.56
962 1399 3.246226 GGAGTAGCAGATAACACGCATTG 59.754 47.826 0.00 0.00 0.00 2.82
963 1400 2.609459 AGTAGCAGATAACACGCATTGC 59.391 45.455 0.00 0.00 0.00 3.56
964 1401 1.452110 AGCAGATAACACGCATTGCA 58.548 45.000 9.69 0.00 34.17 4.08
965 1402 1.131126 AGCAGATAACACGCATTGCAC 59.869 47.619 9.69 0.00 34.17 4.57
966 1403 1.801618 CAGATAACACGCATTGCACG 58.198 50.000 9.69 0.97 0.00 5.34
967 1404 1.128507 CAGATAACACGCATTGCACGT 59.871 47.619 9.69 1.65 46.42 4.49
968 1405 2.347150 CAGATAACACGCATTGCACGTA 59.653 45.455 9.69 0.00 42.96 3.57
969 1406 2.347452 AGATAACACGCATTGCACGTAC 59.653 45.455 9.69 0.00 42.96 3.67
970 1407 1.499049 TAACACGCATTGCACGTACA 58.501 45.000 9.69 0.00 42.96 2.90
971 1408 0.041663 AACACGCATTGCACGTACAC 60.042 50.000 9.69 0.00 42.96 2.90
972 1409 1.154814 ACACGCATTGCACGTACACA 61.155 50.000 9.69 0.00 42.96 3.72
973 1410 0.165727 CACGCATTGCACGTACACAT 59.834 50.000 9.69 0.00 42.96 3.21
974 1411 1.391826 CACGCATTGCACGTACACATA 59.608 47.619 9.69 0.00 42.96 2.29
975 1412 2.030335 CACGCATTGCACGTACACATAT 59.970 45.455 9.69 0.00 42.96 1.78
976 1413 2.030335 ACGCATTGCACGTACACATATG 59.970 45.455 9.69 0.00 43.02 1.78
977 1414 2.375110 GCATTGCACGTACACATATGC 58.625 47.619 7.88 7.88 38.59 3.14
978 1415 2.854424 GCATTGCACGTACACATATGCC 60.854 50.000 11.31 0.00 37.26 4.40
979 1416 2.100605 TTGCACGTACACATATGCCA 57.899 45.000 1.58 0.00 37.26 4.92
980 1417 2.323968 TGCACGTACACATATGCCAT 57.676 45.000 1.58 0.00 37.26 4.40
981 1418 2.637947 TGCACGTACACATATGCCATT 58.362 42.857 1.58 0.00 37.26 3.16
982 1419 3.013219 TGCACGTACACATATGCCATTT 58.987 40.909 1.58 0.00 37.26 2.32
983 1420 3.181502 TGCACGTACACATATGCCATTTG 60.182 43.478 1.58 0.00 37.26 2.32
984 1421 3.362295 CACGTACACATATGCCATTTGC 58.638 45.455 1.58 0.00 41.77 3.68
985 1422 2.357637 ACGTACACATATGCCATTTGCC 59.642 45.455 1.58 0.00 40.16 4.52
986 1423 2.287547 CGTACACATATGCCATTTGCCC 60.288 50.000 1.58 0.00 40.16 5.36
987 1424 1.863325 ACACATATGCCATTTGCCCA 58.137 45.000 1.58 0.00 40.16 5.36
988 1425 2.186243 ACACATATGCCATTTGCCCAA 58.814 42.857 1.58 0.00 40.16 4.12
989 1426 2.570752 ACACATATGCCATTTGCCCAAA 59.429 40.909 1.58 0.00 40.16 3.28
990 1427 3.199677 CACATATGCCATTTGCCCAAAG 58.800 45.455 1.58 0.00 40.16 2.77
991 1428 2.171027 ACATATGCCATTTGCCCAAAGG 59.829 45.455 1.58 0.00 40.16 3.11
992 1429 2.244486 TATGCCATTTGCCCAAAGGA 57.756 45.000 6.95 0.00 40.16 3.36
993 1430 1.587066 ATGCCATTTGCCCAAAGGAT 58.413 45.000 6.95 0.00 40.16 3.24
994 1431 2.244486 TGCCATTTGCCCAAAGGATA 57.756 45.000 6.95 0.00 40.16 2.59
995 1432 2.109774 TGCCATTTGCCCAAAGGATAG 58.890 47.619 6.95 0.00 40.16 2.08
996 1433 2.292126 TGCCATTTGCCCAAAGGATAGA 60.292 45.455 6.95 0.00 40.16 1.98
997 1434 2.363359 GCCATTTGCCCAAAGGATAGAG 59.637 50.000 6.95 0.00 34.35 2.43
998 1435 3.902218 CCATTTGCCCAAAGGATAGAGA 58.098 45.455 6.95 0.00 34.35 3.10
999 1436 4.477249 CCATTTGCCCAAAGGATAGAGAT 58.523 43.478 6.95 0.00 34.35 2.75
1000 1437 4.522022 CCATTTGCCCAAAGGATAGAGATC 59.478 45.833 6.95 0.00 34.35 2.75
1001 1438 5.383476 CATTTGCCCAAAGGATAGAGATCT 58.617 41.667 0.00 0.00 34.35 2.75
1002 1439 6.466326 CCATTTGCCCAAAGGATAGAGATCTA 60.466 42.308 6.95 0.00 34.35 1.98
1003 1440 6.770286 TTTGCCCAAAGGATAGAGATCTAT 57.230 37.500 0.00 1.96 41.56 1.98
1004 1441 7.872061 TTTGCCCAAAGGATAGAGATCTATA 57.128 36.000 0.00 0.00 39.14 1.31
1005 1442 7.872061 TTGCCCAAAGGATAGAGATCTATAA 57.128 36.000 0.31 0.00 39.14 0.98
1006 1443 7.872061 TGCCCAAAGGATAGAGATCTATAAA 57.128 36.000 0.31 0.00 39.14 1.40
1007 1444 8.454859 TGCCCAAAGGATAGAGATCTATAAAT 57.545 34.615 0.31 0.00 39.14 1.40
1008 1445 9.560860 TGCCCAAAGGATAGAGATCTATAAATA 57.439 33.333 0.31 0.00 39.14 1.40
1009 1446 9.825109 GCCCAAAGGATAGAGATCTATAAATAC 57.175 37.037 0.31 0.00 39.14 1.89
1021 1458 9.921637 GAGATCTATAAATACCAAGAGAAGTGG 57.078 37.037 0.00 0.00 42.28 4.00
1022 1459 8.875168 AGATCTATAAATACCAAGAGAAGTGGG 58.125 37.037 0.00 0.00 40.75 4.61
1023 1460 8.798975 ATCTATAAATACCAAGAGAAGTGGGA 57.201 34.615 0.00 0.00 40.75 4.37
1024 1461 8.618240 TCTATAAATACCAAGAGAAGTGGGAA 57.382 34.615 0.00 0.00 40.75 3.97
1025 1462 8.483758 TCTATAAATACCAAGAGAAGTGGGAAC 58.516 37.037 0.00 0.00 40.75 3.62
1026 1463 5.584551 AAATACCAAGAGAAGTGGGAACT 57.415 39.130 0.00 0.00 40.75 3.01
1027 1464 5.584551 AATACCAAGAGAAGTGGGAACTT 57.415 39.130 0.00 0.00 40.75 2.66
1028 1465 3.214696 ACCAAGAGAAGTGGGAACTTG 57.785 47.619 0.00 0.00 40.75 3.16
1029 1466 2.777692 ACCAAGAGAAGTGGGAACTTGA 59.222 45.455 0.00 0.00 40.75 3.02
1030 1467 3.181450 ACCAAGAGAAGTGGGAACTTGAG 60.181 47.826 0.00 0.00 40.75 3.02
1031 1468 2.810852 CAAGAGAAGTGGGAACTTGAGC 59.189 50.000 0.00 0.00 39.84 4.26
1032 1469 2.050144 AGAGAAGTGGGAACTTGAGCA 58.950 47.619 0.00 0.00 0.00 4.26
1033 1470 2.439507 AGAGAAGTGGGAACTTGAGCAA 59.560 45.455 0.00 0.00 0.00 3.91
1034 1471 3.117888 AGAGAAGTGGGAACTTGAGCAAA 60.118 43.478 0.00 0.00 0.00 3.68
1035 1472 2.952310 AGAAGTGGGAACTTGAGCAAAC 59.048 45.455 0.00 0.00 0.00 2.93
1036 1473 2.435372 AGTGGGAACTTGAGCAAACA 57.565 45.000 0.00 0.00 0.00 2.83
1037 1474 2.733956 AGTGGGAACTTGAGCAAACAA 58.266 42.857 0.00 0.00 0.00 2.83
1044 1481 1.843992 CTTGAGCAAACAAGCACCAC 58.156 50.000 0.00 0.00 40.24 4.16
1045 1482 1.134753 CTTGAGCAAACAAGCACCACA 59.865 47.619 0.00 0.00 40.24 4.17
1046 1483 0.740149 TGAGCAAACAAGCACCACAG 59.260 50.000 0.00 0.00 36.85 3.66
1047 1484 0.595825 GAGCAAACAAGCACCACAGC 60.596 55.000 0.00 0.00 36.85 4.40
1049 1486 0.667993 GCAAACAAGCACCACAGCTA 59.332 50.000 0.00 0.00 45.89 3.32
1050 1487 1.335324 GCAAACAAGCACCACAGCTAG 60.335 52.381 0.00 0.00 45.89 3.42
1051 1488 1.949525 CAAACAAGCACCACAGCTAGT 59.050 47.619 0.00 0.00 45.89 2.57
1052 1489 2.348411 AACAAGCACCACAGCTAGTT 57.652 45.000 0.00 0.00 45.89 2.24
1053 1490 3.485463 AACAAGCACCACAGCTAGTTA 57.515 42.857 0.00 0.00 45.89 2.24
1054 1491 3.703001 ACAAGCACCACAGCTAGTTAT 57.297 42.857 0.00 0.00 45.89 1.89
1055 1492 3.600388 ACAAGCACCACAGCTAGTTATC 58.400 45.455 0.00 0.00 45.89 1.75
1056 1493 3.007940 ACAAGCACCACAGCTAGTTATCA 59.992 43.478 0.00 0.00 45.89 2.15
1057 1494 3.981071 AGCACCACAGCTAGTTATCAA 57.019 42.857 0.00 0.00 44.50 2.57
1058 1495 3.866651 AGCACCACAGCTAGTTATCAAG 58.133 45.455 0.00 0.00 44.50 3.02
1059 1496 2.352960 GCACCACAGCTAGTTATCAAGC 59.647 50.000 0.00 0.00 39.08 4.01
1060 1497 2.939103 CACCACAGCTAGTTATCAAGCC 59.061 50.000 0.00 0.00 39.64 4.35
1061 1498 2.840651 ACCACAGCTAGTTATCAAGCCT 59.159 45.455 0.00 0.00 39.64 4.58
1062 1499 4.030913 ACCACAGCTAGTTATCAAGCCTA 58.969 43.478 0.00 0.00 39.64 3.93
1063 1500 4.656112 ACCACAGCTAGTTATCAAGCCTAT 59.344 41.667 0.00 0.00 39.64 2.57
1064 1501 5.839063 ACCACAGCTAGTTATCAAGCCTATA 59.161 40.000 0.00 0.00 39.64 1.31
1065 1502 6.159988 CCACAGCTAGTTATCAAGCCTATAC 58.840 44.000 0.00 0.00 39.64 1.47
1066 1503 6.159988 CACAGCTAGTTATCAAGCCTATACC 58.840 44.000 0.00 0.00 39.64 2.73
1067 1504 6.015010 CACAGCTAGTTATCAAGCCTATACCT 60.015 42.308 0.00 0.00 39.64 3.08
1068 1505 6.209788 ACAGCTAGTTATCAAGCCTATACCTC 59.790 42.308 0.00 0.00 39.64 3.85
1069 1506 5.717654 AGCTAGTTATCAAGCCTATACCTCC 59.282 44.000 0.00 0.00 39.64 4.30
1070 1507 5.717654 GCTAGTTATCAAGCCTATACCTCCT 59.282 44.000 0.00 0.00 32.40 3.69
1071 1508 6.890814 GCTAGTTATCAAGCCTATACCTCCTA 59.109 42.308 0.00 0.00 32.40 2.94
1072 1509 7.562088 GCTAGTTATCAAGCCTATACCTCCTAT 59.438 40.741 0.00 0.00 32.40 2.57
1075 1512 9.839185 AGTTATCAAGCCTATACCTCCTATAAA 57.161 33.333 0.00 0.00 0.00 1.40
1078 1515 8.974292 ATCAAGCCTATACCTCCTATAAAGAA 57.026 34.615 0.00 0.00 0.00 2.52
1079 1516 8.792830 TCAAGCCTATACCTCCTATAAAGAAA 57.207 34.615 0.00 0.00 0.00 2.52
1080 1517 9.220906 TCAAGCCTATACCTCCTATAAAGAAAA 57.779 33.333 0.00 0.00 0.00 2.29
1081 1518 9.847224 CAAGCCTATACCTCCTATAAAGAAAAA 57.153 33.333 0.00 0.00 0.00 1.94
1108 1545 9.821240 AAGATATCAAGCCTATAGAGAAGAAGA 57.179 33.333 5.32 0.00 0.00 2.87
1109 1546 9.466497 AGATATCAAGCCTATAGAGAAGAAGAG 57.534 37.037 5.32 0.00 0.00 2.85
1110 1547 5.782893 TCAAGCCTATAGAGAAGAAGAGC 57.217 43.478 0.00 0.00 0.00 4.09
1111 1548 4.277174 TCAAGCCTATAGAGAAGAAGAGCG 59.723 45.833 0.00 0.00 0.00 5.03
1112 1549 3.153919 AGCCTATAGAGAAGAAGAGCGG 58.846 50.000 0.00 0.00 0.00 5.52
1113 1550 2.230266 GCCTATAGAGAAGAAGAGCGGG 59.770 54.545 0.00 0.00 0.00 6.13
1114 1551 2.230266 CCTATAGAGAAGAAGAGCGGGC 59.770 54.545 0.00 0.00 0.00 6.13
1115 1552 0.671251 ATAGAGAAGAAGAGCGGGCG 59.329 55.000 0.00 0.00 0.00 6.13
1116 1553 0.393944 TAGAGAAGAAGAGCGGGCGA 60.394 55.000 0.00 0.00 0.00 5.54
1117 1554 1.517475 GAGAAGAAGAGCGGGCGAC 60.517 63.158 0.00 0.00 0.00 5.19
1118 1555 2.214181 GAGAAGAAGAGCGGGCGACA 62.214 60.000 0.00 0.00 0.00 4.35
1119 1556 1.153549 GAAGAAGAGCGGGCGACAT 60.154 57.895 0.00 0.00 0.00 3.06
1120 1557 1.424493 GAAGAAGAGCGGGCGACATG 61.424 60.000 0.00 0.00 0.00 3.21
1121 1558 3.567797 GAAGAGCGGGCGACATGC 61.568 66.667 0.00 0.00 45.38 4.06
1130 1567 2.890474 GCGACATGCCGGTGGTAG 60.890 66.667 1.90 0.48 37.76 3.18
1131 1568 2.889617 CGACATGCCGGTGGTAGA 59.110 61.111 1.90 0.00 0.00 2.59
1132 1569 1.226974 CGACATGCCGGTGGTAGAG 60.227 63.158 1.90 0.00 0.00 2.43
1133 1570 1.521681 GACATGCCGGTGGTAGAGC 60.522 63.158 1.90 0.00 0.00 4.09
1134 1571 1.961180 GACATGCCGGTGGTAGAGCT 61.961 60.000 1.90 0.00 0.00 4.09
1135 1572 1.221840 CATGCCGGTGGTAGAGCTT 59.778 57.895 1.90 0.00 0.00 3.74
1136 1573 0.811616 CATGCCGGTGGTAGAGCTTC 60.812 60.000 1.90 0.00 0.00 3.86
1137 1574 1.972660 ATGCCGGTGGTAGAGCTTCC 61.973 60.000 1.90 0.00 0.00 3.46
1138 1575 2.901042 CCGGTGGTAGAGCTTCCC 59.099 66.667 0.00 0.00 0.00 3.97
1139 1576 1.987855 CCGGTGGTAGAGCTTCCCA 60.988 63.158 0.00 0.00 0.00 4.37
1140 1577 1.517832 CGGTGGTAGAGCTTCCCAG 59.482 63.158 0.62 0.00 0.00 4.45
1149 1586 3.885521 GCTTCCCAGCTGCATCGC 61.886 66.667 8.66 4.33 43.51 4.58
1150 1587 2.124819 CTTCCCAGCTGCATCGCT 60.125 61.111 8.66 0.00 41.90 4.93
1151 1588 2.124983 TTCCCAGCTGCATCGCTC 60.125 61.111 8.66 0.00 38.41 5.03
1152 1589 2.590391 CTTCCCAGCTGCATCGCTCT 62.590 60.000 8.66 0.00 38.41 4.09
1153 1590 2.864378 TTCCCAGCTGCATCGCTCTG 62.864 60.000 8.66 0.00 38.41 3.35
1154 1591 2.125229 CCAGCTGCATCGCTCTGT 60.125 61.111 8.66 0.00 38.41 3.41
1155 1592 2.461945 CCAGCTGCATCGCTCTGTG 61.462 63.158 8.66 0.00 38.41 3.66
1156 1593 2.818714 AGCTGCATCGCTCTGTGC 60.819 61.111 1.02 0.00 41.61 4.57
1157 1594 2.818714 GCTGCATCGCTCTGTGCT 60.819 61.111 0.00 0.00 41.78 4.40
1158 1595 2.811066 GCTGCATCGCTCTGTGCTC 61.811 63.158 0.00 0.00 41.78 4.26
1159 1596 2.507769 TGCATCGCTCTGTGCTCG 60.508 61.111 0.00 0.00 41.78 5.03
1160 1597 3.922893 GCATCGCTCTGTGCTCGC 61.923 66.667 0.00 0.00 40.11 5.03
1161 1598 2.507769 CATCGCTCTGTGCTCGCA 60.508 61.111 0.00 0.00 40.11 5.10
1162 1599 2.202716 ATCGCTCTGTGCTCGCAG 60.203 61.111 4.17 4.17 40.11 5.18
1163 1600 2.704808 ATCGCTCTGTGCTCGCAGA 61.705 57.895 12.00 12.00 42.56 4.26
1175 1612 2.901975 TCGCAGAGTAATGGCTCCT 58.098 52.632 0.00 0.00 36.20 3.69
1176 1613 2.067365 TCGCAGAGTAATGGCTCCTA 57.933 50.000 0.00 0.00 36.20 2.94
1177 1614 1.681793 TCGCAGAGTAATGGCTCCTAC 59.318 52.381 0.00 0.00 36.20 3.18
1178 1615 1.269831 CGCAGAGTAATGGCTCCTACC 60.270 57.143 0.00 0.00 36.20 3.18
1179 1616 2.043227 GCAGAGTAATGGCTCCTACCT 58.957 52.381 0.00 0.00 36.20 3.08
1180 1617 2.224161 GCAGAGTAATGGCTCCTACCTG 60.224 54.545 0.00 0.00 36.20 4.00
1181 1618 2.043227 AGAGTAATGGCTCCTACCTGC 58.957 52.381 0.00 0.00 36.20 4.85
1182 1619 0.753262 AGTAATGGCTCCTACCTGCG 59.247 55.000 0.00 0.00 0.00 5.18
1183 1620 0.880718 GTAATGGCTCCTACCTGCGC 60.881 60.000 0.00 0.00 0.00 6.09
1184 1621 1.048724 TAATGGCTCCTACCTGCGCT 61.049 55.000 9.73 0.00 0.00 5.92
1185 1622 1.048724 AATGGCTCCTACCTGCGCTA 61.049 55.000 9.73 0.00 0.00 4.26
1186 1623 0.833834 ATGGCTCCTACCTGCGCTAT 60.834 55.000 9.73 0.00 0.00 2.97
1187 1624 1.005630 GGCTCCTACCTGCGCTATG 60.006 63.158 9.73 0.00 0.00 2.23
1188 1625 1.742768 GCTCCTACCTGCGCTATGT 59.257 57.895 9.73 5.56 0.00 2.29
1189 1626 0.598680 GCTCCTACCTGCGCTATGTG 60.599 60.000 9.73 0.00 0.00 3.21
1190 1627 0.598680 CTCCTACCTGCGCTATGTGC 60.599 60.000 9.73 0.00 39.75 4.57
1192 1629 1.154205 CCTACCTGCGCTATGTGCAC 61.154 60.000 10.75 10.75 44.36 4.57
1193 1630 1.482621 CTACCTGCGCTATGTGCACG 61.483 60.000 13.13 0.02 44.36 5.34
1194 1631 1.939769 TACCTGCGCTATGTGCACGA 61.940 55.000 13.13 1.26 44.36 4.35
1195 1632 2.520039 CCTGCGCTATGTGCACGAG 61.520 63.158 13.13 13.03 44.36 4.18
1196 1633 3.147889 CTGCGCTATGTGCACGAGC 62.148 63.158 25.93 25.93 44.36 5.03
1208 1645 3.705502 ACGAGCATGGTGAGAGCT 58.294 55.556 0.00 0.00 42.17 4.09
1209 1646 1.978473 ACGAGCATGGTGAGAGCTT 59.022 52.632 0.00 0.00 39.02 3.74
1210 1647 0.108424 ACGAGCATGGTGAGAGCTTC 60.108 55.000 0.00 0.00 39.02 3.86
1211 1648 0.108472 CGAGCATGGTGAGAGCTTCA 60.108 55.000 0.00 0.00 39.02 3.02
1212 1649 1.654317 GAGCATGGTGAGAGCTTCAG 58.346 55.000 0.00 0.00 39.02 3.02
1213 1650 0.252479 AGCATGGTGAGAGCTTCAGG 59.748 55.000 0.00 0.00 36.21 3.86
1214 1651 1.375098 GCATGGTGAGAGCTTCAGGC 61.375 60.000 0.00 0.00 36.21 4.85
1215 1652 0.035725 CATGGTGAGAGCTTCAGGCA 60.036 55.000 0.00 0.00 44.79 4.75
1216 1653 0.694771 ATGGTGAGAGCTTCAGGCAA 59.305 50.000 0.00 0.00 44.79 4.52
1217 1654 0.250467 TGGTGAGAGCTTCAGGCAAC 60.250 55.000 0.00 0.00 44.79 4.17
1229 1666 2.253452 GGCAACTGCAGCTCAACG 59.747 61.111 15.27 0.00 44.36 4.10
1230 1667 2.253452 GCAACTGCAGCTCAACGG 59.747 61.111 15.27 0.00 41.59 4.44
1231 1668 2.253452 CAACTGCAGCTCAACGGC 59.747 61.111 15.27 0.00 40.28 5.68
1235 1672 2.979676 TGCAGCTCAACGGCAAGG 60.980 61.111 0.00 0.00 46.96 3.61
1236 1673 2.669569 GCAGCTCAACGGCAAGGA 60.670 61.111 0.00 0.00 39.55 3.36
1237 1674 2.970974 GCAGCTCAACGGCAAGGAC 61.971 63.158 0.00 0.00 39.55 3.85
1238 1675 2.357517 AGCTCAACGGCAAGGACG 60.358 61.111 0.00 0.00 41.40 4.79
1239 1676 4.090057 GCTCAACGGCAAGGACGC 62.090 66.667 0.00 0.00 37.73 5.19
1248 1685 1.807226 GCAAGGACGCCATTAACCC 59.193 57.895 0.00 0.00 0.00 4.11
1249 1686 1.663379 GCAAGGACGCCATTAACCCC 61.663 60.000 0.00 0.00 0.00 4.95
1250 1687 0.034477 CAAGGACGCCATTAACCCCT 60.034 55.000 0.00 0.00 0.00 4.79
1251 1688 1.210967 CAAGGACGCCATTAACCCCTA 59.789 52.381 0.00 0.00 0.00 3.53
1252 1689 0.835276 AGGACGCCATTAACCCCTAC 59.165 55.000 0.00 0.00 0.00 3.18
1253 1690 0.542805 GGACGCCATTAACCCCTACA 59.457 55.000 0.00 0.00 0.00 2.74
1254 1691 1.660167 GACGCCATTAACCCCTACAC 58.340 55.000 0.00 0.00 0.00 2.90
1255 1692 0.253894 ACGCCATTAACCCCTACACC 59.746 55.000 0.00 0.00 0.00 4.16
1256 1693 0.253610 CGCCATTAACCCCTACACCA 59.746 55.000 0.00 0.00 0.00 4.17
1257 1694 1.745827 CGCCATTAACCCCTACACCAG 60.746 57.143 0.00 0.00 0.00 4.00
1258 1695 1.409661 GCCATTAACCCCTACACCAGG 60.410 57.143 0.00 0.00 45.07 4.45
1259 1696 1.920351 CCATTAACCCCTACACCAGGT 59.080 52.381 0.00 0.00 43.80 4.00
1260 1697 3.116959 CCATTAACCCCTACACCAGGTA 58.883 50.000 0.00 0.00 43.80 3.08
1261 1698 3.118149 CCATTAACCCCTACACCAGGTAC 60.118 52.174 0.00 0.00 43.80 3.34
1262 1699 1.851304 TAACCCCTACACCAGGTACG 58.149 55.000 0.00 0.00 43.80 3.67
1263 1700 0.114954 AACCCCTACACCAGGTACGA 59.885 55.000 0.00 0.00 43.80 3.43
1264 1701 0.613012 ACCCCTACACCAGGTACGAC 60.613 60.000 0.00 0.00 43.80 4.34
1265 1702 1.660560 CCCCTACACCAGGTACGACG 61.661 65.000 0.00 0.00 43.80 5.12
1266 1703 0.962356 CCCTACACCAGGTACGACGT 60.962 60.000 5.52 5.52 43.80 4.34
1267 1704 0.449388 CCTACACCAGGTACGACGTC 59.551 60.000 2.43 5.18 39.91 4.34
1268 1705 0.095935 CTACACCAGGTACGACGTCG 59.904 60.000 34.58 34.58 46.33 5.12
1269 1706 0.320334 TACACCAGGTACGACGTCGA 60.320 55.000 41.52 23.28 43.02 4.20
1270 1707 1.134075 CACCAGGTACGACGTCGAG 59.866 63.158 41.52 23.71 43.02 4.04
1271 1708 2.037136 ACCAGGTACGACGTCGAGG 61.037 63.158 41.52 31.21 43.02 4.63
1272 1709 2.037136 CCAGGTACGACGTCGAGGT 61.037 63.158 41.52 23.51 43.02 3.85
1273 1710 0.740868 CCAGGTACGACGTCGAGGTA 60.741 60.000 41.52 22.41 43.02 3.08
1274 1711 1.293924 CAGGTACGACGTCGAGGTAT 58.706 55.000 41.52 22.75 43.02 2.73
1275 1712 1.260033 CAGGTACGACGTCGAGGTATC 59.740 57.143 41.52 24.35 43.02 2.24
1285 1722 3.626924 GAGGTATCGCGGGGCCAT 61.627 66.667 6.13 0.00 0.00 4.40
1286 1723 2.203728 AGGTATCGCGGGGCCATA 60.204 61.111 6.13 0.00 0.00 2.74
1287 1724 1.823169 GAGGTATCGCGGGGCCATAA 61.823 60.000 6.13 0.00 0.00 1.90
1288 1725 1.670083 GGTATCGCGGGGCCATAAC 60.670 63.158 6.13 0.00 0.00 1.89
1289 1726 2.025418 GTATCGCGGGGCCATAACG 61.025 63.158 6.13 4.34 0.00 3.18
1290 1727 3.229156 TATCGCGGGGCCATAACGG 62.229 63.158 6.13 0.00 38.11 4.44
1312 1749 4.408821 GGCCTGGTGCACATCCGA 62.409 66.667 20.43 0.00 43.89 4.55
1313 1750 2.124570 GCCTGGTGCACATCCGAT 60.125 61.111 20.43 0.00 40.77 4.18
1314 1751 2.475466 GCCTGGTGCACATCCGATG 61.475 63.158 20.43 6.84 40.77 3.84
1315 1752 2.475466 CCTGGTGCACATCCGATGC 61.475 63.158 20.43 0.00 43.68 3.91
1316 1753 2.438254 TGGTGCACATCCGATGCC 60.438 61.111 20.43 2.37 42.69 4.40
1317 1754 3.576356 GGTGCACATCCGATGCCG 61.576 66.667 20.43 1.41 42.69 5.69
1318 1755 4.241999 GTGCACATCCGATGCCGC 62.242 66.667 13.17 11.59 42.69 6.53
1319 1756 4.471908 TGCACATCCGATGCCGCT 62.472 61.111 19.00 0.00 42.69 5.52
1320 1757 2.280119 GCACATCCGATGCCGCTA 60.280 61.111 8.36 0.00 37.08 4.26
1321 1758 2.598632 GCACATCCGATGCCGCTAC 61.599 63.158 8.36 0.00 37.08 3.58
1322 1759 1.227234 CACATCCGATGCCGCTACA 60.227 57.895 8.36 0.00 0.00 2.74
1323 1760 0.809636 CACATCCGATGCCGCTACAA 60.810 55.000 8.36 0.00 0.00 2.41
1324 1761 0.810031 ACATCCGATGCCGCTACAAC 60.810 55.000 8.36 0.00 0.00 3.32
1325 1762 1.227556 ATCCGATGCCGCTACAACC 60.228 57.895 0.00 0.00 0.00 3.77
1326 1763 2.971428 ATCCGATGCCGCTACAACCG 62.971 60.000 0.00 0.00 0.00 4.44
1327 1764 2.508439 CGATGCCGCTACAACCGT 60.508 61.111 0.00 0.00 0.00 4.83
1328 1765 1.226745 CGATGCCGCTACAACCGTA 60.227 57.895 0.00 0.00 0.00 4.02
1329 1766 0.802994 CGATGCCGCTACAACCGTAA 60.803 55.000 0.00 0.00 0.00 3.18
1330 1767 0.928229 GATGCCGCTACAACCGTAAG 59.072 55.000 0.00 0.00 0.00 2.34
1331 1768 0.248289 ATGCCGCTACAACCGTAAGT 59.752 50.000 0.00 0.00 0.00 2.24
1332 1769 0.887247 TGCCGCTACAACCGTAAGTA 59.113 50.000 0.00 0.00 0.00 2.24
1333 1770 1.271876 GCCGCTACAACCGTAAGTAC 58.728 55.000 0.00 0.00 0.00 2.73
1334 1771 1.135286 GCCGCTACAACCGTAAGTACT 60.135 52.381 0.00 0.00 0.00 2.73
1335 1772 2.523015 CCGCTACAACCGTAAGTACTG 58.477 52.381 0.00 0.00 0.00 2.74
1336 1773 2.523015 CGCTACAACCGTAAGTACTGG 58.477 52.381 0.00 0.00 0.00 4.00
1337 1774 2.733227 CGCTACAACCGTAAGTACTGGG 60.733 54.545 0.00 0.83 0.00 4.45
1338 1775 2.232208 GCTACAACCGTAAGTACTGGGT 59.768 50.000 0.00 1.55 0.00 4.51
1339 1776 2.825861 ACAACCGTAAGTACTGGGTG 57.174 50.000 12.97 12.97 40.70 4.61
1340 1777 1.345415 ACAACCGTAAGTACTGGGTGG 59.655 52.381 17.54 14.61 39.87 4.61
1341 1778 0.322648 AACCGTAAGTACTGGGTGGC 59.677 55.000 12.71 0.00 31.96 5.01
1342 1779 0.543646 ACCGTAAGTACTGGGTGGCT 60.544 55.000 11.54 0.00 0.00 4.75
1343 1780 0.175073 CCGTAAGTACTGGGTGGCTC 59.825 60.000 0.00 0.00 0.00 4.70
1344 1781 0.179145 CGTAAGTACTGGGTGGCTCG 60.179 60.000 0.00 0.00 0.00 5.03
1345 1782 0.893447 GTAAGTACTGGGTGGCTCGT 59.107 55.000 0.00 0.00 0.00 4.18
1346 1783 1.135170 GTAAGTACTGGGTGGCTCGTC 60.135 57.143 0.00 0.00 0.00 4.20
1347 1784 0.830444 AAGTACTGGGTGGCTCGTCA 60.830 55.000 0.00 0.00 0.00 4.35
1348 1785 1.215647 GTACTGGGTGGCTCGTCAG 59.784 63.158 6.89 6.89 0.00 3.51
1349 1786 2.646175 TACTGGGTGGCTCGTCAGC 61.646 63.158 7.96 0.00 46.06 4.26
1369 1806 2.585247 GGCGACGCCTGGTGTATC 60.585 66.667 31.30 7.78 46.69 2.24
1370 1807 2.954868 GCGACGCCTGGTGTATCG 60.955 66.667 13.78 14.42 0.00 2.92
1371 1808 2.954868 CGACGCCTGGTGTATCGC 60.955 66.667 13.78 0.00 0.00 4.58
1372 1809 2.585247 GACGCCTGGTGTATCGCC 60.585 66.667 13.78 0.00 34.12 5.54
1373 1810 4.508128 ACGCCTGGTGTATCGCCG 62.508 66.667 11.96 0.00 36.72 6.46
1392 1829 4.193334 CGACGCAGATGAGCCGGA 62.193 66.667 5.05 0.00 0.00 5.14
1393 1830 2.184322 GACGCAGATGAGCCGGAA 59.816 61.111 5.05 0.00 0.00 4.30
1394 1831 1.880340 GACGCAGATGAGCCGGAAG 60.880 63.158 5.05 0.00 0.00 3.46
1395 1832 2.284798 GACGCAGATGAGCCGGAAGA 62.285 60.000 5.05 0.00 0.00 2.87
1396 1833 1.153568 CGCAGATGAGCCGGAAGAA 60.154 57.895 5.05 0.00 0.00 2.52
1397 1834 1.150567 CGCAGATGAGCCGGAAGAAG 61.151 60.000 5.05 0.00 0.00 2.85
1398 1835 0.176680 GCAGATGAGCCGGAAGAAGA 59.823 55.000 5.05 0.00 0.00 2.87
1399 1836 1.933247 CAGATGAGCCGGAAGAAGAC 58.067 55.000 5.05 0.00 0.00 3.01
1400 1837 0.827368 AGATGAGCCGGAAGAAGACC 59.173 55.000 5.05 0.00 0.00 3.85
1401 1838 0.827368 GATGAGCCGGAAGAAGACCT 59.173 55.000 5.05 0.00 0.00 3.85
1402 1839 0.539051 ATGAGCCGGAAGAAGACCTG 59.461 55.000 5.05 0.00 0.00 4.00
1403 1840 0.541998 TGAGCCGGAAGAAGACCTGA 60.542 55.000 5.05 0.00 0.00 3.86
1404 1841 0.108567 GAGCCGGAAGAAGACCTGAC 60.109 60.000 5.05 0.00 0.00 3.51
1405 1842 1.079057 GCCGGAAGAAGACCTGACC 60.079 63.158 5.05 0.00 0.00 4.02
1406 1843 1.827399 GCCGGAAGAAGACCTGACCA 61.827 60.000 5.05 0.00 0.00 4.02
1407 1844 0.685097 CCGGAAGAAGACCTGACCAA 59.315 55.000 0.00 0.00 0.00 3.67
1408 1845 1.608283 CCGGAAGAAGACCTGACCAAC 60.608 57.143 0.00 0.00 0.00 3.77
1409 1846 1.608283 CGGAAGAAGACCTGACCAACC 60.608 57.143 0.00 0.00 0.00 3.77
1410 1847 1.271434 GGAAGAAGACCTGACCAACCC 60.271 57.143 0.00 0.00 0.00 4.11
1411 1848 0.771755 AAGAAGACCTGACCAACCCC 59.228 55.000 0.00 0.00 0.00 4.95
1412 1849 0.401395 AGAAGACCTGACCAACCCCA 60.401 55.000 0.00 0.00 0.00 4.96
1413 1850 0.476771 GAAGACCTGACCAACCCCAA 59.523 55.000 0.00 0.00 0.00 4.12
1414 1851 1.075536 GAAGACCTGACCAACCCCAAT 59.924 52.381 0.00 0.00 0.00 3.16
1415 1852 1.158007 AGACCTGACCAACCCCAATT 58.842 50.000 0.00 0.00 0.00 2.32
1416 1853 1.203050 AGACCTGACCAACCCCAATTG 60.203 52.381 0.00 0.00 0.00 2.32
1417 1854 0.831711 ACCTGACCAACCCCAATTGC 60.832 55.000 0.00 0.00 0.00 3.56
1418 1855 0.831288 CCTGACCAACCCCAATTGCA 60.831 55.000 0.00 0.00 0.00 4.08
1419 1856 0.318120 CTGACCAACCCCAATTGCAC 59.682 55.000 0.00 0.00 0.00 4.57
1420 1857 0.105760 TGACCAACCCCAATTGCACT 60.106 50.000 0.00 0.00 0.00 4.40
1421 1858 0.603065 GACCAACCCCAATTGCACTC 59.397 55.000 0.00 0.00 0.00 3.51
1422 1859 0.188342 ACCAACCCCAATTGCACTCT 59.812 50.000 0.00 0.00 0.00 3.24
1423 1860 0.604578 CCAACCCCAATTGCACTCTG 59.395 55.000 0.00 0.00 0.00 3.35
1424 1861 1.619654 CAACCCCAATTGCACTCTGA 58.380 50.000 0.00 0.00 0.00 3.27
1425 1862 2.173519 CAACCCCAATTGCACTCTGAT 58.826 47.619 0.00 0.00 0.00 2.90
1426 1863 2.564062 CAACCCCAATTGCACTCTGATT 59.436 45.455 0.00 0.00 0.00 2.57
1427 1864 3.737559 ACCCCAATTGCACTCTGATTA 57.262 42.857 0.00 0.00 0.00 1.75
1428 1865 4.046286 ACCCCAATTGCACTCTGATTAA 57.954 40.909 0.00 0.00 0.00 1.40
1429 1866 4.415596 ACCCCAATTGCACTCTGATTAAA 58.584 39.130 0.00 0.00 0.00 1.52
1430 1867 4.220602 ACCCCAATTGCACTCTGATTAAAC 59.779 41.667 0.00 0.00 0.00 2.01
1431 1868 4.381932 CCCCAATTGCACTCTGATTAAACC 60.382 45.833 0.00 0.00 0.00 3.27
1432 1869 4.220382 CCCAATTGCACTCTGATTAAACCA 59.780 41.667 0.00 0.00 0.00 3.67
1433 1870 5.279406 CCCAATTGCACTCTGATTAAACCAA 60.279 40.000 0.00 0.00 0.00 3.67
1434 1871 6.400568 CCAATTGCACTCTGATTAAACCAAT 58.599 36.000 0.00 0.00 0.00 3.16
1435 1872 6.532657 CCAATTGCACTCTGATTAAACCAATC 59.467 38.462 0.00 0.00 43.01 2.67
1445 1882 6.907853 TGATTAAACCAATCATTGTCACCA 57.092 33.333 0.00 0.00 46.48 4.17
1446 1883 6.686630 TGATTAAACCAATCATTGTCACCAC 58.313 36.000 0.00 0.00 46.48 4.16
1447 1884 5.461032 TTAAACCAATCATTGTCACCACC 57.539 39.130 0.00 0.00 0.00 4.61
1448 1885 2.673775 ACCAATCATTGTCACCACCA 57.326 45.000 0.00 0.00 0.00 4.17
1449 1886 2.238521 ACCAATCATTGTCACCACCAC 58.761 47.619 0.00 0.00 0.00 4.16
1450 1887 2.158475 ACCAATCATTGTCACCACCACT 60.158 45.455 0.00 0.00 0.00 4.00
1451 1888 2.229543 CCAATCATTGTCACCACCACTG 59.770 50.000 0.00 0.00 0.00 3.66
1452 1889 3.148412 CAATCATTGTCACCACCACTGA 58.852 45.455 0.00 0.00 0.00 3.41
1453 1890 3.726557 ATCATTGTCACCACCACTGAT 57.273 42.857 0.00 0.00 30.17 2.90
1454 1891 2.781923 TCATTGTCACCACCACTGATG 58.218 47.619 0.00 0.00 0.00 3.07
1455 1892 2.371510 TCATTGTCACCACCACTGATGA 59.628 45.455 0.00 0.00 0.00 2.92
1456 1893 2.254546 TTGTCACCACCACTGATGAC 57.745 50.000 0.00 0.00 41.51 3.06
1457 1894 1.127343 TGTCACCACCACTGATGACA 58.873 50.000 1.91 1.91 46.92 3.58
1458 1895 1.070601 TGTCACCACCACTGATGACAG 59.929 52.381 1.91 0.00 44.88 3.51
1469 1906 2.274437 CTGATGACAGTGGTGAATCCG 58.726 52.381 0.00 0.00 39.11 4.18
1470 1907 1.623311 TGATGACAGTGGTGAATCCGT 59.377 47.619 0.00 0.00 39.52 4.69
1471 1908 2.002586 GATGACAGTGGTGAATCCGTG 58.997 52.381 0.00 0.00 39.52 4.94
1472 1909 1.044611 TGACAGTGGTGAATCCGTGA 58.955 50.000 0.00 0.00 39.52 4.35
1473 1910 1.623311 TGACAGTGGTGAATCCGTGAT 59.377 47.619 0.00 0.00 39.52 3.06
1474 1911 2.002586 GACAGTGGTGAATCCGTGATG 58.997 52.381 0.00 0.00 39.52 3.07
1475 1912 1.623311 ACAGTGGTGAATCCGTGATGA 59.377 47.619 0.00 0.00 39.52 2.92
1476 1913 2.002586 CAGTGGTGAATCCGTGATGAC 58.997 52.381 0.00 0.00 39.52 3.06
1477 1914 1.066143 AGTGGTGAATCCGTGATGACC 60.066 52.381 0.00 0.00 39.52 4.02
1478 1915 0.108377 TGGTGAATCCGTGATGACCG 60.108 55.000 0.00 0.00 39.52 4.79
1479 1916 0.108329 GGTGAATCCGTGATGACCGT 60.108 55.000 0.00 0.00 0.00 4.83
1480 1917 1.674817 GGTGAATCCGTGATGACCGTT 60.675 52.381 0.00 0.00 0.00 4.44
1481 1918 1.659098 GTGAATCCGTGATGACCGTTC 59.341 52.381 0.00 0.00 0.00 3.95
1482 1919 0.921347 GAATCCGTGATGACCGTTCG 59.079 55.000 0.00 0.00 0.00 3.95
1483 1920 0.459585 AATCCGTGATGACCGTTCGG 60.460 55.000 9.81 9.81 42.12 4.30
1484 1921 1.601419 ATCCGTGATGACCGTTCGGT 61.601 55.000 16.91 16.91 41.58 4.69
1485 1922 1.373748 CCGTGATGACCGTTCGGTT 60.374 57.895 17.90 3.27 38.85 4.44
1486 1923 0.109179 CCGTGATGACCGTTCGGTTA 60.109 55.000 17.90 14.34 38.85 2.85
1487 1924 1.265568 CGTGATGACCGTTCGGTTAG 58.734 55.000 17.90 0.00 38.85 2.34
1488 1925 1.401931 CGTGATGACCGTTCGGTTAGT 60.402 52.381 17.90 7.45 38.85 2.24
1489 1926 2.159531 CGTGATGACCGTTCGGTTAGTA 60.160 50.000 17.90 4.94 38.85 1.82
1490 1927 3.174375 GTGATGACCGTTCGGTTAGTAC 58.826 50.000 17.90 12.45 38.85 2.73
1491 1928 2.164219 TGATGACCGTTCGGTTAGTACC 59.836 50.000 17.90 5.11 38.85 3.34
1492 1929 1.614996 TGACCGTTCGGTTAGTACCA 58.385 50.000 17.90 7.60 45.31 3.25
1493 1930 1.269448 TGACCGTTCGGTTAGTACCAC 59.731 52.381 17.90 3.74 45.31 4.16
1494 1931 1.541588 GACCGTTCGGTTAGTACCACT 59.458 52.381 17.90 0.00 45.31 4.00
1495 1932 1.963515 ACCGTTCGGTTAGTACCACTT 59.036 47.619 11.27 0.00 45.31 3.16
1496 1933 2.288395 ACCGTTCGGTTAGTACCACTTG 60.288 50.000 11.27 0.00 45.31 3.16
1497 1934 2.030007 CCGTTCGGTTAGTACCACTTGA 60.030 50.000 2.82 0.00 45.31 3.02
1498 1935 3.367703 CCGTTCGGTTAGTACCACTTGAT 60.368 47.826 2.82 0.00 45.31 2.57
1499 1936 4.142403 CCGTTCGGTTAGTACCACTTGATA 60.142 45.833 2.82 0.00 45.31 2.15
1500 1937 5.450965 CCGTTCGGTTAGTACCACTTGATAT 60.451 44.000 2.82 0.00 45.31 1.63
1501 1938 6.038356 CGTTCGGTTAGTACCACTTGATATT 58.962 40.000 0.00 0.00 45.31 1.28
1502 1939 7.195646 CGTTCGGTTAGTACCACTTGATATTA 58.804 38.462 0.00 0.00 45.31 0.98
1503 1940 7.166473 CGTTCGGTTAGTACCACTTGATATTAC 59.834 40.741 0.00 0.00 45.31 1.89
1504 1941 7.886629 TCGGTTAGTACCACTTGATATTACT 57.113 36.000 0.00 0.00 45.31 2.24
1505 1942 7.934457 TCGGTTAGTACCACTTGATATTACTC 58.066 38.462 0.00 0.00 45.31 2.59
1506 1943 7.013655 TCGGTTAGTACCACTTGATATTACTCC 59.986 40.741 0.00 0.00 45.31 3.85
1507 1944 7.440198 GGTTAGTACCACTTGATATTACTCCC 58.560 42.308 0.00 0.00 44.36 4.30
1508 1945 7.289549 GGTTAGTACCACTTGATATTACTCCCT 59.710 40.741 0.00 0.00 44.36 4.20
1509 1946 6.980416 AGTACCACTTGATATTACTCCCTC 57.020 41.667 0.00 0.00 0.00 4.30
1510 1947 5.839606 AGTACCACTTGATATTACTCCCTCC 59.160 44.000 0.00 0.00 0.00 4.30
1511 1948 4.631234 ACCACTTGATATTACTCCCTCCA 58.369 43.478 0.00 0.00 0.00 3.86
1512 1949 5.227593 ACCACTTGATATTACTCCCTCCAT 58.772 41.667 0.00 0.00 0.00 3.41
1513 1950 5.672194 ACCACTTGATATTACTCCCTCCATT 59.328 40.000 0.00 0.00 0.00 3.16
1514 1951 6.183361 ACCACTTGATATTACTCCCTCCATTC 60.183 42.308 0.00 0.00 0.00 2.67
1515 1952 6.234177 CACTTGATATTACTCCCTCCATTCC 58.766 44.000 0.00 0.00 0.00 3.01
1516 1953 6.043706 CACTTGATATTACTCCCTCCATTCCT 59.956 42.308 0.00 0.00 0.00 3.36
1517 1954 7.235606 CACTTGATATTACTCCCTCCATTCCTA 59.764 40.741 0.00 0.00 0.00 2.94
1518 1955 7.794683 ACTTGATATTACTCCCTCCATTCCTAA 59.205 37.037 0.00 0.00 0.00 2.69
1519 1956 8.575736 TTGATATTACTCCCTCCATTCCTAAA 57.424 34.615 0.00 0.00 0.00 1.85
1520 1957 8.757307 TGATATTACTCCCTCCATTCCTAAAT 57.243 34.615 0.00 0.00 0.00 1.40
1521 1958 9.852784 TGATATTACTCCCTCCATTCCTAAATA 57.147 33.333 0.00 0.00 0.00 1.40
1526 1963 7.021998 ACTCCCTCCATTCCTAAATATAAGC 57.978 40.000 0.00 0.00 0.00 3.09
1527 1964 6.012421 ACTCCCTCCATTCCTAAATATAAGCC 60.012 42.308 0.00 0.00 0.00 4.35
1528 1965 6.098446 TCCCTCCATTCCTAAATATAAGCCT 58.902 40.000 0.00 0.00 0.00 4.58
1529 1966 6.566480 TCCCTCCATTCCTAAATATAAGCCTT 59.434 38.462 0.00 0.00 0.00 4.35
1530 1967 7.075009 TCCCTCCATTCCTAAATATAAGCCTTT 59.925 37.037 0.00 0.00 0.00 3.11
1531 1968 7.730332 CCCTCCATTCCTAAATATAAGCCTTTT 59.270 37.037 0.00 0.00 0.00 2.27
1532 1969 9.147732 CCTCCATTCCTAAATATAAGCCTTTTT 57.852 33.333 0.00 0.00 0.00 1.94
1547 1984 7.425577 AAGCCTTTTTAGACATTTCAAATGC 57.574 32.000 10.21 3.49 0.00 3.56
1548 1985 6.523840 AGCCTTTTTAGACATTTCAAATGCA 58.476 32.000 10.21 0.00 0.00 3.96
1549 1986 6.424812 AGCCTTTTTAGACATTTCAAATGCAC 59.575 34.615 10.21 5.06 0.00 4.57
1550 1987 6.424812 GCCTTTTTAGACATTTCAAATGCACT 59.575 34.615 10.21 11.80 0.00 4.40
1551 1988 7.598493 GCCTTTTTAGACATTTCAAATGCACTA 59.402 33.333 10.21 10.89 0.00 2.74
1552 1989 8.915654 CCTTTTTAGACATTTCAAATGCACTAC 58.084 33.333 10.21 0.00 0.00 2.73
1553 1990 9.462174 CTTTTTAGACATTTCAAATGCACTACA 57.538 29.630 10.21 5.16 0.00 2.74
1554 1991 9.809096 TTTTTAGACATTTCAAATGCACTACAA 57.191 25.926 10.21 10.15 0.00 2.41
1555 1992 9.979578 TTTTAGACATTTCAAATGCACTACAAT 57.020 25.926 10.21 0.00 0.00 2.71
1606 2043 6.734104 AGTGTAGATTCACTCATTTTGCTC 57.266 37.500 0.00 0.00 44.07 4.26
1607 2044 5.645497 AGTGTAGATTCACTCATTTTGCTCC 59.355 40.000 0.00 0.00 44.07 4.70
1608 2045 4.631377 TGTAGATTCACTCATTTTGCTCCG 59.369 41.667 0.00 0.00 0.00 4.63
1609 2046 3.679389 AGATTCACTCATTTTGCTCCGT 58.321 40.909 0.00 0.00 0.00 4.69
1610 2047 4.832248 AGATTCACTCATTTTGCTCCGTA 58.168 39.130 0.00 0.00 0.00 4.02
1611 2048 5.431765 AGATTCACTCATTTTGCTCCGTAT 58.568 37.500 0.00 0.00 0.00 3.06
1612 2049 4.944962 TTCACTCATTTTGCTCCGTATG 57.055 40.909 0.00 0.00 0.00 2.39
1613 2050 3.937814 TCACTCATTTTGCTCCGTATGT 58.062 40.909 0.00 0.00 0.00 2.29
1614 2051 5.079689 TCACTCATTTTGCTCCGTATGTA 57.920 39.130 0.00 0.00 0.00 2.29
1615 2052 5.109210 TCACTCATTTTGCTCCGTATGTAG 58.891 41.667 0.00 0.00 0.00 2.74
1616 2053 4.870426 CACTCATTTTGCTCCGTATGTAGT 59.130 41.667 0.00 0.00 0.00 2.73
1617 2054 6.040247 CACTCATTTTGCTCCGTATGTAGTA 58.960 40.000 0.00 0.00 0.00 1.82
1618 2055 6.533723 CACTCATTTTGCTCCGTATGTAGTAA 59.466 38.462 0.00 0.00 0.00 2.24
1619 2056 6.534079 ACTCATTTTGCTCCGTATGTAGTAAC 59.466 38.462 0.00 0.00 0.00 2.50
1620 2057 5.813672 TCATTTTGCTCCGTATGTAGTAACC 59.186 40.000 0.00 0.00 0.00 2.85
1621 2058 5.410355 TTTTGCTCCGTATGTAGTAACCT 57.590 39.130 0.00 0.00 0.00 3.50
1622 2059 4.380841 TTGCTCCGTATGTAGTAACCTG 57.619 45.455 0.00 0.00 0.00 4.00
1623 2060 3.359033 TGCTCCGTATGTAGTAACCTGT 58.641 45.455 0.00 0.00 0.00 4.00
1624 2061 3.765511 TGCTCCGTATGTAGTAACCTGTT 59.234 43.478 0.00 0.00 0.00 3.16
1625 2062 4.110482 GCTCCGTATGTAGTAACCTGTTG 58.890 47.826 0.00 0.00 0.00 3.33
1626 2063 4.679662 CTCCGTATGTAGTAACCTGTTGG 58.320 47.826 0.00 0.00 39.83 3.77
1627 2064 4.343231 TCCGTATGTAGTAACCTGTTGGA 58.657 43.478 0.00 0.00 37.04 3.53
1628 2065 4.771577 TCCGTATGTAGTAACCTGTTGGAA 59.228 41.667 0.00 0.00 37.04 3.53
1629 2066 5.422970 TCCGTATGTAGTAACCTGTTGGAAT 59.577 40.000 0.00 0.00 37.04 3.01
1630 2067 6.070653 TCCGTATGTAGTAACCTGTTGGAATT 60.071 38.462 0.00 0.00 37.04 2.17
1631 2068 6.596497 CCGTATGTAGTAACCTGTTGGAATTT 59.404 38.462 0.00 0.00 37.04 1.82
1632 2069 7.201582 CCGTATGTAGTAACCTGTTGGAATTTC 60.202 40.741 0.00 0.00 37.04 2.17
1633 2070 7.548075 CGTATGTAGTAACCTGTTGGAATTTCT 59.452 37.037 0.00 0.00 37.04 2.52
1634 2071 7.687941 ATGTAGTAACCTGTTGGAATTTCTG 57.312 36.000 0.00 0.00 37.04 3.02
1635 2072 6.833041 TGTAGTAACCTGTTGGAATTTCTGA 58.167 36.000 0.00 0.00 37.04 3.27
1636 2073 7.284074 TGTAGTAACCTGTTGGAATTTCTGAA 58.716 34.615 0.00 0.00 37.04 3.02
1637 2074 7.776030 TGTAGTAACCTGTTGGAATTTCTGAAA 59.224 33.333 5.15 5.15 37.04 2.69
1638 2075 7.654022 AGTAACCTGTTGGAATTTCTGAAAA 57.346 32.000 6.95 0.00 37.04 2.29
1639 2076 7.716612 AGTAACCTGTTGGAATTTCTGAAAAG 58.283 34.615 6.95 0.00 37.04 2.27
1640 2077 6.790232 AACCTGTTGGAATTTCTGAAAAGA 57.210 33.333 6.95 0.00 37.04 2.52
1641 2078 6.149129 ACCTGTTGGAATTTCTGAAAAGAC 57.851 37.500 6.95 1.21 37.04 3.01
1642 2079 5.893824 ACCTGTTGGAATTTCTGAAAAGACT 59.106 36.000 6.95 0.00 37.04 3.24
1643 2080 6.381133 ACCTGTTGGAATTTCTGAAAAGACTT 59.619 34.615 6.95 0.00 37.04 3.01
1644 2081 6.920210 CCTGTTGGAATTTCTGAAAAGACTTC 59.080 38.462 6.95 6.33 34.57 3.01
1645 2082 6.805713 TGTTGGAATTTCTGAAAAGACTTCC 58.194 36.000 19.31 19.31 33.67 3.46
1646 2083 6.379703 TGTTGGAATTTCTGAAAAGACTTCCA 59.620 34.615 22.65 22.65 37.74 3.53
1647 2084 7.069826 TGTTGGAATTTCTGAAAAGACTTCCAT 59.930 33.333 25.13 0.45 38.53 3.41
1648 2085 7.601705 TGGAATTTCTGAAAAGACTTCCATT 57.398 32.000 22.65 5.90 36.11 3.16
1649 2086 8.021898 TGGAATTTCTGAAAAGACTTCCATTT 57.978 30.769 22.65 5.32 36.11 2.32
1650 2087 7.927629 TGGAATTTCTGAAAAGACTTCCATTTG 59.072 33.333 22.65 0.00 36.11 2.32
1651 2088 7.386025 GGAATTTCTGAAAAGACTTCCATTTGG 59.614 37.037 20.44 0.00 33.46 3.28
1652 2089 5.789643 TTCTGAAAAGACTTCCATTTGGG 57.210 39.130 0.00 0.00 35.41 4.12
1653 2090 5.060427 TCTGAAAAGACTTCCATTTGGGA 57.940 39.130 0.00 0.00 46.61 4.37
1661 2098 3.662290 TCCATTTGGGAACGGAAGG 57.338 52.632 0.00 0.00 44.80 3.46
1662 2099 1.068948 TCCATTTGGGAACGGAAGGA 58.931 50.000 0.00 0.00 44.80 3.36
1663 2100 1.004277 TCCATTTGGGAACGGAAGGAG 59.996 52.381 0.00 0.00 44.80 3.69
1664 2101 1.271926 CCATTTGGGAACGGAAGGAGT 60.272 52.381 0.00 0.00 40.01 3.85
1665 2102 2.026636 CCATTTGGGAACGGAAGGAGTA 60.027 50.000 0.00 0.00 40.01 2.59
1666 2103 3.371595 CCATTTGGGAACGGAAGGAGTAT 60.372 47.826 0.00 0.00 40.01 2.12
1667 2104 4.270008 CATTTGGGAACGGAAGGAGTATT 58.730 43.478 0.00 0.00 0.00 1.89
1668 2105 5.433526 CATTTGGGAACGGAAGGAGTATTA 58.566 41.667 0.00 0.00 0.00 0.98
1669 2106 5.703730 TTTGGGAACGGAAGGAGTATTAT 57.296 39.130 0.00 0.00 0.00 1.28
1670 2107 6.811634 TTTGGGAACGGAAGGAGTATTATA 57.188 37.500 0.00 0.00 0.00 0.98
1671 2108 5.796424 TGGGAACGGAAGGAGTATTATAC 57.204 43.478 0.00 0.00 0.00 1.47
1672 2109 4.590222 TGGGAACGGAAGGAGTATTATACC 59.410 45.833 0.00 0.00 0.00 2.73
1673 2110 4.590222 GGGAACGGAAGGAGTATTATACCA 59.410 45.833 0.00 0.00 0.00 3.25
1674 2111 5.510349 GGGAACGGAAGGAGTATTATACCAC 60.510 48.000 0.00 0.00 0.00 4.16
1675 2112 5.303845 GGAACGGAAGGAGTATTATACCACT 59.696 44.000 0.00 0.00 0.00 4.00
1676 2113 6.491403 GGAACGGAAGGAGTATTATACCACTA 59.509 42.308 0.00 0.00 0.00 2.74
1677 2114 7.309073 GGAACGGAAGGAGTATTATACCACTAG 60.309 44.444 0.00 0.00 0.00 2.57
1678 2115 5.476254 ACGGAAGGAGTATTATACCACTAGC 59.524 44.000 0.00 0.00 0.00 3.42
1679 2116 5.711036 CGGAAGGAGTATTATACCACTAGCT 59.289 44.000 0.00 0.00 0.00 3.32
1680 2117 6.883217 CGGAAGGAGTATTATACCACTAGCTA 59.117 42.308 0.00 0.00 0.00 3.32
1681 2118 7.066043 CGGAAGGAGTATTATACCACTAGCTAG 59.934 44.444 19.44 19.44 0.00 3.42
1682 2119 7.889600 GGAAGGAGTATTATACCACTAGCTAGT 59.110 40.741 20.95 20.95 36.90 2.57
1693 2130 3.784701 ACTAGCTAGTGATTCGTGTGG 57.215 47.619 25.52 0.00 34.72 4.17
1694 2131 2.159226 ACTAGCTAGTGATTCGTGTGGC 60.159 50.000 25.52 0.00 34.72 5.01
1695 2132 0.458543 AGCTAGTGATTCGTGTGGCG 60.459 55.000 0.00 0.00 43.01 5.69
1706 2143 2.112475 CGTGTGGCGAAAATTCAACA 57.888 45.000 0.00 0.00 44.77 3.33
1707 2144 2.043411 CGTGTGGCGAAAATTCAACAG 58.957 47.619 0.00 0.00 44.77 3.16
1708 2145 2.393764 GTGTGGCGAAAATTCAACAGG 58.606 47.619 0.00 0.00 0.00 4.00
1709 2146 1.269517 TGTGGCGAAAATTCAACAGGC 60.270 47.619 0.00 0.00 0.00 4.85
1710 2147 1.035923 TGGCGAAAATTCAACAGGCA 58.964 45.000 0.00 0.00 0.00 4.75
1711 2148 1.617850 TGGCGAAAATTCAACAGGCAT 59.382 42.857 0.00 0.00 0.00 4.40
1712 2149 1.994779 GGCGAAAATTCAACAGGCATG 59.005 47.619 0.00 0.00 0.00 4.06
1713 2150 2.610232 GGCGAAAATTCAACAGGCATGT 60.610 45.455 0.00 0.00 43.15 3.21
1714 2151 3.366883 GGCGAAAATTCAACAGGCATGTA 60.367 43.478 3.57 0.00 39.29 2.29
1715 2152 4.423732 GCGAAAATTCAACAGGCATGTAT 58.576 39.130 3.57 0.00 39.29 2.29
1716 2153 4.500477 GCGAAAATTCAACAGGCATGTATC 59.500 41.667 3.57 0.00 39.29 2.24
1717 2154 5.639757 CGAAAATTCAACAGGCATGTATCA 58.360 37.500 3.57 0.00 39.29 2.15
1718 2155 5.512788 CGAAAATTCAACAGGCATGTATCAC 59.487 40.000 3.57 0.00 39.29 3.06
1719 2156 4.621068 AATTCAACAGGCATGTATCACG 57.379 40.909 3.57 0.00 39.29 4.35
1720 2157 2.760634 TCAACAGGCATGTATCACGT 57.239 45.000 3.57 0.00 39.29 4.49
1721 2158 2.345876 TCAACAGGCATGTATCACGTG 58.654 47.619 9.94 9.94 39.29 4.49
1729 2166 1.324435 CATGTATCACGTGCAGGTTCG 59.676 52.381 11.67 0.29 0.00 3.95
1730 2167 0.315886 TGTATCACGTGCAGGTTCGT 59.684 50.000 11.67 1.05 40.99 3.85
1731 2168 0.989890 GTATCACGTGCAGGTTCGTC 59.010 55.000 11.67 0.00 38.23 4.20
1732 2169 0.455464 TATCACGTGCAGGTTCGTCG 60.455 55.000 11.67 0.00 38.23 5.12
1733 2170 4.059459 CACGTGCAGGTTCGTCGC 62.059 66.667 9.81 0.00 38.23 5.19
1778 2215 3.430862 GCGCATGACCTTCGCCAA 61.431 61.111 0.30 0.00 42.71 4.52
1779 2216 2.787249 CGCATGACCTTCGCCAAG 59.213 61.111 0.00 0.00 0.00 3.61
1787 2224 3.479269 CTTCGCCAAGGACGACGC 61.479 66.667 0.00 0.00 39.67 5.19
1791 2228 4.070552 GCCAAGGACGACGCCTCT 62.071 66.667 10.58 0.00 37.26 3.69
1792 2229 2.182030 CCAAGGACGACGCCTCTC 59.818 66.667 10.58 0.00 37.26 3.20
1793 2230 2.182030 CAAGGACGACGCCTCTCC 59.818 66.667 10.58 3.01 37.26 3.71
1794 2231 2.282958 AAGGACGACGCCTCTCCA 60.283 61.111 10.58 0.00 37.26 3.86
1795 2232 1.682684 AAGGACGACGCCTCTCCAT 60.683 57.895 10.58 0.00 37.26 3.41
1796 2233 1.949847 AAGGACGACGCCTCTCCATG 61.950 60.000 10.58 0.00 37.26 3.66
1797 2234 2.583593 GACGACGCCTCTCCATGC 60.584 66.667 0.00 0.00 0.00 4.06
1798 2235 3.356639 GACGACGCCTCTCCATGCA 62.357 63.158 0.00 0.00 0.00 3.96
1799 2236 2.107750 CGACGCCTCTCCATGCAT 59.892 61.111 0.00 0.00 0.00 3.96
1800 2237 2.242572 CGACGCCTCTCCATGCATG 61.243 63.158 20.19 20.19 0.00 4.06
1801 2238 2.515523 ACGCCTCTCCATGCATGC 60.516 61.111 21.69 11.82 0.00 4.06
1802 2239 2.203167 CGCCTCTCCATGCATGCT 60.203 61.111 21.69 1.07 0.00 3.79
1803 2240 2.252346 CGCCTCTCCATGCATGCTC 61.252 63.158 21.69 4.85 0.00 4.26
1804 2241 2.252346 GCCTCTCCATGCATGCTCG 61.252 63.158 21.69 10.99 0.00 5.03
1805 2242 1.145598 CCTCTCCATGCATGCTCGT 59.854 57.895 21.69 1.84 0.00 4.18
1806 2243 1.158484 CCTCTCCATGCATGCTCGTG 61.158 60.000 21.69 14.34 0.00 4.35
1807 2244 1.153309 TCTCCATGCATGCTCGTGG 60.153 57.895 21.69 22.00 42.99 4.94
1808 2245 1.450848 CTCCATGCATGCTCGTGGT 60.451 57.895 25.80 4.49 42.39 4.16
1809 2246 1.712018 CTCCATGCATGCTCGTGGTG 61.712 60.000 25.80 21.93 42.39 4.17
1810 2247 2.767445 CCATGCATGCTCGTGGTGG 61.767 63.158 21.69 12.71 38.13 4.61
1811 2248 1.746239 CATGCATGCTCGTGGTGGA 60.746 57.895 20.33 0.00 0.00 4.02
1812 2249 1.746615 ATGCATGCTCGTGGTGGAC 60.747 57.895 20.33 0.00 0.00 4.02
1821 2258 4.681978 GTGGTGGACGGCGAGCTT 62.682 66.667 16.62 0.00 0.00 3.74
1822 2259 4.680237 TGGTGGACGGCGAGCTTG 62.680 66.667 16.62 0.00 0.00 4.01
1823 2260 4.373116 GGTGGACGGCGAGCTTGA 62.373 66.667 16.62 0.00 0.00 3.02
1824 2261 3.112709 GTGGACGGCGAGCTTGAC 61.113 66.667 16.62 0.00 0.00 3.18
1825 2262 4.373116 TGGACGGCGAGCTTGACC 62.373 66.667 16.62 4.73 0.00 4.02
1826 2263 4.373116 GGACGGCGAGCTTGACCA 62.373 66.667 16.62 0.00 0.00 4.02
1827 2264 3.112709 GACGGCGAGCTTGACCAC 61.113 66.667 16.62 0.00 0.00 4.16
1828 2265 4.681978 ACGGCGAGCTTGACCACC 62.682 66.667 16.62 0.00 0.00 4.61
1829 2266 4.680237 CGGCGAGCTTGACCACCA 62.680 66.667 4.70 0.00 0.00 4.17
1830 2267 3.050275 GGCGAGCTTGACCACCAC 61.050 66.667 4.70 0.00 0.00 4.16
1831 2268 3.414700 GCGAGCTTGACCACCACG 61.415 66.667 4.70 0.00 0.00 4.94
1832 2269 2.338620 CGAGCTTGACCACCACGA 59.661 61.111 0.00 0.00 0.00 4.35
1833 2270 2.022129 CGAGCTTGACCACCACGAC 61.022 63.158 0.00 0.00 0.00 4.34
1834 2271 1.069090 GAGCTTGACCACCACGACA 59.931 57.895 0.00 0.00 0.00 4.35
1835 2272 0.946221 GAGCTTGACCACCACGACAG 60.946 60.000 0.00 0.00 0.00 3.51
1836 2273 2.607892 GCTTGACCACCACGACAGC 61.608 63.158 0.00 0.00 0.00 4.40
1837 2274 2.279851 TTGACCACCACGACAGCG 60.280 61.111 0.00 0.00 44.79 5.18
1838 2275 4.961511 TGACCACCACGACAGCGC 62.962 66.667 0.00 0.00 42.48 5.92
1860 2297 2.804090 GACGCGTTCACCGTCCTC 60.804 66.667 15.53 0.00 46.78 3.71
1861 2298 3.547249 GACGCGTTCACCGTCCTCA 62.547 63.158 15.53 0.00 46.78 3.86
1862 2299 2.355363 CGCGTTCACCGTCCTCAA 60.355 61.111 0.00 0.00 39.32 3.02
1863 2300 2.654912 CGCGTTCACCGTCCTCAAC 61.655 63.158 0.00 0.00 39.32 3.18
1864 2301 2.315386 GCGTTCACCGTCCTCAACC 61.315 63.158 0.00 0.00 39.32 3.77
1865 2302 1.366366 CGTTCACCGTCCTCAACCT 59.634 57.895 0.00 0.00 0.00 3.50
1866 2303 0.944311 CGTTCACCGTCCTCAACCTG 60.944 60.000 0.00 0.00 0.00 4.00
1867 2304 0.602905 GTTCACCGTCCTCAACCTGG 60.603 60.000 0.00 0.00 0.00 4.45
1868 2305 0.761323 TTCACCGTCCTCAACCTGGA 60.761 55.000 0.00 0.00 0.00 3.86
1869 2306 1.185618 TCACCGTCCTCAACCTGGAG 61.186 60.000 0.00 0.00 33.78 3.86
1870 2307 1.155390 ACCGTCCTCAACCTGGAGA 59.845 57.895 0.00 0.00 37.05 3.71
1871 2308 0.471211 ACCGTCCTCAACCTGGAGAA 60.471 55.000 0.00 0.00 37.05 2.87
1872 2309 0.037232 CCGTCCTCAACCTGGAGAAC 60.037 60.000 0.00 0.00 37.05 3.01
1873 2310 0.679505 CGTCCTCAACCTGGAGAACA 59.320 55.000 0.00 0.00 37.05 3.18
1875 2312 0.687354 TCCTCAACCTGGAGAACAGC 59.313 55.000 0.00 0.00 46.14 4.40
1876 2313 0.671781 CCTCAACCTGGAGAACAGCG 60.672 60.000 0.00 0.00 46.14 5.18
1877 2314 1.294659 CTCAACCTGGAGAACAGCGC 61.295 60.000 0.00 0.00 46.14 5.92
1878 2315 2.032681 AACCTGGAGAACAGCGCC 59.967 61.111 2.29 0.00 46.14 6.53
1879 2316 2.818169 AACCTGGAGAACAGCGCCA 61.818 57.895 2.29 0.00 46.14 5.69
1882 2319 4.704833 TGGAGAACAGCGCCAGGC 62.705 66.667 2.29 0.00 41.91 4.85
1901 2338 4.751431 GCTCCCCAGCTTTGTCAT 57.249 55.556 0.00 0.00 43.09 3.06
1902 2339 2.187073 GCTCCCCAGCTTTGTCATG 58.813 57.895 0.00 0.00 43.09 3.07
1903 2340 0.610232 GCTCCCCAGCTTTGTCATGT 60.610 55.000 0.00 0.00 43.09 3.21
1904 2341 1.915141 CTCCCCAGCTTTGTCATGTT 58.085 50.000 0.00 0.00 0.00 2.71
1905 2342 1.815003 CTCCCCAGCTTTGTCATGTTC 59.185 52.381 0.00 0.00 0.00 3.18
1906 2343 1.144708 TCCCCAGCTTTGTCATGTTCA 59.855 47.619 0.00 0.00 0.00 3.18
1907 2344 1.962807 CCCCAGCTTTGTCATGTTCAA 59.037 47.619 0.00 0.00 0.00 2.69
1908 2345 2.029649 CCCCAGCTTTGTCATGTTCAAG 60.030 50.000 0.00 0.00 0.00 3.02
1909 2346 2.029649 CCCAGCTTTGTCATGTTCAAGG 60.030 50.000 9.63 9.63 0.00 3.61
1910 2347 2.029649 CCAGCTTTGTCATGTTCAAGGG 60.030 50.000 13.52 9.14 0.00 3.95
1911 2348 1.615392 AGCTTTGTCATGTTCAAGGGC 59.385 47.619 13.52 15.00 0.00 5.19
1912 2349 1.340889 GCTTTGTCATGTTCAAGGGCA 59.659 47.619 17.57 0.00 0.00 5.36
1913 2350 2.224018 GCTTTGTCATGTTCAAGGGCAA 60.224 45.455 17.57 0.00 0.00 4.52
1914 2351 3.383761 CTTTGTCATGTTCAAGGGCAAC 58.616 45.455 0.00 0.00 0.00 4.17
1915 2352 2.064434 TGTCATGTTCAAGGGCAACA 57.936 45.000 0.00 0.00 38.12 3.33
1916 2353 2.382882 TGTCATGTTCAAGGGCAACAA 58.617 42.857 0.00 0.00 37.30 2.83
1917 2354 2.100584 TGTCATGTTCAAGGGCAACAAC 59.899 45.455 0.00 0.00 37.30 3.32
1918 2355 1.336440 TCATGTTCAAGGGCAACAACG 59.664 47.619 0.00 0.00 37.30 4.10
1919 2356 0.673437 ATGTTCAAGGGCAACAACGG 59.327 50.000 0.00 0.00 37.30 4.44
1920 2357 1.299850 GTTCAAGGGCAACAACGGC 60.300 57.895 0.00 0.00 39.74 5.68
1921 2358 1.754621 TTCAAGGGCAACAACGGCA 60.755 52.632 0.00 0.00 39.74 5.69
1922 2359 1.112315 TTCAAGGGCAACAACGGCAT 61.112 50.000 0.00 0.00 39.74 4.40
1923 2360 1.373246 CAAGGGCAACAACGGCATG 60.373 57.895 0.00 0.00 39.74 4.06
1924 2361 1.832167 AAGGGCAACAACGGCATGT 60.832 52.632 0.00 0.00 39.74 3.21
1925 2362 1.398958 AAGGGCAACAACGGCATGTT 61.399 50.000 0.00 0.22 44.08 2.71
1926 2363 1.372872 GGGCAACAACGGCATGTTC 60.373 57.895 2.95 0.24 41.44 3.18
1927 2364 1.372872 GGCAACAACGGCATGTTCC 60.373 57.895 2.95 4.87 41.44 3.62
1928 2365 1.659794 GCAACAACGGCATGTTCCT 59.340 52.632 2.95 0.00 41.44 3.36
1929 2366 0.664166 GCAACAACGGCATGTTCCTG 60.664 55.000 2.95 0.00 41.44 3.86
1930 2367 0.039256 CAACAACGGCATGTTCCTGG 60.039 55.000 2.95 0.00 41.44 4.45
1931 2368 1.805428 AACAACGGCATGTTCCTGGC 61.805 55.000 0.00 0.00 39.23 4.85
1932 2369 2.676471 AACGGCATGTTCCTGGCC 60.676 61.111 0.00 0.00 44.27 5.36
1933 2370 4.740822 ACGGCATGTTCCTGGCCC 62.741 66.667 0.00 0.00 44.90 5.80
1950 2387 2.771435 CCCCCGACGGATAAACAAC 58.229 57.895 17.49 0.00 0.00 3.32
1951 2388 0.745486 CCCCCGACGGATAAACAACC 60.745 60.000 17.49 0.00 0.00 3.77
1958 2395 2.103537 CGGATAAACAACCGGAACCT 57.896 50.000 9.46 0.00 44.59 3.50
1959 2396 2.004733 CGGATAAACAACCGGAACCTC 58.995 52.381 9.46 0.00 44.59 3.85
1960 2397 2.362736 GGATAAACAACCGGAACCTCC 58.637 52.381 9.46 0.61 0.00 4.30
1961 2398 2.026542 GGATAAACAACCGGAACCTCCT 60.027 50.000 9.46 0.00 33.30 3.69
1962 2399 2.845363 TAAACAACCGGAACCTCCTC 57.155 50.000 9.46 0.00 33.30 3.71
1963 2400 0.109913 AAACAACCGGAACCTCCTCC 59.890 55.000 9.46 0.00 33.30 4.30
1964 2401 1.057851 AACAACCGGAACCTCCTCCA 61.058 55.000 9.46 0.00 34.91 3.86
1965 2402 1.296715 CAACCGGAACCTCCTCCAG 59.703 63.158 9.46 0.00 34.91 3.86
1966 2403 1.152096 AACCGGAACCTCCTCCAGT 60.152 57.895 9.46 0.00 34.91 4.00
1967 2404 0.767060 AACCGGAACCTCCTCCAGTT 60.767 55.000 9.46 0.00 34.91 3.16
1968 2405 1.192803 ACCGGAACCTCCTCCAGTTC 61.193 60.000 9.46 0.00 41.34 3.01
1969 2406 1.215647 CGGAACCTCCTCCAGTTCG 59.784 63.158 0.00 0.00 42.67 3.95
1970 2407 1.079057 GGAACCTCCTCCAGTTCGC 60.079 63.158 0.00 0.00 42.67 4.70
1971 2408 1.446272 GAACCTCCTCCAGTTCGCG 60.446 63.158 0.00 0.00 33.65 5.87
1972 2409 2.837371 GAACCTCCTCCAGTTCGCGG 62.837 65.000 6.13 0.00 33.65 6.46
1973 2410 3.382832 CCTCCTCCAGTTCGCGGT 61.383 66.667 6.13 0.00 0.00 5.68
1974 2411 2.125912 CTCCTCCAGTTCGCGGTG 60.126 66.667 6.13 1.13 0.00 4.94
1975 2412 2.915659 TCCTCCAGTTCGCGGTGT 60.916 61.111 6.13 0.00 0.00 4.16
1976 2413 2.432628 CCTCCAGTTCGCGGTGTC 60.433 66.667 6.13 0.00 0.00 3.67
1977 2414 2.432628 CTCCAGTTCGCGGTGTCC 60.433 66.667 6.13 0.00 0.00 4.02
1995 2432 2.285154 CGACATCGGCGACTTAACC 58.715 57.895 13.76 0.00 35.37 2.85
2006 2443 2.883574 CGACTTAACCGCTATGTTCCA 58.116 47.619 0.00 0.00 0.00 3.53
2007 2444 3.454375 CGACTTAACCGCTATGTTCCAT 58.546 45.455 0.00 0.00 0.00 3.41
2008 2445 3.489785 CGACTTAACCGCTATGTTCCATC 59.510 47.826 0.00 0.00 0.00 3.51
2009 2446 4.694339 GACTTAACCGCTATGTTCCATCT 58.306 43.478 0.00 0.00 0.00 2.90
2010 2447 4.694339 ACTTAACCGCTATGTTCCATCTC 58.306 43.478 0.00 0.00 0.00 2.75
2011 2448 4.406003 ACTTAACCGCTATGTTCCATCTCT 59.594 41.667 0.00 0.00 0.00 3.10
2012 2449 3.460857 AACCGCTATGTTCCATCTCTC 57.539 47.619 0.00 0.00 0.00 3.20
2013 2450 1.689273 ACCGCTATGTTCCATCTCTCC 59.311 52.381 0.00 0.00 0.00 3.71
2014 2451 1.001406 CCGCTATGTTCCATCTCTCCC 59.999 57.143 0.00 0.00 0.00 4.30
2015 2452 1.688735 CGCTATGTTCCATCTCTCCCA 59.311 52.381 0.00 0.00 0.00 4.37
2016 2453 2.546795 CGCTATGTTCCATCTCTCCCAC 60.547 54.545 0.00 0.00 0.00 4.61
2017 2454 2.435805 GCTATGTTCCATCTCTCCCACA 59.564 50.000 0.00 0.00 0.00 4.17
2018 2455 3.072184 GCTATGTTCCATCTCTCCCACAT 59.928 47.826 0.00 0.00 0.00 3.21
2019 2456 3.572632 ATGTTCCATCTCTCCCACATG 57.427 47.619 0.00 0.00 0.00 3.21
2020 2457 2.550175 TGTTCCATCTCTCCCACATGA 58.450 47.619 0.00 0.00 0.00 3.07
2021 2458 2.912295 TGTTCCATCTCTCCCACATGAA 59.088 45.455 0.00 0.00 0.00 2.57
2022 2459 3.274288 GTTCCATCTCTCCCACATGAAC 58.726 50.000 0.00 0.00 0.00 3.18
2023 2460 2.550175 TCCATCTCTCCCACATGAACA 58.450 47.619 0.00 0.00 0.00 3.18
2024 2461 2.912295 TCCATCTCTCCCACATGAACAA 59.088 45.455 0.00 0.00 0.00 2.83
2025 2462 3.012518 CCATCTCTCCCACATGAACAAC 58.987 50.000 0.00 0.00 0.00 3.32
2026 2463 2.455674 TCTCTCCCACATGAACAACG 57.544 50.000 0.00 0.00 0.00 4.10
2027 2464 1.001974 TCTCTCCCACATGAACAACGG 59.998 52.381 0.00 0.00 0.00 4.44
2028 2465 0.605319 TCTCCCACATGAACAACGGC 60.605 55.000 0.00 0.00 0.00 5.68
2029 2466 0.888736 CTCCCACATGAACAACGGCA 60.889 55.000 0.00 0.00 0.00 5.69
2030 2467 1.169661 TCCCACATGAACAACGGCAC 61.170 55.000 0.00 0.00 0.00 5.01
2031 2468 1.285641 CCACATGAACAACGGCACC 59.714 57.895 0.00 0.00 0.00 5.01
2032 2469 1.082169 CACATGAACAACGGCACCG 60.082 57.895 7.71 7.71 46.03 4.94
2045 2482 4.530857 CACCGTCCTCATCGCCCC 62.531 72.222 0.00 0.00 0.00 5.80
2059 2496 3.781307 CCCCCGCCGATCTCAACA 61.781 66.667 0.00 0.00 0.00 3.33
2060 2497 2.202932 CCCCGCCGATCTCAACAG 60.203 66.667 0.00 0.00 0.00 3.16
2061 2498 2.892425 CCCGCCGATCTCAACAGC 60.892 66.667 0.00 0.00 0.00 4.40
2062 2499 2.185350 CCGCCGATCTCAACAGCT 59.815 61.111 0.00 0.00 0.00 4.24
2063 2500 1.880340 CCGCCGATCTCAACAGCTC 60.880 63.158 0.00 0.00 0.00 4.09
2064 2501 1.880340 CGCCGATCTCAACAGCTCC 60.880 63.158 0.00 0.00 0.00 4.70
2065 2502 1.880340 GCCGATCTCAACAGCTCCG 60.880 63.158 0.00 0.00 0.00 4.63
2066 2503 1.880340 CCGATCTCAACAGCTCCGC 60.880 63.158 0.00 0.00 0.00 5.54
2067 2504 1.153765 CGATCTCAACAGCTCCGCA 60.154 57.895 0.00 0.00 0.00 5.69
2068 2505 0.529337 CGATCTCAACAGCTCCGCAT 60.529 55.000 0.00 0.00 0.00 4.73
2069 2506 1.216122 GATCTCAACAGCTCCGCATC 58.784 55.000 0.00 0.00 0.00 3.91
2070 2507 0.179062 ATCTCAACAGCTCCGCATCC 60.179 55.000 0.00 0.00 0.00 3.51
2071 2508 1.220206 CTCAACAGCTCCGCATCCT 59.780 57.895 0.00 0.00 0.00 3.24
2072 2509 0.461548 CTCAACAGCTCCGCATCCTA 59.538 55.000 0.00 0.00 0.00 2.94
2073 2510 0.175760 TCAACAGCTCCGCATCCTAC 59.824 55.000 0.00 0.00 0.00 3.18
2074 2511 0.176680 CAACAGCTCCGCATCCTACT 59.823 55.000 0.00 0.00 0.00 2.57
2075 2512 0.176680 AACAGCTCCGCATCCTACTG 59.823 55.000 0.00 0.00 0.00 2.74
2076 2513 1.068753 CAGCTCCGCATCCTACTGG 59.931 63.158 0.00 0.00 0.00 4.00
2078 2515 0.687757 AGCTCCGCATCCTACTGGAA 60.688 55.000 0.00 0.00 46.80 3.53
2079 2516 0.530870 GCTCCGCATCCTACTGGAAC 60.531 60.000 0.00 0.00 46.80 3.62
2080 2517 0.105039 CTCCGCATCCTACTGGAACC 59.895 60.000 0.00 0.00 46.80 3.62
2081 2518 0.325296 TCCGCATCCTACTGGAACCT 60.325 55.000 0.00 0.00 46.80 3.50
2082 2519 0.105039 CCGCATCCTACTGGAACCTC 59.895 60.000 0.00 0.00 46.80 3.85
2083 2520 0.249073 CGCATCCTACTGGAACCTCG 60.249 60.000 0.00 0.00 46.80 4.63
2084 2521 1.112113 GCATCCTACTGGAACCTCGA 58.888 55.000 0.00 0.00 46.80 4.04
2085 2522 1.067821 GCATCCTACTGGAACCTCGAG 59.932 57.143 5.13 5.13 46.80 4.04
2086 2523 2.656002 CATCCTACTGGAACCTCGAGA 58.344 52.381 15.71 0.00 46.80 4.04
2087 2524 2.893215 TCCTACTGGAACCTCGAGAA 57.107 50.000 15.71 0.00 39.87 2.87
2088 2525 2.444421 TCCTACTGGAACCTCGAGAAC 58.556 52.381 15.71 4.47 39.87 3.01
2089 2526 1.132643 CCTACTGGAACCTCGAGAACG 59.867 57.143 15.71 0.00 36.78 3.95
2090 2527 1.132643 CTACTGGAACCTCGAGAACGG 59.867 57.143 15.71 8.32 40.21 4.44
2091 2528 1.446272 CTGGAACCTCGAGAACGGC 60.446 63.158 15.71 0.00 40.21 5.68
2092 2529 2.154798 CTGGAACCTCGAGAACGGCA 62.155 60.000 15.71 0.00 40.21 5.69
2093 2530 1.005394 GGAACCTCGAGAACGGCAA 60.005 57.895 15.71 0.00 40.21 4.52
2094 2531 1.289800 GGAACCTCGAGAACGGCAAC 61.290 60.000 15.71 0.00 40.21 4.17
2095 2532 0.319641 GAACCTCGAGAACGGCAACT 60.320 55.000 15.71 0.00 40.21 3.16
2096 2533 0.600255 AACCTCGAGAACGGCAACTG 60.600 55.000 15.71 0.00 40.21 3.16
2097 2534 1.738099 CCTCGAGAACGGCAACTGG 60.738 63.158 15.71 0.00 40.21 4.00
2098 2535 1.289066 CTCGAGAACGGCAACTGGA 59.711 57.895 6.58 0.00 40.21 3.86
2099 2536 0.108615 CTCGAGAACGGCAACTGGAT 60.109 55.000 6.58 0.00 40.21 3.41
2100 2537 0.108804 TCGAGAACGGCAACTGGATC 60.109 55.000 0.00 0.00 40.21 3.36
2101 2538 1.413767 CGAGAACGGCAACTGGATCG 61.414 60.000 0.00 0.00 35.72 3.69
2102 2539 0.108804 GAGAACGGCAACTGGATCGA 60.109 55.000 0.00 0.00 0.00 3.59
2103 2540 0.108615 AGAACGGCAACTGGATCGAG 60.109 55.000 2.78 2.78 0.00 4.04
2104 2541 0.108804 GAACGGCAACTGGATCGAGA 60.109 55.000 12.14 0.00 0.00 4.04
2105 2542 0.389948 AACGGCAACTGGATCGAGAC 60.390 55.000 12.14 0.60 0.00 3.36
2106 2543 1.519455 CGGCAACTGGATCGAGACC 60.519 63.158 12.14 8.61 0.00 3.85
2107 2544 1.596934 GGCAACTGGATCGAGACCA 59.403 57.895 12.14 12.46 35.96 4.02
2108 2545 0.036388 GGCAACTGGATCGAGACCAA 60.036 55.000 12.14 1.19 36.95 3.67
2109 2546 1.079503 GCAACTGGATCGAGACCAAC 58.920 55.000 12.14 2.92 36.95 3.77
2110 2547 1.608025 GCAACTGGATCGAGACCAACA 60.608 52.381 12.14 0.00 36.95 3.33
2111 2548 2.936993 GCAACTGGATCGAGACCAACAT 60.937 50.000 12.14 2.39 36.95 2.71
2112 2549 2.674852 CAACTGGATCGAGACCAACATG 59.325 50.000 12.14 9.63 36.95 3.21
2113 2550 1.902508 ACTGGATCGAGACCAACATGT 59.097 47.619 12.14 0.00 36.95 3.21
2114 2551 2.093973 ACTGGATCGAGACCAACATGTC 60.094 50.000 12.14 0.00 36.95 3.06
2115 2552 1.207089 TGGATCGAGACCAACATGTCC 59.793 52.381 10.98 0.00 35.83 4.02
2116 2553 1.482593 GGATCGAGACCAACATGTCCT 59.517 52.381 0.00 0.00 35.83 3.85
2117 2554 2.093447 GGATCGAGACCAACATGTCCTT 60.093 50.000 0.00 0.00 35.83 3.36
2118 2555 3.600388 GATCGAGACCAACATGTCCTTT 58.400 45.455 0.00 0.00 35.83 3.11
2119 2556 4.382685 GGATCGAGACCAACATGTCCTTTA 60.383 45.833 0.00 0.00 35.83 1.85
2120 2557 4.188247 TCGAGACCAACATGTCCTTTAG 57.812 45.455 0.00 0.00 35.83 1.85
2121 2558 2.673368 CGAGACCAACATGTCCTTTAGC 59.327 50.000 0.00 0.00 35.83 3.09
2122 2559 3.674997 GAGACCAACATGTCCTTTAGCA 58.325 45.455 0.00 0.00 35.83 3.49
2123 2560 4.072131 GAGACCAACATGTCCTTTAGCAA 58.928 43.478 0.00 0.00 35.83 3.91
2124 2561 3.821033 AGACCAACATGTCCTTTAGCAAC 59.179 43.478 0.00 0.00 35.83 4.17
2125 2562 2.552315 ACCAACATGTCCTTTAGCAACG 59.448 45.455 0.00 0.00 0.00 4.10
2126 2563 2.584791 CAACATGTCCTTTAGCAACGC 58.415 47.619 0.00 0.00 0.00 4.84
2127 2564 1.165270 ACATGTCCTTTAGCAACGCC 58.835 50.000 0.00 0.00 0.00 5.68
2128 2565 0.096976 CATGTCCTTTAGCAACGCCG 59.903 55.000 0.00 0.00 0.00 6.46
2129 2566 1.644786 ATGTCCTTTAGCAACGCCGC 61.645 55.000 0.00 0.00 0.00 6.53
2130 2567 2.744709 TCCTTTAGCAACGCCGCC 60.745 61.111 0.00 0.00 0.00 6.13
2131 2568 4.160635 CCTTTAGCAACGCCGCCG 62.161 66.667 0.00 0.00 41.14 6.46
2132 2569 4.811761 CTTTAGCAACGCCGCCGC 62.812 66.667 0.00 0.00 38.22 6.53
2156 2593 2.434884 CAGCGCGTGGTTCTGGAT 60.435 61.111 8.43 0.00 0.00 3.41
2157 2594 1.153647 CAGCGCGTGGTTCTGGATA 60.154 57.895 8.43 0.00 0.00 2.59
2158 2595 0.530650 CAGCGCGTGGTTCTGGATAT 60.531 55.000 8.43 0.00 0.00 1.63
2159 2596 1.037493 AGCGCGTGGTTCTGGATATA 58.963 50.000 8.43 0.00 0.00 0.86
2160 2597 1.137513 GCGCGTGGTTCTGGATATAC 58.862 55.000 8.43 0.00 0.00 1.47
2161 2598 1.779569 CGCGTGGTTCTGGATATACC 58.220 55.000 0.00 0.00 39.54 2.73
2173 2610 4.002256 TGGATATACCAGGTGAAGGACA 57.998 45.455 0.76 0.00 44.64 4.02
2174 2611 3.967326 TGGATATACCAGGTGAAGGACAG 59.033 47.826 0.76 0.00 44.64 3.51
2175 2612 3.325135 GGATATACCAGGTGAAGGACAGG 59.675 52.174 0.76 0.00 38.79 4.00
2176 2613 2.344093 ATACCAGGTGAAGGACAGGT 57.656 50.000 0.76 0.00 37.96 4.00
2177 2614 2.112279 TACCAGGTGAAGGACAGGTT 57.888 50.000 0.76 0.00 36.31 3.50
2178 2615 0.765510 ACCAGGTGAAGGACAGGTTC 59.234 55.000 0.00 0.00 32.18 3.62
2179 2616 0.320771 CCAGGTGAAGGACAGGTTCG 60.321 60.000 0.00 0.00 0.00 3.95
2180 2617 0.951040 CAGGTGAAGGACAGGTTCGC 60.951 60.000 0.00 0.00 34.31 4.70
2181 2618 1.122019 AGGTGAAGGACAGGTTCGCT 61.122 55.000 0.00 0.00 35.24 4.93
2182 2619 0.606604 GGTGAAGGACAGGTTCGCTA 59.393 55.000 0.00 0.00 35.24 4.26
2183 2620 1.207329 GGTGAAGGACAGGTTCGCTAT 59.793 52.381 0.00 0.00 35.24 2.97
2184 2621 2.541556 GTGAAGGACAGGTTCGCTATC 58.458 52.381 0.00 0.00 32.68 2.08
2185 2622 1.480954 TGAAGGACAGGTTCGCTATCC 59.519 52.381 0.00 0.00 0.00 2.59
2186 2623 1.757699 GAAGGACAGGTTCGCTATCCT 59.242 52.381 0.00 0.00 41.70 3.24
2187 2624 1.404843 AGGACAGGTTCGCTATCCTC 58.595 55.000 0.00 0.00 34.61 3.71
2188 2625 1.112113 GGACAGGTTCGCTATCCTCA 58.888 55.000 0.00 0.00 30.91 3.86
2189 2626 1.480954 GGACAGGTTCGCTATCCTCAA 59.519 52.381 0.00 0.00 30.91 3.02
2190 2627 2.541556 GACAGGTTCGCTATCCTCAAC 58.458 52.381 0.00 0.00 30.91 3.18
2191 2628 1.135083 ACAGGTTCGCTATCCTCAACG 60.135 52.381 0.00 0.00 30.91 4.10
2192 2629 0.460311 AGGTTCGCTATCCTCAACGG 59.540 55.000 0.00 0.00 0.00 4.44
2193 2630 1.152383 GGTTCGCTATCCTCAACGGC 61.152 60.000 0.00 0.00 0.00 5.68
2194 2631 1.143183 TTCGCTATCCTCAACGGCC 59.857 57.895 0.00 0.00 0.00 6.13
2195 2632 2.622903 TTCGCTATCCTCAACGGCCG 62.623 60.000 26.86 26.86 0.00 6.13
2196 2633 2.280186 GCTATCCTCAACGGCCGG 60.280 66.667 31.76 13.23 0.00 6.13
2197 2634 2.792947 GCTATCCTCAACGGCCGGA 61.793 63.158 31.76 17.21 0.00 5.14
2198 2635 1.364171 CTATCCTCAACGGCCGGAG 59.636 63.158 31.76 25.42 0.00 4.63
2199 2636 2.701163 CTATCCTCAACGGCCGGAGC 62.701 65.000 31.76 0.00 38.76 4.70
2201 2638 4.697756 CCTCAACGGCCGGAGCAA 62.698 66.667 31.76 8.96 42.56 3.91
2202 2639 2.436646 CTCAACGGCCGGAGCAAT 60.437 61.111 31.76 3.35 42.56 3.56
2203 2640 2.435938 TCAACGGCCGGAGCAATC 60.436 61.111 31.76 0.00 42.56 2.67
2204 2641 3.864686 CAACGGCCGGAGCAATCG 61.865 66.667 31.76 3.99 42.56 3.34
2226 2663 2.084610 TCTGCAAGAGGTTGTCGATG 57.915 50.000 0.00 0.00 38.67 3.84
2227 2664 1.081892 CTGCAAGAGGTTGTCGATGG 58.918 55.000 0.00 0.00 35.92 3.51
2228 2665 0.321564 TGCAAGAGGTTGTCGATGGG 60.322 55.000 0.00 0.00 35.92 4.00
2229 2666 0.036388 GCAAGAGGTTGTCGATGGGA 60.036 55.000 0.00 0.00 35.92 4.37
2230 2667 1.610624 GCAAGAGGTTGTCGATGGGAA 60.611 52.381 0.00 0.00 35.92 3.97
2231 2668 2.778299 CAAGAGGTTGTCGATGGGAAA 58.222 47.619 0.00 0.00 0.00 3.13
2232 2669 2.474410 AGAGGTTGTCGATGGGAAAC 57.526 50.000 0.00 0.00 0.00 2.78
2233 2670 1.697432 AGAGGTTGTCGATGGGAAACA 59.303 47.619 0.00 0.00 0.00 2.83
2234 2671 2.305927 AGAGGTTGTCGATGGGAAACAT 59.694 45.455 0.00 0.00 44.18 2.71
2244 2681 3.665745 ATGGGAAACATCAACAACTGC 57.334 42.857 0.00 0.00 33.53 4.40
2245 2682 1.686052 TGGGAAACATCAACAACTGCC 59.314 47.619 0.00 0.00 0.00 4.85
2246 2683 1.963515 GGGAAACATCAACAACTGCCT 59.036 47.619 0.00 0.00 0.00 4.75
2247 2684 2.029918 GGGAAACATCAACAACTGCCTC 60.030 50.000 0.00 0.00 0.00 4.70
2248 2685 2.622942 GGAAACATCAACAACTGCCTCA 59.377 45.455 0.00 0.00 0.00 3.86
2249 2686 3.068024 GGAAACATCAACAACTGCCTCAA 59.932 43.478 0.00 0.00 0.00 3.02
2250 2687 3.715628 AACATCAACAACTGCCTCAAC 57.284 42.857 0.00 0.00 0.00 3.18
2251 2688 1.603802 ACATCAACAACTGCCTCAACG 59.396 47.619 0.00 0.00 0.00 4.10
2252 2689 0.593128 ATCAACAACTGCCTCAACGC 59.407 50.000 0.00 0.00 0.00 4.84
2253 2690 1.369209 CAACAACTGCCTCAACGCG 60.369 57.895 3.53 3.53 0.00 6.01
2254 2691 2.542907 AACAACTGCCTCAACGCGG 61.543 57.895 12.47 0.00 41.17 6.46
2258 2695 4.717629 CTGCCTCAACGCGGTCGA 62.718 66.667 12.47 3.31 39.41 4.20
2272 2709 3.216237 TCGACCCGACCATCATGG 58.784 61.111 0.54 0.54 45.02 3.66
2273 2710 2.588877 CGACCCGACCATCATGGC 60.589 66.667 2.52 0.00 42.67 4.40
2274 2711 2.203209 GACCCGACCATCATGGCC 60.203 66.667 2.52 0.00 42.67 5.36
2275 2712 4.175337 ACCCGACCATCATGGCCG 62.175 66.667 5.20 5.20 43.27 6.13
2276 2713 3.860605 CCCGACCATCATGGCCGA 61.861 66.667 14.91 0.00 46.71 5.54
2277 2714 2.280389 CCGACCATCATGGCCGAG 60.280 66.667 14.91 0.00 46.71 4.63
2278 2715 2.280389 CGACCATCATGGCCGAGG 60.280 66.667 6.53 0.00 46.71 4.63
2279 2716 2.592861 GACCATCATGGCCGAGGC 60.593 66.667 2.52 5.37 42.67 4.70
2280 2717 3.405093 GACCATCATGGCCGAGGCA 62.405 63.158 16.65 3.33 42.67 4.75
2281 2718 2.903855 CCATCATGGCCGAGGCAC 60.904 66.667 16.65 6.08 41.84 5.01
2293 2730 2.267006 AGGCACTCATCGCAGTGG 59.733 61.111 10.00 0.00 43.61 4.00
2294 2731 2.265739 GGCACTCATCGCAGTGGA 59.734 61.111 10.00 0.00 43.61 4.02
2295 2732 1.812922 GGCACTCATCGCAGTGGAG 60.813 63.158 10.00 0.00 43.61 3.86
2296 2733 1.812922 GCACTCATCGCAGTGGAGG 60.813 63.158 10.00 0.00 43.61 4.30
2297 2734 1.893062 CACTCATCGCAGTGGAGGA 59.107 57.895 0.00 0.00 40.26 3.71
2299 2736 1.227205 CTCATCGCAGTGGAGGAGC 60.227 63.158 9.36 0.00 37.93 4.70
2300 2737 2.202987 CATCGCAGTGGAGGAGCC 60.203 66.667 0.00 0.00 37.10 4.70
2301 2738 3.474570 ATCGCAGTGGAGGAGCCC 61.475 66.667 0.00 0.00 34.97 5.19
2303 2740 3.790437 CGCAGTGGAGGAGCCCAT 61.790 66.667 0.00 0.00 38.66 4.00
2304 2741 2.191641 GCAGTGGAGGAGCCCATC 59.808 66.667 0.00 0.00 38.66 3.51
2313 2750 3.866582 GAGCCCATCCTCCACCGG 61.867 72.222 0.00 0.00 0.00 5.28
2323 2760 2.447920 TCCACCGGGAGATCCACA 59.552 61.111 6.32 0.00 38.64 4.17
2324 2761 1.685765 TCCACCGGGAGATCCACAG 60.686 63.158 6.32 0.00 38.64 3.66
2325 2762 2.187946 CACCGGGAGATCCACAGC 59.812 66.667 6.32 0.00 37.91 4.40
2326 2763 2.284625 ACCGGGAGATCCACAGCA 60.285 61.111 6.32 0.00 37.91 4.41
2327 2764 1.690633 ACCGGGAGATCCACAGCAT 60.691 57.895 6.32 0.00 37.91 3.79
2328 2765 1.070445 CCGGGAGATCCACAGCATC 59.930 63.158 0.00 0.00 37.91 3.91
2329 2766 1.689243 CCGGGAGATCCACAGCATCA 61.689 60.000 0.00 0.00 37.91 3.07
2330 2767 0.249784 CGGGAGATCCACAGCATCAG 60.250 60.000 0.47 0.00 37.91 2.90
2331 2768 0.534652 GGGAGATCCACAGCATCAGC 60.535 60.000 0.47 0.00 38.39 4.26
2332 2769 0.469070 GGAGATCCACAGCATCAGCT 59.531 55.000 0.00 0.00 44.03 4.24
2333 2770 1.690893 GGAGATCCACAGCATCAGCTA 59.309 52.381 0.00 0.00 42.33 3.32
2334 2771 2.547642 GGAGATCCACAGCATCAGCTAC 60.548 54.545 0.00 0.00 42.33 3.58
2335 2772 5.063630 GGAGATCCACAGCATCAGCTACA 62.064 52.174 0.00 0.00 42.33 2.74
2336 2773 6.821669 GGAGATCCACAGCATCAGCTACAG 62.822 54.167 0.00 0.00 42.33 2.74
2353 2790 4.201122 GGCTGATGGAGGCCAGGG 62.201 72.222 5.01 0.00 46.84 4.45
2354 2791 3.415087 GCTGATGGAGGCCAGGGT 61.415 66.667 5.01 0.00 36.75 4.34
2355 2792 2.593978 CTGATGGAGGCCAGGGTG 59.406 66.667 5.01 0.00 36.75 4.61
2356 2793 2.204136 TGATGGAGGCCAGGGTGT 60.204 61.111 5.01 0.00 36.75 4.16
2357 2794 0.982852 CTGATGGAGGCCAGGGTGTA 60.983 60.000 5.01 0.00 36.75 2.90
2358 2795 1.271840 TGATGGAGGCCAGGGTGTAC 61.272 60.000 5.01 0.00 36.75 2.90
2359 2796 2.311688 GATGGAGGCCAGGGTGTACG 62.312 65.000 5.01 0.00 36.75 3.67
2360 2797 2.682494 GGAGGCCAGGGTGTACGA 60.682 66.667 5.01 0.00 0.00 3.43
2361 2798 2.577593 GAGGCCAGGGTGTACGAC 59.422 66.667 5.01 0.00 0.00 4.34
2362 2799 2.203728 AGGCCAGGGTGTACGACA 60.204 61.111 5.01 0.00 0.00 4.35
2371 2808 2.159181 GTGTACGACACCACCATGC 58.841 57.895 6.82 0.00 43.05 4.06
2372 2809 0.320421 GTGTACGACACCACCATGCT 60.320 55.000 6.82 0.00 43.05 3.79
2373 2810 0.037697 TGTACGACACCACCATGCTC 60.038 55.000 0.00 0.00 0.00 4.26
2374 2811 0.037697 GTACGACACCACCATGCTCA 60.038 55.000 0.00 0.00 0.00 4.26
2375 2812 0.037697 TACGACACCACCATGCTCAC 60.038 55.000 0.00 0.00 0.00 3.51
2376 2813 2.034879 CGACACCACCATGCTCACC 61.035 63.158 0.00 0.00 0.00 4.02
2377 2814 1.073025 GACACCACCATGCTCACCA 59.927 57.895 0.00 0.00 0.00 4.17
2378 2815 0.322816 GACACCACCATGCTCACCAT 60.323 55.000 0.00 0.00 33.39 3.55
2384 2821 3.203442 CATGCTCACCATGGCCAC 58.797 61.111 8.16 0.00 46.09 5.01
2385 2822 2.043652 ATGCTCACCATGGCCACC 60.044 61.111 8.16 0.00 31.48 4.61
2386 2823 2.921500 ATGCTCACCATGGCCACCA 61.921 57.895 8.16 4.86 38.19 4.17
2387 2824 3.064324 GCTCACCATGGCCACCAC 61.064 66.667 8.16 0.00 35.80 4.16
2388 2825 2.747460 CTCACCATGGCCACCACG 60.747 66.667 8.16 0.00 35.80 4.94
2389 2826 4.343323 TCACCATGGCCACCACGG 62.343 66.667 8.16 9.43 43.30 4.94
2411 2848 4.355925 GGTCAACGACACCTCCAC 57.644 61.111 0.00 0.00 33.68 4.02
2412 2849 1.444250 GGTCAACGACACCTCCACA 59.556 57.895 0.00 0.00 33.68 4.17
2413 2850 0.600255 GGTCAACGACACCTCCACAG 60.600 60.000 0.00 0.00 33.68 3.66
2414 2851 0.387929 GTCAACGACACCTCCACAGA 59.612 55.000 0.00 0.00 32.09 3.41
2415 2852 0.673985 TCAACGACACCTCCACAGAG 59.326 55.000 0.00 0.00 40.09 3.35
2416 2853 0.673985 CAACGACACCTCCACAGAGA 59.326 55.000 0.00 0.00 43.39 3.10
2417 2854 1.068588 CAACGACACCTCCACAGAGAA 59.931 52.381 0.00 0.00 43.39 2.87
2418 2855 0.674534 ACGACACCTCCACAGAGAAC 59.325 55.000 0.00 0.00 43.39 3.01
2419 2856 0.673985 CGACACCTCCACAGAGAACA 59.326 55.000 0.00 0.00 43.39 3.18
2420 2857 1.603172 CGACACCTCCACAGAGAACAC 60.603 57.143 0.00 0.00 43.39 3.32
2421 2858 0.759346 ACACCTCCACAGAGAACACC 59.241 55.000 0.00 0.00 43.39 4.16
2422 2859 0.758734 CACCTCCACAGAGAACACCA 59.241 55.000 0.00 0.00 43.39 4.17
2423 2860 1.140852 CACCTCCACAGAGAACACCAA 59.859 52.381 0.00 0.00 43.39 3.67
2424 2861 1.417890 ACCTCCACAGAGAACACCAAG 59.582 52.381 0.00 0.00 43.39 3.61
2425 2862 1.694150 CCTCCACAGAGAACACCAAGA 59.306 52.381 0.00 0.00 43.39 3.02
2426 2863 2.289320 CCTCCACAGAGAACACCAAGAG 60.289 54.545 0.00 0.00 43.39 2.85
2427 2864 1.694150 TCCACAGAGAACACCAAGAGG 59.306 52.381 0.00 0.00 42.21 3.69
2428 2865 1.517242 CACAGAGAACACCAAGAGGC 58.483 55.000 0.00 0.00 39.06 4.70
2429 2866 1.071385 CACAGAGAACACCAAGAGGCT 59.929 52.381 0.00 0.00 39.06 4.58
2430 2867 1.071385 ACAGAGAACACCAAGAGGCTG 59.929 52.381 0.00 0.00 39.06 4.85
2431 2868 0.036022 AGAGAACACCAAGAGGCTGC 59.964 55.000 0.00 0.00 39.06 5.25
2432 2869 1.294659 GAGAACACCAAGAGGCTGCG 61.295 60.000 0.00 0.00 39.06 5.18
2433 2870 2.281761 AACACCAAGAGGCTGCGG 60.282 61.111 0.00 0.00 39.06 5.69
2435 2872 4.711949 CACCAAGAGGCTGCGGCT 62.712 66.667 18.85 11.06 42.48 5.52
2436 2873 4.711949 ACCAAGAGGCTGCGGCTG 62.712 66.667 18.85 7.54 38.98 4.85
2438 2875 4.711949 CAAGAGGCTGCGGCTGGT 62.712 66.667 18.85 1.93 38.98 4.00
2439 2876 4.711949 AAGAGGCTGCGGCTGGTG 62.712 66.667 18.85 0.00 38.98 4.17
2441 2878 4.082523 GAGGCTGCGGCTGGTGTA 62.083 66.667 18.85 0.00 38.98 2.90
2442 2879 4.394712 AGGCTGCGGCTGGTGTAC 62.395 66.667 18.85 0.00 36.97 2.90
2444 2881 4.735132 GCTGCGGCTGGTGTACGA 62.735 66.667 11.21 0.00 35.22 3.43
2445 2882 2.507102 CTGCGGCTGGTGTACGAG 60.507 66.667 0.00 0.00 0.00 4.18
2446 2883 3.989698 CTGCGGCTGGTGTACGAGG 62.990 68.421 0.00 0.00 0.00 4.63
2447 2884 3.755628 GCGGCTGGTGTACGAGGA 61.756 66.667 0.00 0.00 0.00 3.71
2448 2885 2.490217 CGGCTGGTGTACGAGGAG 59.510 66.667 0.00 0.00 0.00 3.69
2449 2886 2.893398 GGCTGGTGTACGAGGAGG 59.107 66.667 0.00 0.00 0.00 4.30
2450 2887 1.681327 GGCTGGTGTACGAGGAGGA 60.681 63.158 0.00 0.00 0.00 3.71
2451 2888 1.668101 GGCTGGTGTACGAGGAGGAG 61.668 65.000 0.00 0.00 0.00 3.69
2452 2889 1.668101 GCTGGTGTACGAGGAGGAGG 61.668 65.000 0.00 0.00 0.00 4.30
2453 2890 0.034380 CTGGTGTACGAGGAGGAGGA 60.034 60.000 0.00 0.00 0.00 3.71
2454 2891 0.034380 TGGTGTACGAGGAGGAGGAG 60.034 60.000 0.00 0.00 0.00 3.69
2455 2892 0.255318 GGTGTACGAGGAGGAGGAGA 59.745 60.000 0.00 0.00 0.00 3.71
2456 2893 1.133730 GGTGTACGAGGAGGAGGAGAT 60.134 57.143 0.00 0.00 0.00 2.75
2457 2894 1.950909 GTGTACGAGGAGGAGGAGATG 59.049 57.143 0.00 0.00 0.00 2.90
2458 2895 1.844497 TGTACGAGGAGGAGGAGATGA 59.156 52.381 0.00 0.00 0.00 2.92
2459 2896 2.158740 TGTACGAGGAGGAGGAGATGAG 60.159 54.545 0.00 0.00 0.00 2.90
2460 2897 0.467290 ACGAGGAGGAGGAGATGAGC 60.467 60.000 0.00 0.00 0.00 4.26
2461 2898 0.467106 CGAGGAGGAGGAGATGAGCA 60.467 60.000 0.00 0.00 0.00 4.26
2462 2899 1.039856 GAGGAGGAGGAGATGAGCAC 58.960 60.000 0.00 0.00 0.00 4.40
2463 2900 0.398381 AGGAGGAGGAGATGAGCACC 60.398 60.000 0.00 0.00 0.00 5.01
2464 2901 0.398381 GGAGGAGGAGATGAGCACCT 60.398 60.000 0.00 0.00 40.59 4.00
2465 2902 0.752054 GAGGAGGAGATGAGCACCTG 59.248 60.000 0.00 0.00 37.74 4.00
2466 2903 0.690411 AGGAGGAGATGAGCACCTGG 60.690 60.000 0.00 0.00 37.74 4.45
2467 2904 1.694133 GGAGGAGATGAGCACCTGGG 61.694 65.000 0.00 0.00 37.74 4.45
2468 2905 0.689080 GAGGAGATGAGCACCTGGGA 60.689 60.000 0.00 0.00 37.74 4.37
2469 2906 0.980231 AGGAGATGAGCACCTGGGAC 60.980 60.000 0.00 0.00 36.13 4.46
2470 2907 1.267574 GGAGATGAGCACCTGGGACA 61.268 60.000 0.00 0.00 0.00 4.02
2471 2908 0.107945 GAGATGAGCACCTGGGACAC 60.108 60.000 0.00 0.00 0.00 3.67
2472 2909 1.078143 GATGAGCACCTGGGACACC 60.078 63.158 0.00 0.00 37.24 4.16
2473 2910 1.841302 GATGAGCACCTGGGACACCA 61.841 60.000 0.00 0.00 46.94 4.17
2474 2911 2.032681 GAGCACCTGGGACACCAC 59.967 66.667 0.00 0.00 43.37 4.16
2475 2912 2.448542 AGCACCTGGGACACCACT 60.449 61.111 0.00 0.00 43.37 4.00
2476 2913 2.032681 GCACCTGGGACACCACTC 59.967 66.667 0.00 0.00 43.37 3.51
2477 2914 2.520536 GCACCTGGGACACCACTCT 61.521 63.158 0.00 0.00 43.37 3.24
2478 2915 1.674057 CACCTGGGACACCACTCTC 59.326 63.158 0.00 0.00 43.37 3.20
2479 2916 1.908793 ACCTGGGACACCACTCTCG 60.909 63.158 0.00 0.00 43.37 4.04
2480 2917 1.606601 CCTGGGACACCACTCTCGA 60.607 63.158 0.00 0.00 43.37 4.04
2481 2918 1.599606 CCTGGGACACCACTCTCGAG 61.600 65.000 5.93 5.93 43.37 4.04
2482 2919 2.219325 CTGGGACACCACTCTCGAGC 62.219 65.000 7.81 0.00 43.37 5.03
2483 2920 1.979693 GGGACACCACTCTCGAGCT 60.980 63.158 7.81 0.00 36.50 4.09
2484 2921 1.509004 GGACACCACTCTCGAGCTC 59.491 63.158 7.81 2.73 0.00 4.09
2485 2922 1.244697 GGACACCACTCTCGAGCTCA 61.245 60.000 15.40 0.00 0.00 4.26
2486 2923 0.598562 GACACCACTCTCGAGCTCAA 59.401 55.000 15.40 0.00 0.00 3.02
2487 2924 0.600557 ACACCACTCTCGAGCTCAAG 59.399 55.000 15.40 4.57 0.00 3.02
2488 2925 0.735632 CACCACTCTCGAGCTCAAGC 60.736 60.000 15.40 0.00 42.49 4.01
2500 2937 2.892784 GCTCAAGCTCGGGTATAAGT 57.107 50.000 0.00 0.00 38.21 2.24
2501 2938 2.745102 GCTCAAGCTCGGGTATAAGTC 58.255 52.381 0.00 0.00 38.21 3.01
2502 2939 2.546162 GCTCAAGCTCGGGTATAAGTCC 60.546 54.545 0.00 0.00 38.21 3.85
2503 2940 2.693591 CTCAAGCTCGGGTATAAGTCCA 59.306 50.000 0.00 0.00 0.00 4.02
2504 2941 2.429610 TCAAGCTCGGGTATAAGTCCAC 59.570 50.000 0.00 0.00 0.00 4.02
2505 2942 1.411041 AGCTCGGGTATAAGTCCACC 58.589 55.000 0.00 0.00 0.00 4.61
2506 2943 1.117150 GCTCGGGTATAAGTCCACCA 58.883 55.000 0.00 0.00 36.48 4.17
2507 2944 1.692519 GCTCGGGTATAAGTCCACCAT 59.307 52.381 0.00 0.00 36.48 3.55
2508 2945 2.104281 GCTCGGGTATAAGTCCACCATT 59.896 50.000 0.00 0.00 36.48 3.16
2509 2946 3.322828 GCTCGGGTATAAGTCCACCATTA 59.677 47.826 0.00 0.00 36.48 1.90
2510 2947 4.560919 GCTCGGGTATAAGTCCACCATTAG 60.561 50.000 0.00 0.00 36.48 1.73
2511 2948 4.806892 TCGGGTATAAGTCCACCATTAGA 58.193 43.478 0.00 0.00 36.48 2.10
2512 2949 4.831155 TCGGGTATAAGTCCACCATTAGAG 59.169 45.833 0.00 0.00 36.48 2.43
2513 2950 4.560919 CGGGTATAAGTCCACCATTAGAGC 60.561 50.000 0.00 0.00 36.48 4.09
2514 2951 4.347000 GGGTATAAGTCCACCATTAGAGCA 59.653 45.833 0.00 0.00 36.48 4.26
2515 2952 5.511545 GGGTATAAGTCCACCATTAGAGCAG 60.512 48.000 0.00 0.00 36.48 4.24
2516 2953 4.696479 ATAAGTCCACCATTAGAGCAGG 57.304 45.455 0.00 0.00 0.00 4.85
2517 2954 1.207791 AGTCCACCATTAGAGCAGGG 58.792 55.000 0.00 0.00 0.00 4.45
2518 2955 0.912486 GTCCACCATTAGAGCAGGGT 59.088 55.000 0.00 0.00 0.00 4.34
2519 2956 1.282157 GTCCACCATTAGAGCAGGGTT 59.718 52.381 0.00 0.00 0.00 4.11
2520 2957 1.559682 TCCACCATTAGAGCAGGGTTC 59.440 52.381 0.00 0.00 0.00 3.62
2521 2958 1.408822 CCACCATTAGAGCAGGGTTCC 60.409 57.143 0.00 0.00 0.00 3.62
2522 2959 0.919710 ACCATTAGAGCAGGGTTCCC 59.080 55.000 0.00 0.00 0.00 3.97
2523 2960 0.183731 CCATTAGAGCAGGGTTCCCC 59.816 60.000 4.02 0.00 45.90 4.81
2534 2971 4.035102 GTTCCCCAAGCTCGGCCT 62.035 66.667 0.00 0.00 0.00 5.19
2535 2972 3.717294 TTCCCCAAGCTCGGCCTC 61.717 66.667 0.00 0.00 0.00 4.70
2554 2991 4.521062 GCGCTCGGGTCAGCATCT 62.521 66.667 0.00 0.00 39.62 2.90
2555 2992 2.279120 CGCTCGGGTCAGCATCTC 60.279 66.667 0.00 0.00 39.62 2.75
2556 2993 2.895680 GCTCGGGTCAGCATCTCA 59.104 61.111 0.00 0.00 39.43 3.27
2557 2994 1.227205 GCTCGGGTCAGCATCTCAG 60.227 63.158 0.00 0.00 39.43 3.35
2558 2995 1.227205 CTCGGGTCAGCATCTCAGC 60.227 63.158 0.00 0.00 0.00 4.26
2559 2996 2.202987 CGGGTCAGCATCTCAGCC 60.203 66.667 0.00 0.00 34.23 4.85
2560 2997 2.202987 GGGTCAGCATCTCAGCCG 60.203 66.667 0.00 0.00 34.23 5.52
2561 2998 2.725312 GGGTCAGCATCTCAGCCGA 61.725 63.158 0.00 0.00 34.23 5.54
2562 2999 1.227205 GGTCAGCATCTCAGCCGAG 60.227 63.158 0.00 0.00 40.98 4.63
2563 3000 1.515020 GTCAGCATCTCAGCCGAGT 59.485 57.895 0.00 0.00 40.44 4.18
2564 3001 0.108424 GTCAGCATCTCAGCCGAGTT 60.108 55.000 0.00 0.00 40.44 3.01
2565 3002 0.174389 TCAGCATCTCAGCCGAGTTC 59.826 55.000 0.00 0.00 40.44 3.01
2566 3003 0.175302 CAGCATCTCAGCCGAGTTCT 59.825 55.000 0.00 0.00 40.44 3.01
2567 3004 1.406898 CAGCATCTCAGCCGAGTTCTA 59.593 52.381 0.00 0.00 40.44 2.10
2568 3005 1.407258 AGCATCTCAGCCGAGTTCTAC 59.593 52.381 0.00 0.00 40.44 2.59
2569 3006 1.862008 GCATCTCAGCCGAGTTCTACG 60.862 57.143 0.00 0.00 40.44 3.51
2575 3012 2.758737 CCGAGTTCTACGGGGCCT 60.759 66.667 0.84 0.00 45.65 5.19
2576 3013 1.454479 CCGAGTTCTACGGGGCCTA 60.454 63.158 0.84 0.00 45.65 3.93
2577 3014 1.732308 CGAGTTCTACGGGGCCTAC 59.268 63.158 0.84 0.00 0.00 3.18
2578 3015 1.033746 CGAGTTCTACGGGGCCTACA 61.034 60.000 0.84 0.00 0.00 2.74
2579 3016 1.188863 GAGTTCTACGGGGCCTACAA 58.811 55.000 0.84 0.00 0.00 2.41
2580 3017 0.900421 AGTTCTACGGGGCCTACAAC 59.100 55.000 0.84 0.00 0.00 3.32
2581 3018 0.900421 GTTCTACGGGGCCTACAACT 59.100 55.000 0.84 0.00 0.00 3.16
2582 3019 0.899720 TTCTACGGGGCCTACAACTG 59.100 55.000 0.84 0.00 0.00 3.16
2583 3020 0.974010 TCTACGGGGCCTACAACTGG 60.974 60.000 0.84 0.00 0.00 4.00
2584 3021 1.968050 CTACGGGGCCTACAACTGGG 61.968 65.000 0.84 0.00 0.00 4.45
2585 3022 4.109675 CGGGGCCTACAACTGGGG 62.110 72.222 0.84 0.00 0.00 4.96
2586 3023 4.442454 GGGGCCTACAACTGGGGC 62.442 72.222 0.84 7.24 45.80 5.80
2588 3025 3.712907 GGCCTACAACTGGGGCGA 61.713 66.667 0.00 0.00 46.10 5.54
2589 3026 2.349755 GCCTACAACTGGGGCGAA 59.650 61.111 0.00 0.00 36.37 4.70
2590 3027 1.302993 GCCTACAACTGGGGCGAAA 60.303 57.895 0.00 0.00 36.37 3.46
2591 3028 1.583495 GCCTACAACTGGGGCGAAAC 61.583 60.000 0.00 0.00 36.37 2.78
2592 3029 0.958876 CCTACAACTGGGGCGAAACC 60.959 60.000 0.00 0.00 37.93 3.27
2593 3030 0.250553 CTACAACTGGGGCGAAACCA 60.251 55.000 0.00 0.00 42.05 3.67
2594 3031 0.402504 TACAACTGGGGCGAAACCAT 59.597 50.000 0.00 0.00 42.05 3.55
2595 3032 1.178534 ACAACTGGGGCGAAACCATG 61.179 55.000 0.00 0.00 42.05 3.66
2596 3033 1.606313 AACTGGGGCGAAACCATGG 60.606 57.895 11.19 11.19 42.05 3.66
2597 3034 2.075355 AACTGGGGCGAAACCATGGA 62.075 55.000 21.47 0.00 42.05 3.41
2598 3035 1.750399 CTGGGGCGAAACCATGGAG 60.750 63.158 21.47 7.81 42.05 3.86
2599 3036 2.196997 CTGGGGCGAAACCATGGAGA 62.197 60.000 21.47 0.00 42.05 3.71
2600 3037 1.001393 GGGGCGAAACCATGGAGAA 60.001 57.895 21.47 0.00 42.05 2.87
2601 3038 1.032114 GGGGCGAAACCATGGAGAAG 61.032 60.000 21.47 8.19 42.05 2.85
2602 3039 0.035439 GGGCGAAACCATGGAGAAGA 60.035 55.000 21.47 0.00 42.05 2.87
2603 3040 1.613255 GGGCGAAACCATGGAGAAGAA 60.613 52.381 21.47 0.00 42.05 2.52
2604 3041 1.740025 GGCGAAACCATGGAGAAGAAG 59.260 52.381 21.47 3.92 38.86 2.85
2605 3042 1.740025 GCGAAACCATGGAGAAGAAGG 59.260 52.381 21.47 0.00 0.00 3.46
2606 3043 2.876079 GCGAAACCATGGAGAAGAAGGT 60.876 50.000 21.47 0.00 0.00 3.50
2607 3044 2.744202 CGAAACCATGGAGAAGAAGGTG 59.256 50.000 21.47 0.00 31.86 4.00
2608 3045 3.557054 CGAAACCATGGAGAAGAAGGTGA 60.557 47.826 21.47 0.00 31.86 4.02
2609 3046 3.710209 AACCATGGAGAAGAAGGTGAG 57.290 47.619 21.47 0.00 31.86 3.51
2610 3047 1.912043 ACCATGGAGAAGAAGGTGAGG 59.088 52.381 21.47 0.00 0.00 3.86
2611 3048 1.407989 CCATGGAGAAGAAGGTGAGGC 60.408 57.143 5.56 0.00 0.00 4.70
2612 3049 1.280133 CATGGAGAAGAAGGTGAGGCA 59.720 52.381 0.00 0.00 0.00 4.75
2613 3050 1.661463 TGGAGAAGAAGGTGAGGCAT 58.339 50.000 0.00 0.00 0.00 4.40
2614 3051 1.280133 TGGAGAAGAAGGTGAGGCATG 59.720 52.381 0.00 0.00 0.00 4.06
2615 3052 1.556911 GGAGAAGAAGGTGAGGCATGA 59.443 52.381 0.00 0.00 0.00 3.07
2616 3053 2.419851 GGAGAAGAAGGTGAGGCATGAG 60.420 54.545 0.00 0.00 0.00 2.90
2617 3054 1.558756 AGAAGAAGGTGAGGCATGAGG 59.441 52.381 0.00 0.00 0.00 3.86
2618 3055 1.280421 GAAGAAGGTGAGGCATGAGGT 59.720 52.381 0.00 0.00 0.00 3.85
2619 3056 0.908198 AGAAGGTGAGGCATGAGGTC 59.092 55.000 0.00 0.00 0.00 3.85
2620 3057 0.460987 GAAGGTGAGGCATGAGGTCG 60.461 60.000 0.00 0.00 0.00 4.79
2621 3058 1.194781 AAGGTGAGGCATGAGGTCGT 61.195 55.000 0.00 0.00 0.00 4.34
2622 3059 1.153549 GGTGAGGCATGAGGTCGTC 60.154 63.158 0.00 0.00 0.00 4.20
2623 3060 1.608717 GGTGAGGCATGAGGTCGTCT 61.609 60.000 0.00 0.00 0.00 4.18
2624 3061 1.103803 GTGAGGCATGAGGTCGTCTA 58.896 55.000 0.00 0.00 0.00 2.59
2625 3062 1.683917 GTGAGGCATGAGGTCGTCTAT 59.316 52.381 0.00 0.00 0.00 1.98
2626 3063 1.683385 TGAGGCATGAGGTCGTCTATG 59.317 52.381 0.00 0.00 0.00 2.23
2627 3064 1.957177 GAGGCATGAGGTCGTCTATGA 59.043 52.381 0.00 0.00 0.00 2.15
2628 3065 1.959985 AGGCATGAGGTCGTCTATGAG 59.040 52.381 0.00 0.00 0.00 2.90
2629 3066 1.000283 GGCATGAGGTCGTCTATGAGG 60.000 57.143 0.00 0.00 0.00 3.86
2630 3067 1.604185 GCATGAGGTCGTCTATGAGGC 60.604 57.143 0.00 0.00 0.00 4.70
2631 3068 1.000283 CATGAGGTCGTCTATGAGGCC 60.000 57.143 0.00 0.00 0.00 5.19
2632 3069 1.101635 TGAGGTCGTCTATGAGGCCG 61.102 60.000 0.00 0.00 0.00 6.13
2633 3070 2.027751 GGTCGTCTATGAGGCCGC 59.972 66.667 0.00 0.00 0.00 6.53
2634 3071 2.782222 GGTCGTCTATGAGGCCGCA 61.782 63.158 12.99 12.99 0.00 5.69
2635 3072 1.299468 GTCGTCTATGAGGCCGCAG 60.299 63.158 16.31 1.88 0.00 5.18
2636 3073 1.753078 TCGTCTATGAGGCCGCAGT 60.753 57.895 16.31 6.01 0.00 4.40
2637 3074 1.589993 CGTCTATGAGGCCGCAGTG 60.590 63.158 16.31 10.12 0.00 3.66
2638 3075 1.884926 GTCTATGAGGCCGCAGTGC 60.885 63.158 16.31 4.58 0.00 4.40
2655 3092 4.410400 CCGCCCAGGACCAAGGTC 62.410 72.222 10.80 10.80 45.00 3.85
2656 3093 3.636231 CGCCCAGGACCAAGGTCA 61.636 66.667 20.03 0.00 46.20 4.02
2657 3094 2.034221 GCCCAGGACCAAGGTCAC 59.966 66.667 20.03 9.98 46.20 3.67
2658 3095 2.757077 CCCAGGACCAAGGTCACC 59.243 66.667 20.03 5.28 46.20 4.02
2659 3096 2.347490 CCAGGACCAAGGTCACCG 59.653 66.667 20.03 7.95 46.20 4.94
2660 3097 2.516888 CCAGGACCAAGGTCACCGT 61.517 63.158 20.03 0.00 46.20 4.83
2661 3098 1.004918 CAGGACCAAGGTCACCGTC 60.005 63.158 20.03 3.26 46.20 4.79
2662 3099 1.458777 AGGACCAAGGTCACCGTCA 60.459 57.895 20.03 0.00 46.20 4.35
2663 3100 1.052124 AGGACCAAGGTCACCGTCAA 61.052 55.000 20.03 0.00 46.20 3.18
2664 3101 0.602905 GGACCAAGGTCACCGTCAAG 60.603 60.000 20.03 0.00 46.20 3.02
2665 3102 0.602905 GACCAAGGTCACCGTCAAGG 60.603 60.000 14.19 0.00 44.02 3.61
2666 3103 1.966451 CCAAGGTCACCGTCAAGGC 60.966 63.158 0.00 0.00 46.52 4.35
2667 3104 1.966451 CAAGGTCACCGTCAAGGCC 60.966 63.158 0.00 0.00 46.52 5.19
2668 3105 3.530910 AAGGTCACCGTCAAGGCCG 62.531 63.158 0.00 0.00 46.52 6.13
2669 3106 4.309950 GGTCACCGTCAAGGCCGT 62.310 66.667 0.00 0.00 46.52 5.68
2670 3107 2.737376 GTCACCGTCAAGGCCGTC 60.737 66.667 0.00 0.00 46.52 4.79
2671 3108 4.351938 TCACCGTCAAGGCCGTCG 62.352 66.667 0.00 0.67 46.52 5.12
2701 3138 3.980989 CCGTCACCGTCCCGTTCA 61.981 66.667 0.00 0.00 0.00 3.18
2702 3139 2.027897 CGTCACCGTCCCGTTCAA 59.972 61.111 0.00 0.00 0.00 2.69
2703 3140 2.305127 CGTCACCGTCCCGTTCAAC 61.305 63.158 0.00 0.00 0.00 3.18
2704 3141 1.068585 GTCACCGTCCCGTTCAACT 59.931 57.895 0.00 0.00 0.00 3.16
2705 3142 0.314935 GTCACCGTCCCGTTCAACTA 59.685 55.000 0.00 0.00 0.00 2.24
2706 3143 0.314935 TCACCGTCCCGTTCAACTAC 59.685 55.000 0.00 0.00 0.00 2.73
2707 3144 0.668401 CACCGTCCCGTTCAACTACC 60.668 60.000 0.00 0.00 0.00 3.18
2708 3145 1.444895 CCGTCCCGTTCAACTACCG 60.445 63.158 0.00 0.00 0.00 4.02
2709 3146 2.090524 CGTCCCGTTCAACTACCGC 61.091 63.158 0.00 0.00 0.00 5.68
2710 3147 1.739196 GTCCCGTTCAACTACCGCC 60.739 63.158 0.00 0.00 0.00 6.13
2711 3148 2.208619 TCCCGTTCAACTACCGCCA 61.209 57.895 0.00 0.00 0.00 5.69
2712 3149 1.740296 CCCGTTCAACTACCGCCAG 60.740 63.158 0.00 0.00 0.00 4.85
2713 3150 1.740296 CCGTTCAACTACCGCCAGG 60.740 63.158 0.00 0.00 45.13 4.45
2740 3177 2.687200 CCACGGATGGGAGGGTGA 60.687 66.667 0.00 0.00 43.04 4.02
2741 3178 2.735772 CCACGGATGGGAGGGTGAG 61.736 68.421 0.00 0.00 43.04 3.51
2742 3179 2.365635 ACGGATGGGAGGGTGAGG 60.366 66.667 0.00 0.00 0.00 3.86
2743 3180 2.041922 CGGATGGGAGGGTGAGGA 60.042 66.667 0.00 0.00 0.00 3.71
2744 3181 2.136878 CGGATGGGAGGGTGAGGAG 61.137 68.421 0.00 0.00 0.00 3.69
2745 3182 2.447714 GGATGGGAGGGTGAGGAGC 61.448 68.421 0.00 0.00 0.00 4.70
2746 3183 1.690633 GATGGGAGGGTGAGGAGCA 60.691 63.158 0.00 0.00 0.00 4.26
2747 3184 1.692042 ATGGGAGGGTGAGGAGCAG 60.692 63.158 0.00 0.00 0.00 4.24
2748 3185 3.791586 GGGAGGGTGAGGAGCAGC 61.792 72.222 0.00 0.00 44.17 5.25
2749 3186 3.005539 GGAGGGTGAGGAGCAGCA 61.006 66.667 0.00 0.00 46.67 4.41
2750 3187 2.373707 GGAGGGTGAGGAGCAGCAT 61.374 63.158 0.00 0.00 46.67 3.79
2751 3188 1.145819 GAGGGTGAGGAGCAGCATC 59.854 63.158 0.00 0.00 46.53 3.91
2752 3189 1.614525 AGGGTGAGGAGCAGCATCA 60.615 57.895 0.00 0.00 46.67 3.07
2753 3190 1.203441 AGGGTGAGGAGCAGCATCAA 61.203 55.000 0.00 0.00 46.67 2.57
2754 3191 0.747283 GGGTGAGGAGCAGCATCAAG 60.747 60.000 0.00 0.00 46.67 3.02
2755 3192 0.251354 GGTGAGGAGCAGCATCAAGA 59.749 55.000 0.00 0.00 44.31 3.02
2756 3193 1.654317 GTGAGGAGCAGCATCAAGAG 58.346 55.000 0.00 0.00 39.28 2.85
2757 3194 0.540454 TGAGGAGCAGCATCAAGAGG 59.460 55.000 0.00 0.00 33.80 3.69
2758 3195 0.179051 GAGGAGCAGCATCAAGAGGG 60.179 60.000 0.00 0.00 0.00 4.30
2759 3196 0.619832 AGGAGCAGCATCAAGAGGGA 60.620 55.000 0.00 0.00 0.00 4.20
2760 3197 0.463474 GGAGCAGCATCAAGAGGGAC 60.463 60.000 0.00 0.00 0.00 4.46
2761 3198 0.809241 GAGCAGCATCAAGAGGGACG 60.809 60.000 0.00 0.00 0.00 4.79
2762 3199 1.817099 GCAGCATCAAGAGGGACGG 60.817 63.158 0.00 0.00 0.00 4.79
2763 3200 1.817099 CAGCATCAAGAGGGACGGC 60.817 63.158 0.00 0.00 0.00 5.68
2764 3201 2.514824 GCATCAAGAGGGACGGCC 60.515 66.667 0.00 0.00 0.00 6.13
2765 3202 3.036429 GCATCAAGAGGGACGGCCT 62.036 63.158 7.57 0.00 0.00 5.19
2766 3203 1.144936 CATCAAGAGGGACGGCCTC 59.855 63.158 7.57 2.32 34.79 4.70
2767 3204 1.002274 ATCAAGAGGGACGGCCTCT 59.998 57.895 7.57 5.17 45.34 3.69
2768 3205 0.261991 ATCAAGAGGGACGGCCTCTA 59.738 55.000 7.57 0.00 42.98 2.43
2769 3206 0.683504 TCAAGAGGGACGGCCTCTAC 60.684 60.000 7.57 0.00 42.98 2.59
2770 3207 0.970937 CAAGAGGGACGGCCTCTACA 60.971 60.000 7.57 0.00 42.98 2.74
2771 3208 0.971447 AAGAGGGACGGCCTCTACAC 60.971 60.000 7.57 0.00 42.98 2.90
2772 3209 2.363925 AGGGACGGCCTCTACACC 60.364 66.667 7.57 0.00 0.00 4.16
2777 3214 3.217231 CGGCCTCTACACCGGAAT 58.783 61.111 9.46 0.00 45.74 3.01
2778 3215 1.067582 CGGCCTCTACACCGGAATC 59.932 63.158 9.46 0.00 45.74 2.52
2779 3216 1.672854 CGGCCTCTACACCGGAATCA 61.673 60.000 9.46 0.00 45.74 2.57
2780 3217 0.539986 GGCCTCTACACCGGAATCAA 59.460 55.000 9.46 0.00 0.00 2.57
2781 3218 1.653151 GCCTCTACACCGGAATCAAC 58.347 55.000 9.46 0.00 0.00 3.18
2782 3219 1.066430 GCCTCTACACCGGAATCAACA 60.066 52.381 9.46 0.00 0.00 3.33
2783 3220 2.893637 CCTCTACACCGGAATCAACAG 58.106 52.381 9.46 0.00 0.00 3.16
2784 3221 2.233922 CCTCTACACCGGAATCAACAGT 59.766 50.000 9.46 0.00 0.00 3.55
2785 3222 3.306780 CCTCTACACCGGAATCAACAGTT 60.307 47.826 9.46 0.00 0.00 3.16
2786 3223 4.081862 CCTCTACACCGGAATCAACAGTTA 60.082 45.833 9.46 0.00 0.00 2.24
2787 3224 4.813027 TCTACACCGGAATCAACAGTTAC 58.187 43.478 9.46 0.00 0.00 2.50
2788 3225 2.409975 ACACCGGAATCAACAGTTACG 58.590 47.619 9.46 0.00 32.78 3.18
2789 3226 2.036217 ACACCGGAATCAACAGTTACGA 59.964 45.455 9.46 0.00 34.91 3.43
2790 3227 2.410730 CACCGGAATCAACAGTTACGAC 59.589 50.000 9.46 0.00 34.91 4.34
2791 3228 2.298163 ACCGGAATCAACAGTTACGACT 59.702 45.455 9.46 0.00 34.91 4.18
2792 3229 3.243975 ACCGGAATCAACAGTTACGACTT 60.244 43.478 9.46 0.00 34.91 3.01
2793 3230 3.367025 CCGGAATCAACAGTTACGACTTC 59.633 47.826 0.00 0.00 34.91 3.01
2794 3231 3.985279 CGGAATCAACAGTTACGACTTCA 59.015 43.478 0.00 0.00 34.91 3.02
2795 3232 4.446385 CGGAATCAACAGTTACGACTTCAA 59.554 41.667 0.00 0.00 34.91 2.69
2796 3233 5.120208 CGGAATCAACAGTTACGACTTCAAT 59.880 40.000 0.00 0.00 34.91 2.57
2797 3234 6.347402 CGGAATCAACAGTTACGACTTCAATT 60.347 38.462 0.00 0.00 34.91 2.32
2798 3235 7.360361 GGAATCAACAGTTACGACTTCAATTT 58.640 34.615 0.00 0.00 32.54 1.82
2799 3236 7.534239 GGAATCAACAGTTACGACTTCAATTTC 59.466 37.037 0.00 0.00 32.54 2.17
2800 3237 5.969741 TCAACAGTTACGACTTCAATTTCG 58.030 37.500 0.00 0.00 41.14 3.46
2801 3238 5.749588 TCAACAGTTACGACTTCAATTTCGA 59.250 36.000 4.37 0.00 38.63 3.71
2802 3239 5.824243 ACAGTTACGACTTCAATTTCGAG 57.176 39.130 4.37 0.00 38.63 4.04
2803 3240 5.526115 ACAGTTACGACTTCAATTTCGAGA 58.474 37.500 4.37 0.00 38.63 4.04
2804 3241 5.401674 ACAGTTACGACTTCAATTTCGAGAC 59.598 40.000 4.37 2.99 38.63 3.36
2805 3242 4.922103 AGTTACGACTTCAATTTCGAGACC 59.078 41.667 4.37 0.00 38.63 3.85
2806 3243 2.325761 ACGACTTCAATTTCGAGACCG 58.674 47.619 4.37 0.00 38.63 4.79
2807 3244 2.288030 ACGACTTCAATTTCGAGACCGT 60.288 45.455 4.37 0.00 38.63 4.83
2808 3245 2.729882 CGACTTCAATTTCGAGACCGTT 59.270 45.455 0.00 0.00 37.43 4.44
2809 3246 3.421826 CGACTTCAATTTCGAGACCGTTG 60.422 47.826 0.00 0.00 37.43 4.10
2810 3247 3.724374 ACTTCAATTTCGAGACCGTTGA 58.276 40.909 0.00 0.00 37.05 3.18
2811 3248 3.741344 ACTTCAATTTCGAGACCGTTGAG 59.259 43.478 0.00 0.00 32.50 3.02
2813 3250 2.297880 TCAATTTCGAGACCGTTGAGGA 59.702 45.455 0.00 0.00 45.00 3.71
2814 3251 2.656560 ATTTCGAGACCGTTGAGGAG 57.343 50.000 0.00 0.00 45.00 3.69
2815 3252 1.612676 TTTCGAGACCGTTGAGGAGA 58.387 50.000 0.00 0.00 45.00 3.71
2816 3253 1.612676 TTCGAGACCGTTGAGGAGAA 58.387 50.000 0.00 0.00 45.00 2.87
2817 3254 1.166129 TCGAGACCGTTGAGGAGAAG 58.834 55.000 0.00 0.00 45.00 2.85
2818 3255 0.456995 CGAGACCGTTGAGGAGAAGC 60.457 60.000 0.00 0.00 45.00 3.86
2819 3256 0.892063 GAGACCGTTGAGGAGAAGCT 59.108 55.000 0.00 0.00 45.00 3.74
2820 3257 0.605589 AGACCGTTGAGGAGAAGCTG 59.394 55.000 0.00 0.00 45.00 4.24
2821 3258 1.004440 ACCGTTGAGGAGAAGCTGC 60.004 57.895 0.00 0.00 45.00 5.25
2822 3259 1.743252 CCGTTGAGGAGAAGCTGCC 60.743 63.158 0.00 0.00 45.00 4.85
2823 3260 2.097038 CGTTGAGGAGAAGCTGCCG 61.097 63.158 0.00 0.00 0.00 5.69
2824 3261 1.743252 GTTGAGGAGAAGCTGCCGG 60.743 63.158 0.00 0.00 0.00 6.13
2825 3262 1.913262 TTGAGGAGAAGCTGCCGGA 60.913 57.895 5.05 0.00 0.00 5.14
2826 3263 1.892819 TTGAGGAGAAGCTGCCGGAG 61.893 60.000 5.05 0.10 0.00 4.63
2827 3264 2.038007 AGGAGAAGCTGCCGGAGA 59.962 61.111 5.05 0.00 0.00 3.71
2828 3265 2.015227 GAGGAGAAGCTGCCGGAGAG 62.015 65.000 5.05 0.00 0.00 3.20
2829 3266 2.498726 GAGAAGCTGCCGGAGAGG 59.501 66.667 5.05 0.00 44.97 3.69
2830 3267 2.038007 AGAAGCTGCCGGAGAGGA 59.962 61.111 5.05 0.00 45.00 3.71
2831 3268 1.608717 GAGAAGCTGCCGGAGAGGAA 61.609 60.000 5.05 0.00 45.00 3.36
2832 3269 1.448717 GAAGCTGCCGGAGAGGAAC 60.449 63.158 5.05 0.00 45.00 3.62
2833 3270 2.860972 GAAGCTGCCGGAGAGGAACC 62.861 65.000 5.05 0.00 45.00 3.62
2834 3271 4.475135 GCTGCCGGAGAGGAACCC 62.475 72.222 5.05 0.00 45.00 4.11
2835 3272 4.148825 CTGCCGGAGAGGAACCCG 62.149 72.222 5.05 0.00 45.00 5.28
2840 3277 4.516195 GGAGAGGAACCCGAGCGC 62.516 72.222 0.00 0.00 0.00 5.92
2841 3278 3.453679 GAGAGGAACCCGAGCGCT 61.454 66.667 11.27 11.27 0.00 5.92
2842 3279 2.997897 AGAGGAACCCGAGCGCTT 60.998 61.111 13.26 0.00 0.00 4.68
2843 3280 2.815647 GAGGAACCCGAGCGCTTG 60.816 66.667 18.28 18.28 0.00 4.01
2844 3281 3.296709 GAGGAACCCGAGCGCTTGA 62.297 63.158 26.61 0.00 0.00 3.02
2845 3282 2.125106 GGAACCCGAGCGCTTGAT 60.125 61.111 26.61 10.86 0.00 2.57
2846 3283 2.464459 GGAACCCGAGCGCTTGATG 61.464 63.158 26.61 17.98 0.00 3.07
2847 3284 1.447838 GAACCCGAGCGCTTGATGA 60.448 57.895 26.61 0.00 0.00 2.92
2848 3285 1.424493 GAACCCGAGCGCTTGATGAG 61.424 60.000 26.61 13.38 0.00 2.90
2849 3286 2.172483 AACCCGAGCGCTTGATGAGT 62.172 55.000 26.61 14.01 0.00 3.41
2850 3287 1.448540 CCCGAGCGCTTGATGAGTT 60.449 57.895 26.61 0.00 0.00 3.01
2851 3288 1.021390 CCCGAGCGCTTGATGAGTTT 61.021 55.000 26.61 0.00 0.00 2.66
2852 3289 0.095935 CCGAGCGCTTGATGAGTTTG 59.904 55.000 26.61 2.42 0.00 2.93
2853 3290 0.519999 CGAGCGCTTGATGAGTTTGC 60.520 55.000 20.57 0.00 0.00 3.68
2854 3291 0.801251 GAGCGCTTGATGAGTTTGCT 59.199 50.000 13.26 0.00 34.61 3.91
2855 3292 1.198637 GAGCGCTTGATGAGTTTGCTT 59.801 47.619 13.26 0.00 32.95 3.91
2856 3293 1.198637 AGCGCTTGATGAGTTTGCTTC 59.801 47.619 2.64 0.00 30.00 3.86
2857 3294 1.069022 GCGCTTGATGAGTTTGCTTCA 60.069 47.619 0.00 0.00 0.00 3.02
2858 3295 2.415090 GCGCTTGATGAGTTTGCTTCAT 60.415 45.455 0.00 0.00 0.00 2.57
2859 3296 3.829948 CGCTTGATGAGTTTGCTTCATT 58.170 40.909 0.00 0.00 0.00 2.57
2860 3297 4.672542 GCGCTTGATGAGTTTGCTTCATTA 60.673 41.667 0.00 0.00 0.00 1.90
2861 3298 5.575957 CGCTTGATGAGTTTGCTTCATTAT 58.424 37.500 0.00 0.00 0.00 1.28
2862 3299 5.680229 CGCTTGATGAGTTTGCTTCATTATC 59.320 40.000 0.00 0.00 0.00 1.75
2863 3300 6.457934 CGCTTGATGAGTTTGCTTCATTATCT 60.458 38.462 0.00 0.00 0.00 1.98
2864 3301 6.911511 GCTTGATGAGTTTGCTTCATTATCTC 59.088 38.462 0.00 0.00 0.00 2.75
2865 3302 7.414873 GCTTGATGAGTTTGCTTCATTATCTCA 60.415 37.037 0.00 0.00 35.47 3.27
2866 3303 7.926674 TGATGAGTTTGCTTCATTATCTCAA 57.073 32.000 0.00 0.00 34.84 3.02
2867 3304 8.515695 TGATGAGTTTGCTTCATTATCTCAAT 57.484 30.769 0.00 0.00 34.84 2.57
2868 3305 9.617523 TGATGAGTTTGCTTCATTATCTCAATA 57.382 29.630 0.00 0.00 34.84 1.90
2869 3306 9.875675 GATGAGTTTGCTTCATTATCTCAATAC 57.124 33.333 0.00 0.00 34.84 1.89
2870 3307 8.791327 TGAGTTTGCTTCATTATCTCAATACA 57.209 30.769 0.00 0.00 0.00 2.29
2871 3308 9.230122 TGAGTTTGCTTCATTATCTCAATACAA 57.770 29.630 0.00 0.00 0.00 2.41
2885 3322 8.742125 ATCTCAATACAATATCTTACTCCCCA 57.258 34.615 0.00 0.00 0.00 4.96
2886 3323 8.742125 TCTCAATACAATATCTTACTCCCCAT 57.258 34.615 0.00 0.00 0.00 4.00
2887 3324 9.837681 TCTCAATACAATATCTTACTCCCCATA 57.162 33.333 0.00 0.00 0.00 2.74
2926 3363 9.555727 AGAGTGTTTAAATTGCTACTTTAGTGA 57.444 29.630 0.00 0.00 0.00 3.41
2935 3372 8.997621 AATTGCTACTTTAGTGATCTAAACGA 57.002 30.769 0.00 0.00 40.05 3.85
2936 3373 9.601217 AATTGCTACTTTAGTGATCTAAACGAT 57.399 29.630 0.00 0.00 40.05 3.73
2948 3385 6.636562 GATCTAAACGATCTTACAGAGGGA 57.363 41.667 0.00 0.00 44.21 4.20
2949 3386 6.642707 ATCTAAACGATCTTACAGAGGGAG 57.357 41.667 0.00 0.00 0.00 4.30
2950 3387 5.507637 TCTAAACGATCTTACAGAGGGAGT 58.492 41.667 0.00 0.00 0.00 3.85
2951 3388 6.656902 TCTAAACGATCTTACAGAGGGAGTA 58.343 40.000 0.00 0.00 0.00 2.59
2952 3389 5.838531 AAACGATCTTACAGAGGGAGTAG 57.161 43.478 0.00 0.00 0.00 2.57
2953 3390 3.215975 ACGATCTTACAGAGGGAGTAGC 58.784 50.000 0.00 0.00 0.00 3.58
2954 3391 3.215151 CGATCTTACAGAGGGAGTAGCA 58.785 50.000 0.00 0.00 0.00 3.49
2955 3392 3.823873 CGATCTTACAGAGGGAGTAGCAT 59.176 47.826 0.00 0.00 0.00 3.79
2956 3393 4.320861 CGATCTTACAGAGGGAGTAGCATG 60.321 50.000 0.00 0.00 0.00 4.06
2957 3394 2.695666 TCTTACAGAGGGAGTAGCATGC 59.304 50.000 10.51 10.51 0.00 4.06
2958 3395 2.159179 TACAGAGGGAGTAGCATGCA 57.841 50.000 21.98 2.77 0.00 3.96
2959 3396 1.504912 ACAGAGGGAGTAGCATGCAT 58.495 50.000 21.98 4.95 0.00 3.96
2960 3397 1.415659 ACAGAGGGAGTAGCATGCATC 59.584 52.381 21.98 14.27 0.00 3.91
2961 3398 1.693062 CAGAGGGAGTAGCATGCATCT 59.307 52.381 21.98 16.94 31.44 2.90
2962 3399 2.104451 CAGAGGGAGTAGCATGCATCTT 59.896 50.000 21.98 0.61 28.59 2.40
2963 3400 2.104451 AGAGGGAGTAGCATGCATCTTG 59.896 50.000 21.98 0.00 26.14 3.02
2964 3401 1.842562 AGGGAGTAGCATGCATCTTGT 59.157 47.619 21.98 0.00 0.00 3.16
2965 3402 1.945394 GGGAGTAGCATGCATCTTGTG 59.055 52.381 21.98 0.00 0.00 3.33
2966 3403 2.636830 GGAGTAGCATGCATCTTGTGT 58.363 47.619 21.98 0.00 0.00 3.72
2967 3404 2.353889 GGAGTAGCATGCATCTTGTGTG 59.646 50.000 21.98 0.00 0.00 3.82
2968 3405 1.741706 AGTAGCATGCATCTTGTGTGC 59.258 47.619 21.98 0.00 42.81 4.57
2969 3406 0.728542 TAGCATGCATCTTGTGTGCG 59.271 50.000 21.98 0.00 45.37 5.34
2970 3407 2.156446 GCATGCATCTTGTGTGCGC 61.156 57.895 14.21 0.00 45.37 6.09
2971 3408 1.504900 CATGCATCTTGTGTGCGCT 59.495 52.632 9.73 0.00 45.37 5.92
2972 3409 0.109458 CATGCATCTTGTGTGCGCTT 60.109 50.000 9.73 0.00 45.37 4.68
2973 3410 0.599558 ATGCATCTTGTGTGCGCTTT 59.400 45.000 9.73 0.00 45.37 3.51
2974 3411 0.385029 TGCATCTTGTGTGCGCTTTT 59.615 45.000 9.73 0.00 45.37 2.27
2975 3412 1.055338 GCATCTTGTGTGCGCTTTTC 58.945 50.000 9.73 0.00 32.29 2.29
2976 3413 1.321016 CATCTTGTGTGCGCTTTTCG 58.679 50.000 9.73 0.00 42.12 3.46
2977 3414 0.238289 ATCTTGTGTGCGCTTTTCGG 59.762 50.000 9.73 0.00 38.94 4.30
2978 3415 1.092921 TCTTGTGTGCGCTTTTCGGT 61.093 50.000 9.73 0.00 38.94 4.69
2979 3416 0.248458 CTTGTGTGCGCTTTTCGGTT 60.248 50.000 9.73 0.00 38.94 4.44
2980 3417 0.171455 TTGTGTGCGCTTTTCGGTTT 59.829 45.000 9.73 0.00 38.94 3.27
2981 3418 1.015109 TGTGTGCGCTTTTCGGTTTA 58.985 45.000 9.73 0.00 38.94 2.01
2982 3419 1.604755 TGTGTGCGCTTTTCGGTTTAT 59.395 42.857 9.73 0.00 38.94 1.40
2983 3420 2.033550 TGTGTGCGCTTTTCGGTTTATT 59.966 40.909 9.73 0.00 38.94 1.40
2984 3421 3.250280 TGTGTGCGCTTTTCGGTTTATTA 59.750 39.130 9.73 0.00 38.94 0.98
2985 3422 4.220572 GTGTGCGCTTTTCGGTTTATTAA 58.779 39.130 9.73 0.00 38.94 1.40
2986 3423 4.676018 GTGTGCGCTTTTCGGTTTATTAAA 59.324 37.500 9.73 0.00 38.94 1.52
2987 3424 4.676018 TGTGCGCTTTTCGGTTTATTAAAC 59.324 37.500 9.73 10.26 40.65 2.01
3007 3444 9.665719 ATTAAACCAGCTTTTACAATAAATGGG 57.334 29.630 0.00 0.00 0.00 4.00
3008 3445 6.680148 AACCAGCTTTTACAATAAATGGGT 57.320 33.333 0.00 0.00 0.00 4.51
3009 3446 6.036577 ACCAGCTTTTACAATAAATGGGTG 57.963 37.500 0.00 6.03 0.00 4.61
3010 3447 4.869861 CCAGCTTTTACAATAAATGGGTGC 59.130 41.667 0.00 0.00 0.00 5.01
3011 3448 4.562394 CAGCTTTTACAATAAATGGGTGCG 59.438 41.667 0.00 0.00 0.00 5.34
3012 3449 4.461081 AGCTTTTACAATAAATGGGTGCGA 59.539 37.500 0.00 0.00 0.00 5.10
3013 3450 4.561213 GCTTTTACAATAAATGGGTGCGAC 59.439 41.667 0.00 0.00 0.00 5.19
3014 3451 5.704888 CTTTTACAATAAATGGGTGCGACA 58.295 37.500 0.00 0.00 0.00 4.35
3015 3452 5.906113 TTTACAATAAATGGGTGCGACAT 57.094 34.783 0.00 0.00 0.00 3.06
3016 3453 3.781079 ACAATAAATGGGTGCGACATG 57.219 42.857 0.00 0.00 0.00 3.21
3017 3454 3.088532 ACAATAAATGGGTGCGACATGT 58.911 40.909 0.00 0.00 0.00 3.21
3018 3455 4.265893 ACAATAAATGGGTGCGACATGTA 58.734 39.130 0.00 0.00 0.00 2.29
3019 3456 4.702612 ACAATAAATGGGTGCGACATGTAA 59.297 37.500 0.00 0.00 0.00 2.41
3020 3457 5.163663 ACAATAAATGGGTGCGACATGTAAG 60.164 40.000 0.00 0.00 0.00 2.34
3021 3458 2.489938 AATGGGTGCGACATGTAAGT 57.510 45.000 0.00 0.00 0.00 2.24
3022 3459 3.620427 AATGGGTGCGACATGTAAGTA 57.380 42.857 0.00 0.00 0.00 2.24
3023 3460 2.373540 TGGGTGCGACATGTAAGTAC 57.626 50.000 0.00 5.90 0.00 2.73
3024 3461 1.274596 GGGTGCGACATGTAAGTACG 58.725 55.000 0.00 0.00 0.00 3.67
3025 3462 1.403249 GGGTGCGACATGTAAGTACGT 60.403 52.381 0.00 0.00 0.00 3.57
3026 3463 1.652124 GGTGCGACATGTAAGTACGTG 59.348 52.381 0.00 8.77 46.08 4.49
3036 3473 4.275838 TGTAAGTACGTGTTTGGTTTGC 57.724 40.909 0.00 0.00 0.00 3.68
3037 3474 3.688185 TGTAAGTACGTGTTTGGTTTGCA 59.312 39.130 0.00 0.00 0.00 4.08
3038 3475 4.335874 TGTAAGTACGTGTTTGGTTTGCAT 59.664 37.500 0.00 0.00 0.00 3.96
3039 3476 3.347958 AGTACGTGTTTGGTTTGCATG 57.652 42.857 0.00 0.00 0.00 4.06
3040 3477 2.685897 AGTACGTGTTTGGTTTGCATGT 59.314 40.909 0.00 0.00 36.48 3.21
3041 3478 3.878103 AGTACGTGTTTGGTTTGCATGTA 59.122 39.130 0.00 0.00 34.62 2.29
3042 3479 3.073144 ACGTGTTTGGTTTGCATGTAC 57.927 42.857 0.00 0.00 31.45 2.90
3043 3480 2.685897 ACGTGTTTGGTTTGCATGTACT 59.314 40.909 0.00 0.00 31.45 2.73
3044 3481 3.129638 ACGTGTTTGGTTTGCATGTACTT 59.870 39.130 0.00 0.00 31.45 2.24
3045 3482 4.335874 ACGTGTTTGGTTTGCATGTACTTA 59.664 37.500 0.00 0.00 31.45 2.24
3046 3483 5.009210 ACGTGTTTGGTTTGCATGTACTTAT 59.991 36.000 0.00 0.00 31.45 1.73
3047 3484 5.341993 CGTGTTTGGTTTGCATGTACTTATG 59.658 40.000 0.00 0.00 0.00 1.90
3062 3499 9.158364 CATGTACTTATGCAATGAACGATAAAC 57.842 33.333 0.00 0.00 0.00 2.01
3063 3500 8.257830 TGTACTTATGCAATGAACGATAAACA 57.742 30.769 0.00 0.00 0.00 2.83
3064 3501 8.722394 TGTACTTATGCAATGAACGATAAACAA 58.278 29.630 0.00 0.00 0.00 2.83
3065 3502 8.995906 GTACTTATGCAATGAACGATAAACAAC 58.004 33.333 0.00 0.00 0.00 3.32
3066 3503 7.589395 ACTTATGCAATGAACGATAAACAACA 58.411 30.769 0.00 0.00 0.00 3.33
3067 3504 8.079203 ACTTATGCAATGAACGATAAACAACAA 58.921 29.630 0.00 0.00 0.00 2.83
3068 3505 8.978564 TTATGCAATGAACGATAAACAACAAT 57.021 26.923 0.00 0.00 0.00 2.71
3070 3507 8.619146 ATGCAATGAACGATAAACAACAATAG 57.381 30.769 0.00 0.00 0.00 1.73
3071 3508 7.589395 TGCAATGAACGATAAACAACAATAGT 58.411 30.769 0.00 0.00 0.00 2.12
3072 3509 8.079203 TGCAATGAACGATAAACAACAATAGTT 58.921 29.630 0.00 0.00 38.88 2.24
3073 3510 8.911662 GCAATGAACGATAAACAACAATAGTTT 58.088 29.630 0.00 0.00 41.63 2.66
3137 3574 2.046314 GCTGCCCTTACGAGCCAA 60.046 61.111 0.00 0.00 0.00 4.52
3138 3575 1.674322 GCTGCCCTTACGAGCCAAA 60.674 57.895 0.00 0.00 0.00 3.28
3139 3576 1.923227 GCTGCCCTTACGAGCCAAAC 61.923 60.000 0.00 0.00 0.00 2.93
3140 3577 1.302993 TGCCCTTACGAGCCAAACC 60.303 57.895 0.00 0.00 0.00 3.27
3141 3578 1.002502 GCCCTTACGAGCCAAACCT 60.003 57.895 0.00 0.00 0.00 3.50
3142 3579 0.251073 GCCCTTACGAGCCAAACCTA 59.749 55.000 0.00 0.00 0.00 3.08
3143 3580 1.134189 GCCCTTACGAGCCAAACCTAT 60.134 52.381 0.00 0.00 0.00 2.57
3144 3581 2.835027 CCCTTACGAGCCAAACCTATC 58.165 52.381 0.00 0.00 0.00 2.08
3145 3582 2.434702 CCCTTACGAGCCAAACCTATCT 59.565 50.000 0.00 0.00 0.00 1.98
3146 3583 3.492829 CCCTTACGAGCCAAACCTATCTC 60.493 52.174 0.00 0.00 0.00 2.75
3147 3584 3.132289 CCTTACGAGCCAAACCTATCTCA 59.868 47.826 0.00 0.00 0.00 3.27
3148 3585 4.382685 CCTTACGAGCCAAACCTATCTCAA 60.383 45.833 0.00 0.00 0.00 3.02
3149 3586 2.973945 ACGAGCCAAACCTATCTCAAC 58.026 47.619 0.00 0.00 0.00 3.18
3150 3587 2.280628 CGAGCCAAACCTATCTCAACC 58.719 52.381 0.00 0.00 0.00 3.77
3151 3588 2.093447 CGAGCCAAACCTATCTCAACCT 60.093 50.000 0.00 0.00 0.00 3.50
3152 3589 3.132289 CGAGCCAAACCTATCTCAACCTA 59.868 47.826 0.00 0.00 0.00 3.08
3153 3590 4.202264 CGAGCCAAACCTATCTCAACCTAT 60.202 45.833 0.00 0.00 0.00 2.57
3154 3591 5.297569 AGCCAAACCTATCTCAACCTATC 57.702 43.478 0.00 0.00 0.00 2.08
3155 3592 4.058817 GCCAAACCTATCTCAACCTATCG 58.941 47.826 0.00 0.00 0.00 2.92
3156 3593 4.443034 GCCAAACCTATCTCAACCTATCGT 60.443 45.833 0.00 0.00 0.00 3.73
3157 3594 5.050490 CCAAACCTATCTCAACCTATCGTG 58.950 45.833 0.00 0.00 0.00 4.35
3158 3595 5.395324 CCAAACCTATCTCAACCTATCGTGT 60.395 44.000 0.00 0.00 0.00 4.49
3159 3596 5.517322 AACCTATCTCAACCTATCGTGTC 57.483 43.478 0.00 0.00 0.00 3.67
3160 3597 4.794334 ACCTATCTCAACCTATCGTGTCT 58.206 43.478 0.00 0.00 0.00 3.41
3161 3598 5.202004 ACCTATCTCAACCTATCGTGTCTT 58.798 41.667 0.00 0.00 0.00 3.01
3162 3599 5.067936 ACCTATCTCAACCTATCGTGTCTTG 59.932 44.000 0.00 0.00 0.00 3.02
3163 3600 3.232213 TCTCAACCTATCGTGTCTTGC 57.768 47.619 0.00 0.00 0.00 4.01
3164 3601 2.560981 TCTCAACCTATCGTGTCTTGCA 59.439 45.455 0.00 0.00 0.00 4.08
3165 3602 2.668457 CTCAACCTATCGTGTCTTGCAC 59.332 50.000 0.00 0.00 44.36 4.57
3174 3611 2.405892 GTGTCTTGCACATTGTCACC 57.594 50.000 0.00 0.00 46.91 4.02
3175 3612 1.001378 GTGTCTTGCACATTGTCACCC 60.001 52.381 0.00 0.00 46.91 4.61
3176 3613 1.317613 GTCTTGCACATTGTCACCCA 58.682 50.000 0.00 0.00 0.00 4.51
3177 3614 1.001378 GTCTTGCACATTGTCACCCAC 60.001 52.381 0.00 0.00 0.00 4.61
3178 3615 0.314935 CTTGCACATTGTCACCCACC 59.685 55.000 0.00 0.00 0.00 4.61
3179 3616 1.451337 TTGCACATTGTCACCCACCG 61.451 55.000 0.00 0.00 0.00 4.94
3180 3617 2.953821 CACATTGTCACCCACCGC 59.046 61.111 0.00 0.00 0.00 5.68
3181 3618 1.600636 CACATTGTCACCCACCGCT 60.601 57.895 0.00 0.00 0.00 5.52
3182 3619 1.302511 ACATTGTCACCCACCGCTC 60.303 57.895 0.00 0.00 0.00 5.03
3183 3620 1.003355 CATTGTCACCCACCGCTCT 60.003 57.895 0.00 0.00 0.00 4.09
3184 3621 0.606401 CATTGTCACCCACCGCTCTT 60.606 55.000 0.00 0.00 0.00 2.85
3185 3622 0.606401 ATTGTCACCCACCGCTCTTG 60.606 55.000 0.00 0.00 0.00 3.02
3186 3623 3.050275 GTCACCCACCGCTCTTGC 61.050 66.667 0.00 0.00 0.00 4.01
3187 3624 4.329545 TCACCCACCGCTCTTGCC 62.330 66.667 0.00 0.00 35.36 4.52
3188 3625 4.641645 CACCCACCGCTCTTGCCA 62.642 66.667 0.00 0.00 35.36 4.92
3189 3626 3.884774 ACCCACCGCTCTTGCCAA 61.885 61.111 0.00 0.00 35.36 4.52
3190 3627 2.597217 CCCACCGCTCTTGCCAAA 60.597 61.111 0.00 0.00 35.36 3.28
3191 3628 2.199652 CCCACCGCTCTTGCCAAAA 61.200 57.895 0.00 0.00 35.36 2.44
3192 3629 1.739049 CCACCGCTCTTGCCAAAAA 59.261 52.632 0.00 0.00 35.36 1.94
3193 3630 0.597377 CCACCGCTCTTGCCAAAAAC 60.597 55.000 0.00 0.00 35.36 2.43
3194 3631 0.597377 CACCGCTCTTGCCAAAAACC 60.597 55.000 0.00 0.00 35.36 3.27
3195 3632 1.040339 ACCGCTCTTGCCAAAAACCA 61.040 50.000 0.00 0.00 35.36 3.67
3196 3633 0.103937 CCGCTCTTGCCAAAAACCAA 59.896 50.000 0.00 0.00 35.36 3.67
3197 3634 1.270252 CCGCTCTTGCCAAAAACCAAT 60.270 47.619 0.00 0.00 35.36 3.16
3198 3635 2.029470 CCGCTCTTGCCAAAAACCAATA 60.029 45.455 0.00 0.00 35.36 1.90
3199 3636 3.553922 CCGCTCTTGCCAAAAACCAATAA 60.554 43.478 0.00 0.00 35.36 1.40
3200 3637 4.054671 CGCTCTTGCCAAAAACCAATAAA 58.945 39.130 0.00 0.00 35.36 1.40
3201 3638 4.690280 CGCTCTTGCCAAAAACCAATAAAT 59.310 37.500 0.00 0.00 35.36 1.40
3202 3639 5.179182 CGCTCTTGCCAAAAACCAATAAATT 59.821 36.000 0.00 0.00 35.36 1.82
3203 3640 6.602179 GCTCTTGCCAAAAACCAATAAATTC 58.398 36.000 0.00 0.00 0.00 2.17
3204 3641 6.427853 GCTCTTGCCAAAAACCAATAAATTCT 59.572 34.615 0.00 0.00 0.00 2.40
3205 3642 7.602265 GCTCTTGCCAAAAACCAATAAATTCTA 59.398 33.333 0.00 0.00 0.00 2.10
3206 3643 9.657419 CTCTTGCCAAAAACCAATAAATTCTAT 57.343 29.630 0.00 0.00 0.00 1.98
3207 3644 9.651913 TCTTGCCAAAAACCAATAAATTCTATC 57.348 29.630 0.00 0.00 0.00 2.08
3208 3645 9.657419 CTTGCCAAAAACCAATAAATTCTATCT 57.343 29.630 0.00 0.00 0.00 1.98
3210 3647 9.434420 TGCCAAAAACCAATAAATTCTATCTTG 57.566 29.630 0.00 0.00 0.00 3.02
3211 3648 8.882736 GCCAAAAACCAATAAATTCTATCTTGG 58.117 33.333 0.00 0.00 41.67 3.61
3245 3682 8.457238 AAAGAATAGGAATGAGCTTGAATACC 57.543 34.615 0.00 0.00 0.00 2.73
3246 3683 6.226787 AGAATAGGAATGAGCTTGAATACCG 58.773 40.000 0.00 0.00 0.00 4.02
3247 3684 2.565841 AGGAATGAGCTTGAATACCGC 58.434 47.619 0.00 0.00 0.00 5.68
3248 3685 2.171448 AGGAATGAGCTTGAATACCGCT 59.829 45.455 0.00 0.00 36.57 5.52
3249 3686 2.945668 GGAATGAGCTTGAATACCGCTT 59.054 45.455 0.00 0.00 33.47 4.68
3250 3687 3.242870 GGAATGAGCTTGAATACCGCTTG 60.243 47.826 0.00 0.00 33.47 4.01
3251 3688 2.472695 TGAGCTTGAATACCGCTTGT 57.527 45.000 0.00 0.00 33.47 3.16
3252 3689 3.603158 TGAGCTTGAATACCGCTTGTA 57.397 42.857 0.00 0.00 33.47 2.41
3253 3690 3.932822 TGAGCTTGAATACCGCTTGTAA 58.067 40.909 0.00 0.00 33.47 2.41
3254 3691 4.320023 TGAGCTTGAATACCGCTTGTAAA 58.680 39.130 0.00 0.00 33.47 2.01
3255 3692 4.941263 TGAGCTTGAATACCGCTTGTAAAT 59.059 37.500 0.00 0.00 33.47 1.40
3256 3693 6.110033 TGAGCTTGAATACCGCTTGTAAATA 58.890 36.000 0.00 0.00 33.47 1.40
3257 3694 6.596106 TGAGCTTGAATACCGCTTGTAAATAA 59.404 34.615 0.00 0.00 33.47 1.40
3258 3695 7.282224 TGAGCTTGAATACCGCTTGTAAATAAT 59.718 33.333 0.00 0.00 33.47 1.28
3259 3696 7.417612 AGCTTGAATACCGCTTGTAAATAATG 58.582 34.615 0.00 0.00 31.94 1.90
3260 3697 7.282224 AGCTTGAATACCGCTTGTAAATAATGA 59.718 33.333 0.00 0.00 31.94 2.57
3261 3698 7.913297 GCTTGAATACCGCTTGTAAATAATGAA 59.087 33.333 0.00 0.00 31.94 2.57
3262 3699 9.781834 CTTGAATACCGCTTGTAAATAATGAAA 57.218 29.630 0.00 0.00 31.94 2.69
3303 3740 8.667076 GGTATTGTATTACCTAATTTGACGGT 57.333 34.615 0.00 0.00 38.89 4.83
3304 3741 9.762933 GGTATTGTATTACCTAATTTGACGGTA 57.237 33.333 0.00 0.00 38.89 4.02
3320 3757 2.732001 GGTACGTCATCGAATTTGCC 57.268 50.000 0.00 0.00 40.62 4.52
3321 3758 1.329599 GGTACGTCATCGAATTTGCCC 59.670 52.381 0.00 0.00 40.62 5.36
3322 3759 2.277084 GTACGTCATCGAATTTGCCCT 58.723 47.619 0.00 0.00 40.62 5.19
3323 3760 1.369625 ACGTCATCGAATTTGCCCTC 58.630 50.000 0.00 0.00 40.62 4.30
3324 3761 1.338674 ACGTCATCGAATTTGCCCTCA 60.339 47.619 0.00 0.00 40.62 3.86
3325 3762 1.737236 CGTCATCGAATTTGCCCTCAA 59.263 47.619 0.00 0.00 39.71 3.02
3326 3763 2.161410 CGTCATCGAATTTGCCCTCAAA 59.839 45.455 0.00 0.00 41.67 2.69
3327 3764 3.365868 CGTCATCGAATTTGCCCTCAAAA 60.366 43.478 0.00 0.00 41.21 2.44
3328 3765 4.675146 CGTCATCGAATTTGCCCTCAAAAT 60.675 41.667 0.00 0.00 41.21 1.82
3329 3766 5.170748 GTCATCGAATTTGCCCTCAAAATT 58.829 37.500 0.00 0.00 44.44 1.82
3330 3767 5.062558 GTCATCGAATTTGCCCTCAAAATTG 59.937 40.000 0.00 0.00 44.44 2.32
3331 3768 3.324993 TCGAATTTGCCCTCAAAATTGC 58.675 40.909 0.00 0.00 44.44 3.56
3332 3769 3.065655 CGAATTTGCCCTCAAAATTGCA 58.934 40.909 0.00 0.00 44.44 4.08
3333 3770 3.497640 CGAATTTGCCCTCAAAATTGCAA 59.502 39.130 0.00 0.00 44.44 4.08
3341 3778 8.804912 TTGCCCTCAAAATTGCAAAATATTAT 57.195 26.923 1.71 0.00 40.46 1.28
3342 3779 9.896645 TTGCCCTCAAAATTGCAAAATATTATA 57.103 25.926 1.71 0.00 40.46 0.98
3343 3780 9.323985 TGCCCTCAAAATTGCAAAATATTATAC 57.676 29.630 1.71 0.00 0.00 1.47
3344 3781 9.323985 GCCCTCAAAATTGCAAAATATTATACA 57.676 29.630 1.71 0.00 0.00 2.29
3390 3827 2.005971 AAAGACTTCACGCGGTATCC 57.994 50.000 12.47 0.00 0.00 2.59
3391 3828 0.175073 AAGACTTCACGCGGTATCCC 59.825 55.000 12.47 0.00 0.00 3.85
3392 3829 1.227176 GACTTCACGCGGTATCCCC 60.227 63.158 12.47 0.00 0.00 4.81
3401 3838 3.145233 GGTATCCCCGCCTGGTAC 58.855 66.667 0.00 0.00 0.00 3.34
3402 3839 1.458967 GGTATCCCCGCCTGGTACT 60.459 63.158 0.00 0.00 0.00 2.73
3403 3840 1.746517 GTATCCCCGCCTGGTACTG 59.253 63.158 0.00 0.00 0.00 2.74
3404 3841 2.138179 TATCCCCGCCTGGTACTGC 61.138 63.158 0.00 0.00 0.00 4.40
3408 3845 3.797353 CCGCCTGGTACTGCCCAT 61.797 66.667 0.00 0.00 36.04 4.00
3409 3846 2.514592 CGCCTGGTACTGCCCATG 60.515 66.667 0.00 0.00 36.04 3.66
3410 3847 2.830370 GCCTGGTACTGCCCATGC 60.830 66.667 0.00 0.00 38.64 4.06
3420 3857 2.853159 TGCCCATGCAGTAGAAACG 58.147 52.632 0.00 0.00 44.23 3.60
3421 3858 0.036164 TGCCCATGCAGTAGAAACGT 59.964 50.000 0.00 0.00 44.23 3.99
3422 3859 1.165270 GCCCATGCAGTAGAAACGTT 58.835 50.000 0.00 0.00 37.47 3.99
3423 3860 1.539827 GCCCATGCAGTAGAAACGTTT 59.460 47.619 14.57 14.57 37.47 3.60
3424 3861 2.030274 GCCCATGCAGTAGAAACGTTTT 60.030 45.455 15.89 7.85 37.47 2.43
3425 3862 3.189702 GCCCATGCAGTAGAAACGTTTTA 59.810 43.478 15.89 6.88 37.47 1.52
3426 3863 4.142469 GCCCATGCAGTAGAAACGTTTTAT 60.142 41.667 15.89 9.76 37.47 1.40
3427 3864 5.065474 GCCCATGCAGTAGAAACGTTTTATA 59.935 40.000 15.89 8.75 37.47 0.98
3428 3865 6.483687 CCCATGCAGTAGAAACGTTTTATAC 58.516 40.000 15.89 19.10 0.00 1.47
3429 3866 6.315393 CCCATGCAGTAGAAACGTTTTATACT 59.685 38.462 23.55 23.55 0.00 2.12
3430 3867 7.180079 CCATGCAGTAGAAACGTTTTATACTG 58.820 38.462 34.88 34.88 40.25 2.74
3432 3869 5.245850 GCAGTAGAAACGTTTTATACTGCG 58.754 41.667 40.12 28.01 45.62 5.18
3433 3870 5.245850 CAGTAGAAACGTTTTATACTGCGC 58.754 41.667 32.09 14.78 35.70 6.09
3434 3871 5.061808 CAGTAGAAACGTTTTATACTGCGCT 59.938 40.000 32.09 19.33 35.70 5.92
3435 3872 5.636543 AGTAGAAACGTTTTATACTGCGCTT 59.363 36.000 26.28 11.26 0.00 4.68
3436 3873 5.352643 AGAAACGTTTTATACTGCGCTTT 57.647 34.783 15.89 0.00 0.00 3.51
3437 3874 5.144359 AGAAACGTTTTATACTGCGCTTTG 58.856 37.500 15.89 0.99 0.00 2.77
3438 3875 4.477302 AACGTTTTATACTGCGCTTTGT 57.523 36.364 9.73 7.75 0.00 2.83
3439 3876 3.805823 ACGTTTTATACTGCGCTTTGTG 58.194 40.909 9.73 0.00 0.00 3.33
3440 3877 3.249080 ACGTTTTATACTGCGCTTTGTGT 59.751 39.130 9.73 6.12 0.00 3.72
3441 3878 3.838550 CGTTTTATACTGCGCTTTGTGTC 59.161 43.478 9.73 0.00 0.00 3.67
3442 3879 4.156182 GTTTTATACTGCGCTTTGTGTCC 58.844 43.478 9.73 0.00 0.00 4.02
3443 3880 1.635844 TATACTGCGCTTTGTGTCCG 58.364 50.000 9.73 0.00 0.00 4.79
3444 3881 1.019278 ATACTGCGCTTTGTGTCCGG 61.019 55.000 9.73 0.00 0.00 5.14
3445 3882 2.089887 TACTGCGCTTTGTGTCCGGA 62.090 55.000 9.73 0.00 0.00 5.14
3446 3883 2.664851 TGCGCTTTGTGTCCGGAG 60.665 61.111 3.06 0.00 0.00 4.63
3447 3884 2.357034 GCGCTTTGTGTCCGGAGA 60.357 61.111 3.06 0.00 0.00 3.71
3448 3885 2.383527 GCGCTTTGTGTCCGGAGAG 61.384 63.158 3.06 0.00 0.00 3.20
3449 3886 1.289066 CGCTTTGTGTCCGGAGAGA 59.711 57.895 3.06 0.00 0.00 3.10
3450 3887 0.319555 CGCTTTGTGTCCGGAGAGAA 60.320 55.000 3.06 5.48 0.00 2.87
3451 3888 1.433534 GCTTTGTGTCCGGAGAGAAG 58.566 55.000 3.06 12.23 0.00 2.85
3452 3889 1.000955 GCTTTGTGTCCGGAGAGAAGA 59.999 52.381 21.94 9.79 0.00 2.87
3453 3890 2.678324 CTTTGTGTCCGGAGAGAAGAC 58.322 52.381 3.06 0.00 0.00 3.01
3454 3891 1.699730 TTGTGTCCGGAGAGAAGACA 58.300 50.000 3.06 0.00 38.17 3.41
3456 3893 3.432262 TGTCCGGAGAGAAGACACA 57.568 52.632 3.06 0.00 35.67 3.72
3457 3894 1.248486 TGTCCGGAGAGAAGACACAG 58.752 55.000 3.06 0.00 35.67 3.66
3458 3895 0.109039 GTCCGGAGAGAAGACACAGC 60.109 60.000 3.06 0.00 0.00 4.40
3459 3896 0.539669 TCCGGAGAGAAGACACAGCA 60.540 55.000 0.00 0.00 0.00 4.41
3460 3897 0.389166 CCGGAGAGAAGACACAGCAC 60.389 60.000 0.00 0.00 0.00 4.40
3461 3898 0.315251 CGGAGAGAAGACACAGCACA 59.685 55.000 0.00 0.00 0.00 4.57
3462 3899 1.789506 GGAGAGAAGACACAGCACAC 58.210 55.000 0.00 0.00 0.00 3.82
3463 3900 1.606737 GGAGAGAAGACACAGCACACC 60.607 57.143 0.00 0.00 0.00 4.16
3464 3901 1.342819 GAGAGAAGACACAGCACACCT 59.657 52.381 0.00 0.00 0.00 4.00
3474 3911 2.521708 GCACACCTGTTTGGGCCT 60.522 61.111 4.53 0.00 40.30 5.19
3475 3912 2.859981 GCACACCTGTTTGGGCCTG 61.860 63.158 4.53 0.00 40.30 4.85
3476 3913 1.455587 CACACCTGTTTGGGCCTGT 60.456 57.895 4.53 0.00 41.11 4.00
3477 3914 1.152756 ACACCTGTTTGGGCCTGTC 60.153 57.895 4.53 0.00 41.11 3.51
3478 3915 1.903404 CACCTGTTTGGGCCTGTCC 60.903 63.158 4.53 0.00 41.11 4.02
3479 3916 2.391130 ACCTGTTTGGGCCTGTCCA 61.391 57.895 4.53 0.00 41.11 4.02
3480 3917 1.077265 CCTGTTTGGGCCTGTCCAT 59.923 57.895 4.53 0.00 36.58 3.41
3481 3918 1.252904 CCTGTTTGGGCCTGTCCATG 61.253 60.000 4.53 0.00 36.58 3.66
3482 3919 0.540365 CTGTTTGGGCCTGTCCATGT 60.540 55.000 4.53 0.00 36.58 3.21
3483 3920 0.105760 TGTTTGGGCCTGTCCATGTT 60.106 50.000 4.53 0.00 36.58 2.71
3484 3921 1.047801 GTTTGGGCCTGTCCATGTTT 58.952 50.000 4.53 0.00 36.58 2.83
3485 3922 1.047002 TTTGGGCCTGTCCATGTTTG 58.953 50.000 4.53 0.00 36.58 2.93
3486 3923 1.470996 TTGGGCCTGTCCATGTTTGC 61.471 55.000 4.53 0.00 36.58 3.68
3487 3924 2.568090 GGCCTGTCCATGTTTGCG 59.432 61.111 0.00 0.00 34.01 4.85
3488 3925 1.971167 GGCCTGTCCATGTTTGCGA 60.971 57.895 0.00 0.00 34.01 5.10
3489 3926 1.503542 GCCTGTCCATGTTTGCGAG 59.496 57.895 0.00 0.00 0.00 5.03
3490 3927 1.926511 GCCTGTCCATGTTTGCGAGG 61.927 60.000 0.00 0.00 0.00 4.63
3491 3928 1.503542 CTGTCCATGTTTGCGAGGC 59.496 57.895 0.00 0.00 0.00 4.70
3492 3929 1.926511 CTGTCCATGTTTGCGAGGCC 61.927 60.000 0.00 0.00 0.00 5.19
3493 3930 1.675641 GTCCATGTTTGCGAGGCCT 60.676 57.895 3.86 3.86 0.00 5.19
3494 3931 1.675310 TCCATGTTTGCGAGGCCTG 60.675 57.895 12.00 3.42 0.00 4.85
3495 3932 1.973281 CCATGTTTGCGAGGCCTGT 60.973 57.895 12.00 0.00 0.00 4.00
3496 3933 1.526575 CCATGTTTGCGAGGCCTGTT 61.527 55.000 12.00 0.00 0.00 3.16
3497 3934 0.314935 CATGTTTGCGAGGCCTGTTT 59.685 50.000 12.00 0.00 0.00 2.83
3498 3935 1.039856 ATGTTTGCGAGGCCTGTTTT 58.960 45.000 12.00 0.00 0.00 2.43
3499 3936 0.820871 TGTTTGCGAGGCCTGTTTTT 59.179 45.000 12.00 0.00 0.00 1.94
3537 3974 9.990360 TTAGTTTTCTTGTTTTCCTTTTTGTCT 57.010 25.926 0.00 0.00 0.00 3.41
3538 3975 8.902540 AGTTTTCTTGTTTTCCTTTTTGTCTT 57.097 26.923 0.00 0.00 0.00 3.01
3539 3976 8.988934 AGTTTTCTTGTTTTCCTTTTTGTCTTC 58.011 29.630 0.00 0.00 0.00 2.87
3540 3977 8.769891 GTTTTCTTGTTTTCCTTTTTGTCTTCA 58.230 29.630 0.00 0.00 0.00 3.02
3541 3978 9.500785 TTTTCTTGTTTTCCTTTTTGTCTTCAT 57.499 25.926 0.00 0.00 0.00 2.57
3542 3979 9.500785 TTTCTTGTTTTCCTTTTTGTCTTCATT 57.499 25.926 0.00 0.00 0.00 2.57
3543 3980 9.500785 TTCTTGTTTTCCTTTTTGTCTTCATTT 57.499 25.926 0.00 0.00 0.00 2.32
3544 3981 9.500785 TCTTGTTTTCCTTTTTGTCTTCATTTT 57.499 25.926 0.00 0.00 0.00 1.82
3582 4019 9.810545 ATAATTTGGAACTTCGAAAAAGTTTCA 57.189 25.926 5.51 5.51 42.34 2.69
3585 4022 7.948278 TTGGAACTTCGAAAAAGTTTCAAAA 57.052 28.000 16.40 0.00 46.83 2.44
3586 4023 7.948278 TGGAACTTCGAAAAAGTTTCAAAAA 57.052 28.000 6.94 0.00 41.41 1.94
3587 4024 7.789027 TGGAACTTCGAAAAAGTTTCAAAAAC 58.211 30.769 6.94 0.00 41.41 2.43
3588 4025 6.946037 GGAACTTCGAAAAAGTTTCAAAAACG 59.054 34.615 0.00 0.00 40.27 3.60
3589 4026 7.148934 GGAACTTCGAAAAAGTTTCAAAAACGA 60.149 33.333 0.00 0.00 40.27 3.85
3590 4027 7.260722 ACTTCGAAAAAGTTTCAAAAACGAG 57.739 32.000 0.00 0.00 0.00 4.18
3591 4028 7.079475 ACTTCGAAAAAGTTTCAAAAACGAGA 58.921 30.769 0.00 0.00 0.00 4.04
3592 4029 7.592164 ACTTCGAAAAAGTTTCAAAAACGAGAA 59.408 29.630 0.00 0.00 0.00 2.87
3593 4030 8.455598 TTCGAAAAAGTTTCAAAAACGAGAAT 57.544 26.923 0.00 0.00 0.00 2.40
3594 4031 8.455598 TCGAAAAAGTTTCAAAAACGAGAATT 57.544 26.923 0.00 0.00 0.00 2.17
3595 4032 8.917655 TCGAAAAAGTTTCAAAAACGAGAATTT 58.082 25.926 0.00 0.00 0.00 1.82
3596 4033 8.974570 CGAAAAAGTTTCAAAAACGAGAATTTG 58.025 29.630 0.00 0.00 37.77 2.32
3712 4149 9.631639 GAAACTAAACAAAATTTGACCAATTCG 57.368 29.630 13.19 0.00 33.60 3.34
3713 4150 8.934507 AACTAAACAAAATTTGACCAATTCGA 57.065 26.923 13.19 0.00 33.60 3.71
3714 4151 8.934507 ACTAAACAAAATTTGACCAATTCGAA 57.065 26.923 13.19 0.00 33.60 3.71
3715 4152 9.372369 ACTAAACAAAATTTGACCAATTCGAAA 57.628 25.926 13.19 0.00 33.60 3.46
3722 4159 9.824534 AAAATTTGACCAATTCGAAAAATATGC 57.175 25.926 0.00 0.00 33.60 3.14
3723 4160 8.545229 AATTTGACCAATTCGAAAAATATGCA 57.455 26.923 0.00 0.00 30.88 3.96
3724 4161 8.721019 ATTTGACCAATTCGAAAAATATGCAT 57.279 26.923 3.79 3.79 30.88 3.96
3725 4162 7.522901 TTGACCAATTCGAAAAATATGCATG 57.477 32.000 10.16 0.00 0.00 4.06
3726 4163 6.861144 TGACCAATTCGAAAAATATGCATGA 58.139 32.000 10.16 0.00 0.00 3.07
3727 4164 7.318893 TGACCAATTCGAAAAATATGCATGAA 58.681 30.769 10.16 2.44 0.00 2.57
3728 4165 7.980662 TGACCAATTCGAAAAATATGCATGAAT 59.019 29.630 10.16 4.92 0.00 2.57
3729 4166 8.721019 ACCAATTCGAAAAATATGCATGAATT 57.279 26.923 10.16 10.82 35.58 2.17
3730 4167 9.814899 ACCAATTCGAAAAATATGCATGAATTA 57.185 25.926 10.16 0.00 34.01 1.40
3761 4198 9.893305 ATATCCTAAAAACTCAAAAACTGTTCG 57.107 29.630 0.00 0.00 0.00 3.95
3762 4199 7.148355 TCCTAAAAACTCAAAAACTGTTCGT 57.852 32.000 0.00 0.00 0.00 3.85
3763 4200 7.024768 TCCTAAAAACTCAAAAACTGTTCGTG 58.975 34.615 0.00 0.00 0.00 4.35
3764 4201 7.024768 CCTAAAAACTCAAAAACTGTTCGTGA 58.975 34.615 0.00 0.00 0.00 4.35
3765 4202 6.684609 AAAAACTCAAAAACTGTTCGTGAC 57.315 33.333 0.00 0.00 0.00 3.67
3766 4203 5.622770 AAACTCAAAAACTGTTCGTGACT 57.377 34.783 0.00 0.00 0.00 3.41
3767 4204 5.622770 AACTCAAAAACTGTTCGTGACTT 57.377 34.783 0.00 0.00 0.00 3.01
3768 4205 6.730960 AACTCAAAAACTGTTCGTGACTTA 57.269 33.333 0.00 0.00 0.00 2.24
3769 4206 6.103222 ACTCAAAAACTGTTCGTGACTTAC 57.897 37.500 0.00 0.00 0.00 2.34
3832 4269 7.712264 AAAAATGATCGTGCATTTCAGAAAA 57.288 28.000 15.02 0.00 45.09 2.29
3833 4270 7.894376 AAAATGATCGTGCATTTCAGAAAAT 57.106 28.000 15.02 0.00 45.09 1.82
3877 4314 9.701355 AATGTTCGTTGATTTCAAAAATTGTTC 57.299 25.926 0.00 0.00 37.63 3.18
3878 4315 7.680062 TGTTCGTTGATTTCAAAAATTGTTCC 58.320 30.769 0.00 0.00 37.63 3.62
3879 4316 7.547370 TGTTCGTTGATTTCAAAAATTGTTCCT 59.453 29.630 0.00 0.00 37.63 3.36
3880 4317 7.692908 TCGTTGATTTCAAAAATTGTTCCTC 57.307 32.000 0.00 0.00 37.63 3.71
3881 4318 6.699642 TCGTTGATTTCAAAAATTGTTCCTCC 59.300 34.615 0.00 0.00 37.63 4.30
3882 4319 6.478344 CGTTGATTTCAAAAATTGTTCCTCCA 59.522 34.615 0.00 0.00 37.63 3.86
3883 4320 7.010923 CGTTGATTTCAAAAATTGTTCCTCCAA 59.989 33.333 0.00 0.00 37.63 3.53
3884 4321 8.839343 GTTGATTTCAAAAATTGTTCCTCCAAT 58.161 29.630 0.00 0.00 37.63 3.16
3885 4322 8.977267 TGATTTCAAAAATTGTTCCTCCAATT 57.023 26.923 0.00 0.00 44.71 2.32
3921 4358 9.934190 ATGTTTTTCAATTTTAGACATGTTTGC 57.066 25.926 0.00 0.00 0.00 3.68
3922 4359 8.394121 TGTTTTTCAATTTTAGACATGTTTGCC 58.606 29.630 0.00 0.00 0.00 4.52
3923 4360 8.611757 GTTTTTCAATTTTAGACATGTTTGCCT 58.388 29.630 0.00 0.00 0.00 4.75
3924 4361 9.823647 TTTTTCAATTTTAGACATGTTTGCCTA 57.176 25.926 0.00 0.00 0.00 3.93
3925 4362 9.995003 TTTTCAATTTTAGACATGTTTGCCTAT 57.005 25.926 0.00 0.00 0.00 2.57
3926 4363 9.995003 TTTCAATTTTAGACATGTTTGCCTATT 57.005 25.926 0.00 0.00 0.00 1.73
3927 4364 9.638239 TTCAATTTTAGACATGTTTGCCTATTC 57.362 29.630 0.00 0.00 0.00 1.75
3928 4365 8.250332 TCAATTTTAGACATGTTTGCCTATTCC 58.750 33.333 0.00 0.00 0.00 3.01
3929 4366 7.716799 ATTTTAGACATGTTTGCCTATTCCA 57.283 32.000 0.00 0.00 0.00 3.53
3930 4367 6.757897 TTTAGACATGTTTGCCTATTCCAG 57.242 37.500 0.00 0.00 0.00 3.86
3951 4388 9.844257 TTCCAGGAACATATTTTGAAAATGTTT 57.156 25.926 13.08 3.66 42.35 2.83
3992 4429 9.929180 ATGTTTGCAGATAGTATATATGTTCGT 57.071 29.630 0.00 0.00 0.00 3.85
3993 4430 9.191995 TGTTTGCAGATAGTATATATGTTCGTG 57.808 33.333 0.00 0.00 0.00 4.35
3994 4431 9.406828 GTTTGCAGATAGTATATATGTTCGTGA 57.593 33.333 0.00 0.00 0.00 4.35
3995 4432 9.974980 TTTGCAGATAGTATATATGTTCGTGAA 57.025 29.630 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 6.350103 TGTTATCGTCCCAGTATGCAAATAA 58.650 36.000 0.00 0.00 31.97 1.40
1 2 5.919755 TGTTATCGTCCCAGTATGCAAATA 58.080 37.500 0.00 0.00 31.97 1.40
2 3 4.776349 TGTTATCGTCCCAGTATGCAAAT 58.224 39.130 0.00 0.00 31.97 2.32
3 4 4.209307 TGTTATCGTCCCAGTATGCAAA 57.791 40.909 0.00 0.00 31.97 3.68
4 5 3.897141 TGTTATCGTCCCAGTATGCAA 57.103 42.857 0.00 0.00 31.97 4.08
5 6 3.897141 TTGTTATCGTCCCAGTATGCA 57.103 42.857 0.00 0.00 31.97 3.96
6 7 4.493545 CGTTTTGTTATCGTCCCAGTATGC 60.494 45.833 0.00 0.00 31.97 3.14
7 8 4.033587 CCGTTTTGTTATCGTCCCAGTATG 59.966 45.833 0.00 0.00 0.00 2.39
8 9 4.186159 CCGTTTTGTTATCGTCCCAGTAT 58.814 43.478 0.00 0.00 0.00 2.12
9 10 3.587923 CCGTTTTGTTATCGTCCCAGTA 58.412 45.455 0.00 0.00 0.00 2.74
10 11 2.419667 CCGTTTTGTTATCGTCCCAGT 58.580 47.619 0.00 0.00 0.00 4.00
11 12 1.129811 GCCGTTTTGTTATCGTCCCAG 59.870 52.381 0.00 0.00 0.00 4.45
12 13 1.158434 GCCGTTTTGTTATCGTCCCA 58.842 50.000 0.00 0.00 0.00 4.37
13 14 1.135888 GTGCCGTTTTGTTATCGTCCC 60.136 52.381 0.00 0.00 0.00 4.46
14 15 1.532007 TGTGCCGTTTTGTTATCGTCC 59.468 47.619 0.00 0.00 0.00 4.79
15 16 2.567067 GTGTGCCGTTTTGTTATCGTC 58.433 47.619 0.00 0.00 0.00 4.20
16 17 1.070443 CGTGTGCCGTTTTGTTATCGT 60.070 47.619 0.00 0.00 0.00 3.73
17 18 1.586908 CGTGTGCCGTTTTGTTATCG 58.413 50.000 0.00 0.00 0.00 2.92
28 29 1.288419 TGAAGCATGTACGTGTGCCG 61.288 55.000 16.28 0.00 42.20 5.69
29 30 0.871722 TTGAAGCATGTACGTGTGCC 59.128 50.000 16.28 6.40 42.20 5.01
30 31 2.679355 TTTGAAGCATGTACGTGTGC 57.321 45.000 16.28 12.38 41.57 4.57
31 32 4.843147 TCTTTTTGAAGCATGTACGTGTG 58.157 39.130 16.28 2.88 0.00 3.82
32 33 5.689383 ATCTTTTTGAAGCATGTACGTGT 57.311 34.783 16.28 0.00 0.00 4.49
33 34 6.688385 CCATATCTTTTTGAAGCATGTACGTG 59.312 38.462 10.89 10.89 0.00 4.49
34 35 6.597672 TCCATATCTTTTTGAAGCATGTACGT 59.402 34.615 0.00 0.00 0.00 3.57
35 36 7.015226 TCCATATCTTTTTGAAGCATGTACG 57.985 36.000 0.00 0.00 0.00 3.67
36 37 8.623903 TCATCCATATCTTTTTGAAGCATGTAC 58.376 33.333 0.00 0.00 0.00 2.90
37 38 8.623903 GTCATCCATATCTTTTTGAAGCATGTA 58.376 33.333 0.00 0.00 0.00 2.29
38 39 7.123098 TGTCATCCATATCTTTTTGAAGCATGT 59.877 33.333 0.00 0.00 0.00 3.21
39 40 7.485810 TGTCATCCATATCTTTTTGAAGCATG 58.514 34.615 0.00 0.00 0.00 4.06
40 41 7.649533 TGTCATCCATATCTTTTTGAAGCAT 57.350 32.000 0.00 0.00 0.00 3.79
41 42 7.339976 TCATGTCATCCATATCTTTTTGAAGCA 59.660 33.333 0.00 0.00 30.71 3.91
42 43 7.709947 TCATGTCATCCATATCTTTTTGAAGC 58.290 34.615 0.00 0.00 30.71 3.86
43 44 7.861372 GCTCATGTCATCCATATCTTTTTGAAG 59.139 37.037 0.00 0.00 30.71 3.02
44 45 7.558807 AGCTCATGTCATCCATATCTTTTTGAA 59.441 33.333 0.00 0.00 30.71 2.69
45 46 7.058525 AGCTCATGTCATCCATATCTTTTTGA 58.941 34.615 0.00 0.00 30.71 2.69
46 47 7.273320 AGCTCATGTCATCCATATCTTTTTG 57.727 36.000 0.00 0.00 30.71 2.44
47 48 8.985315 TTAGCTCATGTCATCCATATCTTTTT 57.015 30.769 0.00 0.00 30.71 1.94
48 49 8.216423 ACTTAGCTCATGTCATCCATATCTTTT 58.784 33.333 0.00 0.00 30.71 2.27
49 50 7.660617 CACTTAGCTCATGTCATCCATATCTTT 59.339 37.037 0.00 0.00 30.71 2.52
50 51 7.015974 TCACTTAGCTCATGTCATCCATATCTT 59.984 37.037 0.00 0.00 30.71 2.40
51 52 6.496218 TCACTTAGCTCATGTCATCCATATCT 59.504 38.462 0.00 0.00 30.71 1.98
52 53 6.695429 TCACTTAGCTCATGTCATCCATATC 58.305 40.000 0.00 0.00 30.71 1.63
53 54 6.676990 TCACTTAGCTCATGTCATCCATAT 57.323 37.500 0.00 0.00 30.71 1.78
54 55 6.098838 ACTTCACTTAGCTCATGTCATCCATA 59.901 38.462 0.00 0.00 30.71 2.74
55 56 5.104610 ACTTCACTTAGCTCATGTCATCCAT 60.105 40.000 0.00 0.00 0.00 3.41
56 57 4.223700 ACTTCACTTAGCTCATGTCATCCA 59.776 41.667 0.00 0.00 0.00 3.41
57 58 4.764172 ACTTCACTTAGCTCATGTCATCC 58.236 43.478 0.00 0.00 0.00 3.51
58 59 5.414360 TGACTTCACTTAGCTCATGTCATC 58.586 41.667 0.00 0.00 0.00 2.92
59 60 5.411831 TGACTTCACTTAGCTCATGTCAT 57.588 39.130 0.00 0.00 0.00 3.06
60 61 4.871933 TGACTTCACTTAGCTCATGTCA 57.128 40.909 0.00 0.00 0.00 3.58
61 62 5.466728 TGTTTGACTTCACTTAGCTCATGTC 59.533 40.000 0.00 0.00 0.00 3.06
62 63 5.368145 TGTTTGACTTCACTTAGCTCATGT 58.632 37.500 0.00 0.00 0.00 3.21
63 64 5.929697 TGTTTGACTTCACTTAGCTCATG 57.070 39.130 0.00 0.00 0.00 3.07
64 65 7.161404 TGTATGTTTGACTTCACTTAGCTCAT 58.839 34.615 0.00 0.00 0.00 2.90
65 66 6.521162 TGTATGTTTGACTTCACTTAGCTCA 58.479 36.000 0.00 0.00 0.00 4.26
66 67 7.602517 ATGTATGTTTGACTTCACTTAGCTC 57.397 36.000 0.00 0.00 0.00 4.09
67 68 7.445402 ACAATGTATGTTTGACTTCACTTAGCT 59.555 33.333 0.00 0.00 40.06 3.32
68 69 7.584987 ACAATGTATGTTTGACTTCACTTAGC 58.415 34.615 0.00 0.00 40.06 3.09
69 70 8.230486 GGACAATGTATGTTTGACTTCACTTAG 58.770 37.037 0.00 0.00 44.12 2.18
70 71 7.717436 TGGACAATGTATGTTTGACTTCACTTA 59.283 33.333 0.00 0.00 44.12 2.24
71 72 6.545666 TGGACAATGTATGTTTGACTTCACTT 59.454 34.615 0.00 0.00 44.12 3.16
72 73 6.061441 TGGACAATGTATGTTTGACTTCACT 58.939 36.000 0.00 0.00 44.12 3.41
73 74 6.312399 TGGACAATGTATGTTTGACTTCAC 57.688 37.500 0.00 0.00 44.12 3.18
74 75 6.951062 TTGGACAATGTATGTTTGACTTCA 57.049 33.333 0.00 0.00 44.12 3.02
75 76 8.081633 TGATTTGGACAATGTATGTTTGACTTC 58.918 33.333 0.00 0.00 44.12 3.01
76 77 7.950512 TGATTTGGACAATGTATGTTTGACTT 58.049 30.769 0.00 0.00 44.12 3.01
77 78 7.448161 TCTGATTTGGACAATGTATGTTTGACT 59.552 33.333 0.00 0.00 44.12 3.41
78 79 7.592938 TCTGATTTGGACAATGTATGTTTGAC 58.407 34.615 0.00 0.00 44.12 3.18
79 80 7.757941 TCTGATTTGGACAATGTATGTTTGA 57.242 32.000 0.00 0.00 44.12 2.69
80 81 8.815141 TTTCTGATTTGGACAATGTATGTTTG 57.185 30.769 0.00 0.00 44.12 2.93
84 85 9.726232 CAGTATTTCTGATTTGGACAATGTATG 57.274 33.333 0.00 0.00 46.27 2.39
85 86 9.685276 TCAGTATTTCTGATTTGGACAATGTAT 57.315 29.630 0.00 0.00 46.77 2.29
114 115 9.349713 GGATTGGTTAGTAATCATCATTGGTTA 57.650 33.333 0.00 0.00 36.50 2.85
115 116 7.838696 TGGATTGGTTAGTAATCATCATTGGTT 59.161 33.333 0.00 0.00 36.50 3.67
116 117 7.353525 TGGATTGGTTAGTAATCATCATTGGT 58.646 34.615 0.00 0.00 36.50 3.67
117 118 7.822161 TGGATTGGTTAGTAATCATCATTGG 57.178 36.000 0.00 0.00 36.50 3.16
118 119 8.301720 CCATGGATTGGTTAGTAATCATCATTG 58.698 37.037 5.56 0.00 40.99 2.82
119 120 8.413309 CCATGGATTGGTTAGTAATCATCATT 57.587 34.615 5.56 0.00 40.99 2.57
143 144 3.243201 GCTGAAACAGTGGCATAATAGCC 60.243 47.826 0.00 0.00 42.50 3.93
144 145 3.378112 TGCTGAAACAGTGGCATAATAGC 59.622 43.478 0.00 0.00 33.43 2.97
145 146 4.637534 AGTGCTGAAACAGTGGCATAATAG 59.362 41.667 0.00 0.00 37.05 1.73
146 147 4.588899 AGTGCTGAAACAGTGGCATAATA 58.411 39.130 0.00 0.00 37.05 0.98
147 148 3.424703 AGTGCTGAAACAGTGGCATAAT 58.575 40.909 0.00 0.00 37.05 1.28
148 149 2.813754 GAGTGCTGAAACAGTGGCATAA 59.186 45.455 0.00 0.00 37.05 1.90
149 150 2.224499 TGAGTGCTGAAACAGTGGCATA 60.224 45.455 0.00 0.00 37.05 3.14
150 151 1.242076 GAGTGCTGAAACAGTGGCAT 58.758 50.000 0.00 0.00 37.05 4.40
151 152 0.107263 TGAGTGCTGAAACAGTGGCA 60.107 50.000 0.00 0.00 33.43 4.92
152 153 1.024271 TTGAGTGCTGAAACAGTGGC 58.976 50.000 0.00 0.00 33.43 5.01
153 154 2.539547 CGTTTGAGTGCTGAAACAGTGG 60.540 50.000 13.04 0.00 36.66 4.00
154 155 2.351418 TCGTTTGAGTGCTGAAACAGTG 59.649 45.455 13.04 0.00 36.66 3.66
155 156 2.627945 TCGTTTGAGTGCTGAAACAGT 58.372 42.857 13.04 0.00 36.66 3.55
156 157 3.885484 ATCGTTTGAGTGCTGAAACAG 57.115 42.857 13.04 7.19 36.66 3.16
157 158 4.024387 GGTAATCGTTTGAGTGCTGAAACA 60.024 41.667 13.04 3.18 36.66 2.83
158 159 4.024387 TGGTAATCGTTTGAGTGCTGAAAC 60.024 41.667 4.56 4.56 34.16 2.78
159 160 4.130857 TGGTAATCGTTTGAGTGCTGAAA 58.869 39.130 0.00 0.00 0.00 2.69
160 161 3.734463 TGGTAATCGTTTGAGTGCTGAA 58.266 40.909 0.00 0.00 0.00 3.02
161 162 3.325870 CTGGTAATCGTTTGAGTGCTGA 58.674 45.455 0.00 0.00 0.00 4.26
162 163 2.416547 CCTGGTAATCGTTTGAGTGCTG 59.583 50.000 0.00 0.00 0.00 4.41
163 164 2.301870 TCCTGGTAATCGTTTGAGTGCT 59.698 45.455 0.00 0.00 0.00 4.40
164 165 2.695359 TCCTGGTAATCGTTTGAGTGC 58.305 47.619 0.00 0.00 0.00 4.40
165 166 6.761242 TGATTATCCTGGTAATCGTTTGAGTG 59.239 38.462 16.86 0.00 41.71 3.51
166 167 6.884832 TGATTATCCTGGTAATCGTTTGAGT 58.115 36.000 16.86 0.00 41.71 3.41
167 168 7.786178 TTGATTATCCTGGTAATCGTTTGAG 57.214 36.000 16.86 0.00 41.71 3.02
168 169 8.568676 TTTTGATTATCCTGGTAATCGTTTGA 57.431 30.769 16.86 4.54 41.71 2.69
169 170 7.432252 GCTTTTGATTATCCTGGTAATCGTTTG 59.568 37.037 16.86 11.61 41.71 2.93
170 171 7.122055 TGCTTTTGATTATCCTGGTAATCGTTT 59.878 33.333 16.86 0.00 41.71 3.60
171 172 6.601613 TGCTTTTGATTATCCTGGTAATCGTT 59.398 34.615 16.86 0.00 41.71 3.85
172 173 6.038271 GTGCTTTTGATTATCCTGGTAATCGT 59.962 38.462 16.86 0.00 41.71 3.73
173 174 6.430451 GTGCTTTTGATTATCCTGGTAATCG 58.570 40.000 16.86 9.06 41.71 3.34
174 175 6.239036 GGGTGCTTTTGATTATCCTGGTAATC 60.239 42.308 15.92 15.92 40.09 1.75
175 176 5.598417 GGGTGCTTTTGATTATCCTGGTAAT 59.402 40.000 0.00 0.00 0.00 1.89
176 177 4.953579 GGGTGCTTTTGATTATCCTGGTAA 59.046 41.667 0.00 0.00 0.00 2.85
177 178 4.229582 AGGGTGCTTTTGATTATCCTGGTA 59.770 41.667 0.00 0.00 0.00 3.25
178 179 3.011708 AGGGTGCTTTTGATTATCCTGGT 59.988 43.478 0.00 0.00 0.00 4.00
179 180 3.633986 GAGGGTGCTTTTGATTATCCTGG 59.366 47.826 0.00 0.00 0.00 4.45
180 181 3.313526 CGAGGGTGCTTTTGATTATCCTG 59.686 47.826 0.00 0.00 0.00 3.86
181 182 3.545703 CGAGGGTGCTTTTGATTATCCT 58.454 45.455 0.00 0.00 0.00 3.24
182 183 2.618709 CCGAGGGTGCTTTTGATTATCC 59.381 50.000 0.00 0.00 0.00 2.59
183 184 3.279434 ACCGAGGGTGCTTTTGATTATC 58.721 45.455 0.00 0.00 32.98 1.75
184 185 3.366052 ACCGAGGGTGCTTTTGATTAT 57.634 42.857 0.00 0.00 32.98 1.28
185 186 2.871096 ACCGAGGGTGCTTTTGATTA 57.129 45.000 0.00 0.00 32.98 1.75
186 187 3.745723 ACCGAGGGTGCTTTTGATT 57.254 47.368 0.00 0.00 32.98 2.57
196 197 2.122547 AACCTGGACACCGAGGGT 60.123 61.111 0.00 0.00 35.62 4.34
197 198 1.764571 TTGAACCTGGACACCGAGGG 61.765 60.000 0.00 0.00 33.16 4.30
198 199 0.320771 CTTGAACCTGGACACCGAGG 60.321 60.000 0.00 0.00 35.26 4.63
199 200 0.679505 TCTTGAACCTGGACACCGAG 59.320 55.000 0.00 0.00 0.00 4.63
200 201 1.124780 TTCTTGAACCTGGACACCGA 58.875 50.000 0.00 0.00 0.00 4.69
201 202 1.961793 TTTCTTGAACCTGGACACCG 58.038 50.000 0.00 0.00 0.00 4.94
202 203 4.620982 CATTTTTCTTGAACCTGGACACC 58.379 43.478 0.00 0.00 0.00 4.16
203 204 4.051237 GCATTTTTCTTGAACCTGGACAC 58.949 43.478 0.00 0.00 0.00 3.67
204 205 3.703556 TGCATTTTTCTTGAACCTGGACA 59.296 39.130 0.00 0.00 0.00 4.02
205 206 4.051237 GTGCATTTTTCTTGAACCTGGAC 58.949 43.478 0.00 0.00 0.00 4.02
206 207 3.069443 GGTGCATTTTTCTTGAACCTGGA 59.931 43.478 0.00 0.00 39.41 3.86
207 208 3.181467 TGGTGCATTTTTCTTGAACCTGG 60.181 43.478 2.67 0.00 42.52 4.45
208 209 4.053295 CTGGTGCATTTTTCTTGAACCTG 58.947 43.478 2.67 0.00 42.52 4.00
209 210 3.960102 TCTGGTGCATTTTTCTTGAACCT 59.040 39.130 2.67 0.00 42.52 3.50
210 211 4.320608 TCTGGTGCATTTTTCTTGAACC 57.679 40.909 0.00 0.00 42.40 3.62
211 212 5.006649 GGTTTCTGGTGCATTTTTCTTGAAC 59.993 40.000 0.00 0.00 0.00 3.18
212 213 5.115480 GGTTTCTGGTGCATTTTTCTTGAA 58.885 37.500 0.00 0.00 0.00 2.69
213 214 4.161189 TGGTTTCTGGTGCATTTTTCTTGA 59.839 37.500 0.00 0.00 0.00 3.02
214 215 4.440880 TGGTTTCTGGTGCATTTTTCTTG 58.559 39.130 0.00 0.00 0.00 3.02
215 216 4.751767 TGGTTTCTGGTGCATTTTTCTT 57.248 36.364 0.00 0.00 0.00 2.52
216 217 4.503643 CCATGGTTTCTGGTGCATTTTTCT 60.504 41.667 2.57 0.00 0.00 2.52
217 218 3.747529 CCATGGTTTCTGGTGCATTTTTC 59.252 43.478 2.57 0.00 0.00 2.29
218 219 3.496515 CCCATGGTTTCTGGTGCATTTTT 60.497 43.478 11.73 0.00 31.44 1.94
219 220 2.038820 CCCATGGTTTCTGGTGCATTTT 59.961 45.455 11.73 0.00 31.44 1.82
220 221 1.624813 CCCATGGTTTCTGGTGCATTT 59.375 47.619 11.73 0.00 31.44 2.32
221 222 1.269012 CCCATGGTTTCTGGTGCATT 58.731 50.000 11.73 0.00 31.44 3.56
222 223 1.259840 GCCCATGGTTTCTGGTGCAT 61.260 55.000 11.73 0.00 33.06 3.96
223 224 1.907807 GCCCATGGTTTCTGGTGCA 60.908 57.895 11.73 0.00 33.06 4.57
224 225 2.649129 GGCCCATGGTTTCTGGTGC 61.649 63.158 11.73 3.78 31.44 5.01
225 226 1.228831 TGGCCCATGGTTTCTGGTG 60.229 57.895 11.73 0.00 31.44 4.17
226 227 1.228862 GTGGCCCATGGTTTCTGGT 60.229 57.895 11.73 0.00 31.44 4.00
227 228 1.984026 GGTGGCCCATGGTTTCTGG 60.984 63.158 11.73 0.00 0.00 3.86
228 229 2.342650 CGGTGGCCCATGGTTTCTG 61.343 63.158 11.73 0.00 0.00 3.02
229 230 1.493854 TACGGTGGCCCATGGTTTCT 61.494 55.000 11.73 0.00 0.00 2.52
230 231 1.001887 TACGGTGGCCCATGGTTTC 60.002 57.895 11.73 0.00 0.00 2.78
231 232 1.303806 GTACGGTGGCCCATGGTTT 60.304 57.895 11.73 0.00 0.00 3.27
232 233 2.353573 GTACGGTGGCCCATGGTT 59.646 61.111 11.73 0.00 0.00 3.67
233 234 3.723922 GGTACGGTGGCCCATGGT 61.724 66.667 11.73 0.00 0.00 3.55
234 235 3.407967 AGGTACGGTGGCCCATGG 61.408 66.667 4.14 4.14 0.00 3.66
235 236 2.124736 CAGGTACGGTGGCCCATG 60.125 66.667 0.00 0.00 0.00 3.66
236 237 3.407967 CCAGGTACGGTGGCCCAT 61.408 66.667 0.00 0.00 0.00 4.00
237 238 4.642488 TCCAGGTACGGTGGCCCA 62.642 66.667 0.00 0.00 34.77 5.36
238 239 2.414658 TTTTCCAGGTACGGTGGCCC 62.415 60.000 0.00 0.00 34.77 5.80
239 240 1.073548 TTTTCCAGGTACGGTGGCC 59.926 57.895 0.00 0.00 34.77 5.36
240 241 0.535553 TGTTTTCCAGGTACGGTGGC 60.536 55.000 7.83 0.00 34.77 5.01
241 242 2.081462 GATGTTTTCCAGGTACGGTGG 58.919 52.381 6.56 6.56 36.28 4.61
242 243 2.081462 GGATGTTTTCCAGGTACGGTG 58.919 52.381 0.00 0.00 44.74 4.94
243 244 2.484742 GGATGTTTTCCAGGTACGGT 57.515 50.000 0.00 0.00 44.74 4.83
252 253 5.302568 TCATGCATATTCTGGGATGTTTTCC 59.697 40.000 0.00 0.00 44.62 3.13
253 254 6.263842 TCTCATGCATATTCTGGGATGTTTTC 59.736 38.462 0.00 0.00 34.82 2.29
254 255 6.131264 TCTCATGCATATTCTGGGATGTTTT 58.869 36.000 0.00 0.00 34.82 2.43
255 256 5.698104 TCTCATGCATATTCTGGGATGTTT 58.302 37.500 0.00 0.00 34.82 2.83
256 257 5.314718 TCTCATGCATATTCTGGGATGTT 57.685 39.130 0.00 0.00 34.82 2.71
257 258 4.987963 TCTCATGCATATTCTGGGATGT 57.012 40.909 0.00 0.00 34.82 3.06
258 259 6.835819 AAATCTCATGCATATTCTGGGATG 57.164 37.500 0.00 0.00 30.62 3.51
259 260 7.850935 AAAAATCTCATGCATATTCTGGGAT 57.149 32.000 0.00 0.00 31.44 3.85
335 336 1.694696 CTACCCATCTAAGTGGAGGGC 59.305 57.143 0.00 0.00 43.47 5.19
349 350 7.613551 AGAGAAGAAAAGACTAAACTACCCA 57.386 36.000 0.00 0.00 0.00 4.51
381 382 6.260936 GCATCGATTAGAAATCAGGAAAGGAA 59.739 38.462 0.00 0.00 0.00 3.36
421 429 4.062293 CAGGTTCTGTTTGATCGGTAACA 58.938 43.478 7.40 7.40 33.54 2.41
441 449 3.253432 GGTTTTTGAGAACCTGTAGCCAG 59.747 47.826 0.00 0.00 44.55 4.85
457 465 8.695456 AGATGTTAGAGATTTTGTGTGGTTTTT 58.305 29.630 0.00 0.00 0.00 1.94
539 648 4.795278 GCTGCTTTGATTAGAATTTGTCGG 59.205 41.667 0.00 0.00 0.00 4.79
564 673 0.391263 CTTGGTTCAGTACGGGGAGC 60.391 60.000 0.00 0.00 0.00 4.70
567 676 0.389426 CGACTTGGTTCAGTACGGGG 60.389 60.000 0.00 0.00 0.00 5.73
568 677 0.599558 TCGACTTGGTTCAGTACGGG 59.400 55.000 0.00 0.00 0.00 5.28
574 701 4.505922 GCTAATCAGATCGACTTGGTTCAG 59.494 45.833 0.17 0.28 0.00 3.02
616 743 1.335182 AGATCTATCACGTCGGCACTG 59.665 52.381 0.00 0.00 0.00 3.66
645 772 0.109342 GGTGAGGCGGGATCATCAAT 59.891 55.000 0.00 0.00 0.00 2.57
685 1122 1.602323 AATTGGAAACTCGCCCGCA 60.602 52.632 0.00 0.00 0.00 5.69
714 1151 0.248784 GCGCCTTTGCAAGATCCATC 60.249 55.000 0.00 0.00 37.32 3.51
767 1204 0.739813 CCAAGGGAATGGTCGTCGAC 60.740 60.000 17.16 17.16 35.65 4.20
859 1296 8.472413 GGGCGTAGTTGATATGAGGTAATTATA 58.528 37.037 0.00 0.00 0.00 0.98
860 1297 7.180408 AGGGCGTAGTTGATATGAGGTAATTAT 59.820 37.037 0.00 0.00 0.00 1.28
861 1298 6.495872 AGGGCGTAGTTGATATGAGGTAATTA 59.504 38.462 0.00 0.00 0.00 1.40
862 1299 5.307196 AGGGCGTAGTTGATATGAGGTAATT 59.693 40.000 0.00 0.00 0.00 1.40
863 1300 4.838986 AGGGCGTAGTTGATATGAGGTAAT 59.161 41.667 0.00 0.00 0.00 1.89
864 1301 4.220724 AGGGCGTAGTTGATATGAGGTAA 58.779 43.478 0.00 0.00 0.00 2.85
865 1302 3.825014 GAGGGCGTAGTTGATATGAGGTA 59.175 47.826 0.00 0.00 0.00 3.08
866 1303 2.628657 GAGGGCGTAGTTGATATGAGGT 59.371 50.000 0.00 0.00 0.00 3.85
867 1304 2.028930 GGAGGGCGTAGTTGATATGAGG 60.029 54.545 0.00 0.00 0.00 3.86
868 1305 2.351835 CGGAGGGCGTAGTTGATATGAG 60.352 54.545 0.00 0.00 0.00 2.90
869 1306 1.611977 CGGAGGGCGTAGTTGATATGA 59.388 52.381 0.00 0.00 0.00 2.15
870 1307 1.340248 ACGGAGGGCGTAGTTGATATG 59.660 52.381 0.00 0.00 0.00 1.78
871 1308 1.612463 GACGGAGGGCGTAGTTGATAT 59.388 52.381 0.00 0.00 0.00 1.63
872 1309 1.027357 GACGGAGGGCGTAGTTGATA 58.973 55.000 0.00 0.00 0.00 2.15
873 1310 1.673808 GGACGGAGGGCGTAGTTGAT 61.674 60.000 0.00 0.00 0.00 2.57
874 1311 2.345760 GGACGGAGGGCGTAGTTGA 61.346 63.158 0.00 0.00 0.00 3.18
875 1312 2.183555 GGACGGAGGGCGTAGTTG 59.816 66.667 0.00 0.00 0.00 3.16
876 1313 3.073101 GGGACGGAGGGCGTAGTT 61.073 66.667 0.00 0.00 0.00 2.24
877 1314 2.288642 TATGGGACGGAGGGCGTAGT 62.289 60.000 0.00 0.00 0.00 2.73
878 1315 1.111116 TTATGGGACGGAGGGCGTAG 61.111 60.000 0.00 0.00 0.00 3.51
879 1316 1.076118 TTATGGGACGGAGGGCGTA 60.076 57.895 0.00 0.00 0.00 4.42
880 1317 2.364579 TTATGGGACGGAGGGCGT 60.365 61.111 0.00 0.00 0.00 5.68
881 1318 2.040009 ATGTTATGGGACGGAGGGCG 62.040 60.000 0.00 0.00 0.00 6.13
882 1319 1.053424 TATGTTATGGGACGGAGGGC 58.947 55.000 0.00 0.00 0.00 5.19
883 1320 2.969950 TCTTATGTTATGGGACGGAGGG 59.030 50.000 0.00 0.00 0.00 4.30
884 1321 3.555168 GCTCTTATGTTATGGGACGGAGG 60.555 52.174 0.00 0.00 0.00 4.30
885 1322 3.654414 GCTCTTATGTTATGGGACGGAG 58.346 50.000 0.00 0.00 0.00 4.63
886 1323 2.035449 CGCTCTTATGTTATGGGACGGA 59.965 50.000 0.00 0.00 0.00 4.69
887 1324 2.223971 ACGCTCTTATGTTATGGGACGG 60.224 50.000 0.00 0.00 0.00 4.79
888 1325 3.093717 ACGCTCTTATGTTATGGGACG 57.906 47.619 0.00 0.00 0.00 4.79
889 1326 5.813080 AAAACGCTCTTATGTTATGGGAC 57.187 39.130 0.00 0.00 0.00 4.46
909 1346 8.402472 CGTCCCACAATATAAATAGCTCAAAAA 58.598 33.333 0.00 0.00 0.00 1.94
910 1347 7.012894 CCGTCCCACAATATAAATAGCTCAAAA 59.987 37.037 0.00 0.00 0.00 2.44
911 1348 6.485313 CCGTCCCACAATATAAATAGCTCAAA 59.515 38.462 0.00 0.00 0.00 2.69
912 1349 5.995282 CCGTCCCACAATATAAATAGCTCAA 59.005 40.000 0.00 0.00 0.00 3.02
913 1350 5.512404 CCCGTCCCACAATATAAATAGCTCA 60.512 44.000 0.00 0.00 0.00 4.26
914 1351 4.935808 CCCGTCCCACAATATAAATAGCTC 59.064 45.833 0.00 0.00 0.00 4.09
915 1352 4.595781 TCCCGTCCCACAATATAAATAGCT 59.404 41.667 0.00 0.00 0.00 3.32
916 1353 4.901868 TCCCGTCCCACAATATAAATAGC 58.098 43.478 0.00 0.00 0.00 2.97
917 1354 5.488341 CCTCCCGTCCCACAATATAAATAG 58.512 45.833 0.00 0.00 0.00 1.73
918 1355 4.287585 CCCTCCCGTCCCACAATATAAATA 59.712 45.833 0.00 0.00 0.00 1.40
919 1356 3.073946 CCCTCCCGTCCCACAATATAAAT 59.926 47.826 0.00 0.00 0.00 1.40
920 1357 2.440253 CCCTCCCGTCCCACAATATAAA 59.560 50.000 0.00 0.00 0.00 1.40
921 1358 2.051692 CCCTCCCGTCCCACAATATAA 58.948 52.381 0.00 0.00 0.00 0.98
922 1359 1.221007 TCCCTCCCGTCCCACAATATA 59.779 52.381 0.00 0.00 0.00 0.86
923 1360 0.030501 TCCCTCCCGTCCCACAATAT 60.031 55.000 0.00 0.00 0.00 1.28
924 1361 0.689745 CTCCCTCCCGTCCCACAATA 60.690 60.000 0.00 0.00 0.00 1.90
925 1362 1.995626 CTCCCTCCCGTCCCACAAT 60.996 63.158 0.00 0.00 0.00 2.71
926 1363 2.096707 TACTCCCTCCCGTCCCACAA 62.097 60.000 0.00 0.00 0.00 3.33
927 1364 2.509931 CTACTCCCTCCCGTCCCACA 62.510 65.000 0.00 0.00 0.00 4.17
928 1365 1.757340 CTACTCCCTCCCGTCCCAC 60.757 68.421 0.00 0.00 0.00 4.61
929 1366 2.687902 CTACTCCCTCCCGTCCCA 59.312 66.667 0.00 0.00 0.00 4.37
930 1367 2.838693 GCTACTCCCTCCCGTCCC 60.839 72.222 0.00 0.00 0.00 4.46
931 1368 2.043248 TGCTACTCCCTCCCGTCC 60.043 66.667 0.00 0.00 0.00 4.79
932 1369 0.468400 ATCTGCTACTCCCTCCCGTC 60.468 60.000 0.00 0.00 0.00 4.79
933 1370 0.851469 TATCTGCTACTCCCTCCCGT 59.149 55.000 0.00 0.00 0.00 5.28
934 1371 1.614413 GTTATCTGCTACTCCCTCCCG 59.386 57.143 0.00 0.00 0.00 5.14
935 1372 2.365941 GTGTTATCTGCTACTCCCTCCC 59.634 54.545 0.00 0.00 0.00 4.30
936 1373 2.034812 CGTGTTATCTGCTACTCCCTCC 59.965 54.545 0.00 0.00 0.00 4.30
937 1374 2.544069 GCGTGTTATCTGCTACTCCCTC 60.544 54.545 0.00 0.00 0.00 4.30
938 1375 1.409427 GCGTGTTATCTGCTACTCCCT 59.591 52.381 0.00 0.00 0.00 4.20
939 1376 1.136305 TGCGTGTTATCTGCTACTCCC 59.864 52.381 0.00 0.00 0.00 4.30
940 1377 2.579207 TGCGTGTTATCTGCTACTCC 57.421 50.000 0.00 0.00 0.00 3.85
941 1378 3.302740 GCAATGCGTGTTATCTGCTACTC 60.303 47.826 0.00 0.00 0.00 2.59
942 1379 2.609459 GCAATGCGTGTTATCTGCTACT 59.391 45.455 0.00 0.00 0.00 2.57
943 1380 2.351418 TGCAATGCGTGTTATCTGCTAC 59.649 45.455 0.00 0.00 0.00 3.58
944 1381 2.351418 GTGCAATGCGTGTTATCTGCTA 59.649 45.455 0.00 0.00 0.00 3.49
945 1382 1.131126 GTGCAATGCGTGTTATCTGCT 59.869 47.619 0.00 0.00 0.00 4.24
946 1383 1.538276 GTGCAATGCGTGTTATCTGC 58.462 50.000 0.00 0.00 0.00 4.26
947 1384 1.128507 ACGTGCAATGCGTGTTATCTG 59.871 47.619 0.00 0.00 41.33 2.90
948 1385 1.438651 ACGTGCAATGCGTGTTATCT 58.561 45.000 0.00 0.00 41.33 1.98
949 1386 2.092995 TGTACGTGCAATGCGTGTTATC 59.907 45.455 3.02 1.36 42.87 1.75
950 1387 2.070028 TGTACGTGCAATGCGTGTTAT 58.930 42.857 3.02 0.00 42.87 1.89
951 1388 1.192757 GTGTACGTGCAATGCGTGTTA 59.807 47.619 8.25 0.00 42.87 2.41
952 1389 0.041663 GTGTACGTGCAATGCGTGTT 60.042 50.000 8.25 0.00 42.87 3.32
953 1390 1.154814 TGTGTACGTGCAATGCGTGT 61.155 50.000 8.25 3.96 42.87 4.49
954 1391 0.165727 ATGTGTACGTGCAATGCGTG 59.834 50.000 8.25 0.00 42.87 5.34
955 1392 1.715993 TATGTGTACGTGCAATGCGT 58.284 45.000 8.25 6.11 45.11 5.24
956 1393 2.627956 CATATGTGTACGTGCAATGCG 58.372 47.619 8.25 0.00 0.00 4.73
957 1394 2.375110 GCATATGTGTACGTGCAATGC 58.625 47.619 20.73 20.73 37.52 3.56
958 1395 2.354199 TGGCATATGTGTACGTGCAATG 59.646 45.455 8.25 10.04 39.27 2.82
959 1396 2.637947 TGGCATATGTGTACGTGCAAT 58.362 42.857 8.25 7.17 39.27 3.56
960 1397 2.100605 TGGCATATGTGTACGTGCAA 57.899 45.000 8.25 0.00 39.27 4.08
961 1398 2.323968 ATGGCATATGTGTACGTGCA 57.676 45.000 0.82 0.82 39.27 4.57
962 1399 3.362295 CAAATGGCATATGTGTACGTGC 58.638 45.455 0.00 0.00 36.88 5.34
963 1400 3.362295 GCAAATGGCATATGTGTACGTG 58.638 45.455 0.00 0.00 43.97 4.49
964 1401 3.691049 GCAAATGGCATATGTGTACGT 57.309 42.857 0.00 0.00 43.97 3.57
976 1413 2.363359 CTCTATCCTTTGGGCAAATGGC 59.637 50.000 1.62 0.00 43.74 4.40
977 1414 3.902218 TCTCTATCCTTTGGGCAAATGG 58.098 45.455 0.00 0.00 0.00 3.16
978 1415 5.383476 AGATCTCTATCCTTTGGGCAAATG 58.617 41.667 0.00 0.00 31.98 2.32
979 1416 5.659849 AGATCTCTATCCTTTGGGCAAAT 57.340 39.130 0.00 0.00 31.98 2.32
980 1417 6.770286 ATAGATCTCTATCCTTTGGGCAAA 57.230 37.500 0.00 0.00 34.21 3.68
981 1418 7.872061 TTATAGATCTCTATCCTTTGGGCAA 57.128 36.000 0.00 0.00 39.66 4.52
982 1419 7.872061 TTTATAGATCTCTATCCTTTGGGCA 57.128 36.000 0.00 0.00 39.66 5.36
983 1420 9.825109 GTATTTATAGATCTCTATCCTTTGGGC 57.175 37.037 0.00 0.00 39.66 5.36
995 1432 9.921637 CCACTTCTCTTGGTATTTATAGATCTC 57.078 37.037 0.00 0.00 0.00 2.75
996 1433 8.875168 CCCACTTCTCTTGGTATTTATAGATCT 58.125 37.037 0.00 0.00 31.46 2.75
997 1434 8.871125 TCCCACTTCTCTTGGTATTTATAGATC 58.129 37.037 0.00 0.00 31.46 2.75
998 1435 8.798975 TCCCACTTCTCTTGGTATTTATAGAT 57.201 34.615 0.00 0.00 31.46 1.98
999 1436 8.483758 GTTCCCACTTCTCTTGGTATTTATAGA 58.516 37.037 0.00 0.00 31.46 1.98
1000 1437 8.487028 AGTTCCCACTTCTCTTGGTATTTATAG 58.513 37.037 0.00 0.00 31.46 1.31
1001 1438 8.388656 AGTTCCCACTTCTCTTGGTATTTATA 57.611 34.615 0.00 0.00 31.46 0.98
1002 1439 7.272144 AGTTCCCACTTCTCTTGGTATTTAT 57.728 36.000 0.00 0.00 31.46 1.40
1003 1440 6.697641 AGTTCCCACTTCTCTTGGTATTTA 57.302 37.500 0.00 0.00 31.46 1.40
1004 1441 5.584551 AGTTCCCACTTCTCTTGGTATTT 57.415 39.130 0.00 0.00 31.46 1.40
1005 1442 5.073144 TCAAGTTCCCACTTCTCTTGGTATT 59.927 40.000 0.00 0.00 41.69 1.89
1006 1443 4.597507 TCAAGTTCCCACTTCTCTTGGTAT 59.402 41.667 0.00 0.00 41.69 2.73
1007 1444 3.971305 TCAAGTTCCCACTTCTCTTGGTA 59.029 43.478 0.00 0.00 41.69 3.25
1008 1445 2.777692 TCAAGTTCCCACTTCTCTTGGT 59.222 45.455 0.00 0.00 41.69 3.67
1009 1446 3.406764 CTCAAGTTCCCACTTCTCTTGG 58.593 50.000 0.00 0.00 41.69 3.61
1010 1447 2.810852 GCTCAAGTTCCCACTTCTCTTG 59.189 50.000 0.00 0.00 41.69 3.02
1011 1448 2.439507 TGCTCAAGTTCCCACTTCTCTT 59.560 45.455 0.00 0.00 41.69 2.85
1012 1449 2.050144 TGCTCAAGTTCCCACTTCTCT 58.950 47.619 0.00 0.00 41.69 3.10
1013 1450 2.550830 TGCTCAAGTTCCCACTTCTC 57.449 50.000 0.00 0.00 41.69 2.87
1014 1451 2.952310 GTTTGCTCAAGTTCCCACTTCT 59.048 45.455 0.00 0.00 41.69 2.85
1015 1452 2.687935 TGTTTGCTCAAGTTCCCACTTC 59.312 45.455 0.00 0.00 41.69 3.01
1016 1453 2.733956 TGTTTGCTCAAGTTCCCACTT 58.266 42.857 0.00 0.00 44.72 3.16
1017 1454 2.435372 TGTTTGCTCAAGTTCCCACT 57.565 45.000 0.00 0.00 33.11 4.00
1018 1455 2.799562 GCTTGTTTGCTCAAGTTCCCAC 60.800 50.000 14.52 0.00 44.41 4.61
1019 1456 1.408702 GCTTGTTTGCTCAAGTTCCCA 59.591 47.619 14.52 0.00 44.41 4.37
1020 1457 1.408702 TGCTTGTTTGCTCAAGTTCCC 59.591 47.619 14.52 3.58 44.41 3.97
1021 1458 2.463876 GTGCTTGTTTGCTCAAGTTCC 58.536 47.619 14.52 3.82 44.41 3.62
1022 1459 2.159254 TGGTGCTTGTTTGCTCAAGTTC 60.159 45.455 14.52 9.72 44.41 3.01
1023 1460 1.824230 TGGTGCTTGTTTGCTCAAGTT 59.176 42.857 14.52 0.00 44.41 2.66
1024 1461 1.134946 GTGGTGCTTGTTTGCTCAAGT 59.865 47.619 14.52 0.00 44.41 3.16
1025 1462 1.134753 TGTGGTGCTTGTTTGCTCAAG 59.865 47.619 10.76 10.76 45.09 3.02
1026 1463 1.134753 CTGTGGTGCTTGTTTGCTCAA 59.865 47.619 0.00 0.00 0.00 3.02
1027 1464 0.740149 CTGTGGTGCTTGTTTGCTCA 59.260 50.000 0.00 0.00 0.00 4.26
1028 1465 0.595825 GCTGTGGTGCTTGTTTGCTC 60.596 55.000 0.00 0.00 0.00 4.26
1029 1466 1.039233 AGCTGTGGTGCTTGTTTGCT 61.039 50.000 0.00 0.00 40.93 3.91
1030 1467 0.667993 TAGCTGTGGTGCTTGTTTGC 59.332 50.000 0.00 0.00 43.74 3.68
1031 1468 1.949525 ACTAGCTGTGGTGCTTGTTTG 59.050 47.619 0.00 0.00 44.05 2.93
1032 1469 2.348411 ACTAGCTGTGGTGCTTGTTT 57.652 45.000 0.00 0.00 44.05 2.83
1035 1472 3.599343 TGATAACTAGCTGTGGTGCTTG 58.401 45.455 0.00 0.00 43.74 4.01
1036 1473 3.981071 TGATAACTAGCTGTGGTGCTT 57.019 42.857 0.00 0.00 43.74 3.91
1037 1474 3.866651 CTTGATAACTAGCTGTGGTGCT 58.133 45.455 0.00 0.00 46.11 4.40
1038 1475 2.352960 GCTTGATAACTAGCTGTGGTGC 59.647 50.000 0.00 0.00 40.57 5.01
1039 1476 2.939103 GGCTTGATAACTAGCTGTGGTG 59.061 50.000 0.00 0.00 42.61 4.17
1040 1477 2.840651 AGGCTTGATAACTAGCTGTGGT 59.159 45.455 0.00 0.00 42.61 4.16
1041 1478 3.550437 AGGCTTGATAACTAGCTGTGG 57.450 47.619 0.00 0.00 42.61 4.17
1042 1479 6.015010 AGGTATAGGCTTGATAACTAGCTGTG 60.015 42.308 0.00 0.00 42.61 3.66
1043 1480 6.078664 AGGTATAGGCTTGATAACTAGCTGT 58.921 40.000 0.00 0.00 42.61 4.40
1044 1481 6.350612 GGAGGTATAGGCTTGATAACTAGCTG 60.351 46.154 0.00 0.00 42.61 4.24
1045 1482 5.717654 GGAGGTATAGGCTTGATAACTAGCT 59.282 44.000 6.41 0.00 42.61 3.32
1046 1483 5.717654 AGGAGGTATAGGCTTGATAACTAGC 59.282 44.000 0.00 0.00 42.36 3.42
1049 1486 9.839185 TTTATAGGAGGTATAGGCTTGATAACT 57.161 33.333 0.00 0.00 29.18 2.24
1053 1490 8.974292 TTCTTTATAGGAGGTATAGGCTTGAT 57.026 34.615 0.00 0.00 0.00 2.57
1054 1491 8.792830 TTTCTTTATAGGAGGTATAGGCTTGA 57.207 34.615 0.00 0.00 0.00 3.02
1055 1492 9.847224 TTTTTCTTTATAGGAGGTATAGGCTTG 57.153 33.333 0.00 0.00 0.00 4.01
1082 1519 9.821240 TCTTCTTCTCTATAGGCTTGATATCTT 57.179 33.333 3.98 0.00 0.00 2.40
1083 1520 9.466497 CTCTTCTTCTCTATAGGCTTGATATCT 57.534 37.037 3.98 0.00 0.00 1.98
1084 1521 8.190784 GCTCTTCTTCTCTATAGGCTTGATATC 58.809 40.741 0.00 0.00 0.00 1.63
1085 1522 7.148086 CGCTCTTCTTCTCTATAGGCTTGATAT 60.148 40.741 0.00 0.00 0.00 1.63
1086 1523 6.150307 CGCTCTTCTTCTCTATAGGCTTGATA 59.850 42.308 0.00 0.00 0.00 2.15
1087 1524 5.048083 CGCTCTTCTTCTCTATAGGCTTGAT 60.048 44.000 0.00 0.00 0.00 2.57
1088 1525 4.277174 CGCTCTTCTTCTCTATAGGCTTGA 59.723 45.833 0.00 0.00 0.00 3.02
1089 1526 4.545610 CGCTCTTCTTCTCTATAGGCTTG 58.454 47.826 0.00 0.00 0.00 4.01
1090 1527 3.572255 CCGCTCTTCTTCTCTATAGGCTT 59.428 47.826 0.00 0.00 0.00 4.35
1091 1528 3.153919 CCGCTCTTCTTCTCTATAGGCT 58.846 50.000 0.00 0.00 0.00 4.58
1092 1529 2.230266 CCCGCTCTTCTTCTCTATAGGC 59.770 54.545 0.00 0.00 0.00 3.93
1093 1530 2.230266 GCCCGCTCTTCTTCTCTATAGG 59.770 54.545 0.00 0.00 0.00 2.57
1094 1531 2.095466 CGCCCGCTCTTCTTCTCTATAG 60.095 54.545 0.00 0.00 0.00 1.31
1095 1532 1.880675 CGCCCGCTCTTCTTCTCTATA 59.119 52.381 0.00 0.00 0.00 1.31
1096 1533 0.671251 CGCCCGCTCTTCTTCTCTAT 59.329 55.000 0.00 0.00 0.00 1.98
1097 1534 0.393944 TCGCCCGCTCTTCTTCTCTA 60.394 55.000 0.00 0.00 0.00 2.43
1098 1535 1.679305 TCGCCCGCTCTTCTTCTCT 60.679 57.895 0.00 0.00 0.00 3.10
1099 1536 1.517475 GTCGCCCGCTCTTCTTCTC 60.517 63.158 0.00 0.00 0.00 2.87
1100 1537 1.608717 ATGTCGCCCGCTCTTCTTCT 61.609 55.000 0.00 0.00 0.00 2.85
1101 1538 1.153549 ATGTCGCCCGCTCTTCTTC 60.154 57.895 0.00 0.00 0.00 2.87
1102 1539 1.448540 CATGTCGCCCGCTCTTCTT 60.449 57.895 0.00 0.00 0.00 2.52
1103 1540 2.185350 CATGTCGCCCGCTCTTCT 59.815 61.111 0.00 0.00 0.00 2.85
1104 1541 3.567797 GCATGTCGCCCGCTCTTC 61.568 66.667 0.00 0.00 32.94 2.87
1113 1550 2.890474 CTACCACCGGCATGTCGC 60.890 66.667 15.74 0.00 41.28 5.19
1114 1551 1.226974 CTCTACCACCGGCATGTCG 60.227 63.158 13.99 13.99 0.00 4.35
1115 1552 1.521681 GCTCTACCACCGGCATGTC 60.522 63.158 0.00 0.00 0.00 3.06
1116 1553 1.553690 AAGCTCTACCACCGGCATGT 61.554 55.000 0.00 0.00 0.00 3.21
1117 1554 0.811616 GAAGCTCTACCACCGGCATG 60.812 60.000 0.00 0.00 0.00 4.06
1118 1555 1.522569 GAAGCTCTACCACCGGCAT 59.477 57.895 0.00 0.00 0.00 4.40
1119 1556 2.656069 GGAAGCTCTACCACCGGCA 61.656 63.158 0.00 0.00 0.00 5.69
1120 1557 2.187163 GGAAGCTCTACCACCGGC 59.813 66.667 0.00 0.00 0.00 6.13
1121 1558 1.961180 CTGGGAAGCTCTACCACCGG 61.961 65.000 0.00 0.00 0.00 5.28
1122 1559 1.517832 CTGGGAAGCTCTACCACCG 59.482 63.158 0.27 0.00 0.00 4.94
1123 1560 1.222113 GCTGGGAAGCTCTACCACC 59.778 63.158 0.27 0.00 0.00 4.61
1124 1561 0.107945 CAGCTGGGAAGCTCTACCAC 60.108 60.000 5.57 0.00 44.30 4.16
1125 1562 1.903877 GCAGCTGGGAAGCTCTACCA 61.904 60.000 17.12 4.22 44.30 3.25
1126 1563 1.153269 GCAGCTGGGAAGCTCTACC 60.153 63.158 17.12 0.00 44.30 3.18
1127 1564 0.179936 ATGCAGCTGGGAAGCTCTAC 59.820 55.000 17.12 0.00 44.30 2.59
1128 1565 0.467384 GATGCAGCTGGGAAGCTCTA 59.533 55.000 17.12 0.00 44.30 2.43
1129 1566 1.224039 GATGCAGCTGGGAAGCTCT 59.776 57.895 17.12 0.00 44.30 4.09
1130 1567 2.178890 CGATGCAGCTGGGAAGCTC 61.179 63.158 17.12 0.00 44.30 4.09
1132 1569 3.885521 GCGATGCAGCTGGGAAGC 61.886 66.667 17.12 0.00 0.00 3.86
1150 1587 1.134995 CCATTACTCTGCGAGCACAGA 60.135 52.381 7.33 4.35 44.32 3.41
1151 1588 1.284657 CCATTACTCTGCGAGCACAG 58.715 55.000 5.63 0.00 39.12 3.66
1152 1589 0.740868 GCCATTACTCTGCGAGCACA 60.741 55.000 5.63 0.00 32.04 4.57
1153 1590 0.460987 AGCCATTACTCTGCGAGCAC 60.461 55.000 5.63 0.00 32.04 4.40
1154 1591 0.179100 GAGCCATTACTCTGCGAGCA 60.179 55.000 0.00 0.00 33.69 4.26
1155 1592 0.878086 GGAGCCATTACTCTGCGAGC 60.878 60.000 5.63 0.00 36.87 5.03
1156 1593 0.749649 AGGAGCCATTACTCTGCGAG 59.250 55.000 4.36 4.36 36.87 5.03
1157 1594 1.681793 GTAGGAGCCATTACTCTGCGA 59.318 52.381 0.00 0.00 36.87 5.10
1158 1595 1.269831 GGTAGGAGCCATTACTCTGCG 60.270 57.143 0.00 0.00 36.87 5.18
1159 1596 2.043227 AGGTAGGAGCCATTACTCTGC 58.957 52.381 0.00 0.00 36.87 4.26
1160 1597 2.224161 GCAGGTAGGAGCCATTACTCTG 60.224 54.545 0.00 0.00 36.87 3.35
1161 1598 2.043227 GCAGGTAGGAGCCATTACTCT 58.957 52.381 0.00 0.00 36.87 3.24
1162 1599 1.269831 CGCAGGTAGGAGCCATTACTC 60.270 57.143 0.00 0.00 35.86 2.59
1163 1600 0.753262 CGCAGGTAGGAGCCATTACT 59.247 55.000 0.00 0.00 0.00 2.24
1164 1601 0.880718 GCGCAGGTAGGAGCCATTAC 60.881 60.000 0.30 0.00 0.00 1.89
1165 1602 1.048724 AGCGCAGGTAGGAGCCATTA 61.049 55.000 11.47 0.00 35.08 1.90
1166 1603 1.048724 TAGCGCAGGTAGGAGCCATT 61.049 55.000 11.47 0.00 40.68 3.16
1167 1604 0.833834 ATAGCGCAGGTAGGAGCCAT 60.834 55.000 11.47 0.00 46.38 4.40
1168 1605 1.457643 ATAGCGCAGGTAGGAGCCA 60.458 57.895 11.47 0.00 46.38 4.75
1169 1606 1.005630 CATAGCGCAGGTAGGAGCC 60.006 63.158 11.47 0.00 45.67 4.70
1170 1607 0.598680 CACATAGCGCAGGTAGGAGC 60.599 60.000 11.47 0.00 45.67 4.70
1171 1608 0.598680 GCACATAGCGCAGGTAGGAG 60.599 60.000 11.47 0.00 45.67 3.69
1172 1609 1.326951 TGCACATAGCGCAGGTAGGA 61.327 55.000 11.47 0.00 45.67 2.94
1173 1610 1.143838 TGCACATAGCGCAGGTAGG 59.856 57.895 11.47 0.00 46.38 3.18
1174 1611 4.833811 TGCACATAGCGCAGGTAG 57.166 55.556 11.47 0.00 46.38 3.18
1189 1626 2.459442 GCTCTCACCATGCTCGTGC 61.459 63.158 1.71 1.71 40.20 5.34
1190 1627 0.390866 AAGCTCTCACCATGCTCGTG 60.391 55.000 0.00 0.00 35.85 4.35
1191 1628 0.108424 GAAGCTCTCACCATGCTCGT 60.108 55.000 0.00 0.00 35.85 4.18
1192 1629 0.108472 TGAAGCTCTCACCATGCTCG 60.108 55.000 0.00 0.00 35.85 5.03
1193 1630 1.654317 CTGAAGCTCTCACCATGCTC 58.346 55.000 0.00 0.00 35.85 4.26
1194 1631 0.252479 CCTGAAGCTCTCACCATGCT 59.748 55.000 0.00 0.00 38.87 3.79
1195 1632 1.375098 GCCTGAAGCTCTCACCATGC 61.375 60.000 0.00 0.00 38.99 4.06
1196 1633 0.035725 TGCCTGAAGCTCTCACCATG 60.036 55.000 0.00 0.00 44.23 3.66
1197 1634 0.694771 TTGCCTGAAGCTCTCACCAT 59.305 50.000 0.00 0.00 44.23 3.55
1198 1635 0.250467 GTTGCCTGAAGCTCTCACCA 60.250 55.000 0.00 0.00 44.23 4.17
1199 1636 0.036022 AGTTGCCTGAAGCTCTCACC 59.964 55.000 0.00 0.00 44.23 4.02
1200 1637 1.155042 CAGTTGCCTGAAGCTCTCAC 58.845 55.000 0.00 0.00 44.23 3.51
1201 1638 0.604780 GCAGTTGCCTGAAGCTCTCA 60.605 55.000 0.00 0.00 44.23 3.27
1202 1639 0.604780 TGCAGTTGCCTGAAGCTCTC 60.605 55.000 1.06 0.00 44.23 3.20
1203 1640 0.605860 CTGCAGTTGCCTGAAGCTCT 60.606 55.000 5.25 0.00 37.55 4.09
1204 1641 1.874562 CTGCAGTTGCCTGAAGCTC 59.125 57.895 5.25 0.00 37.55 4.09
1205 1642 4.076244 CTGCAGTTGCCTGAAGCT 57.924 55.556 5.25 0.00 37.55 3.74
1207 1644 0.887836 TGAGCTGCAGTTGCCTGAAG 60.888 55.000 16.64 0.00 45.99 3.02
1208 1645 0.466007 TTGAGCTGCAGTTGCCTGAA 60.466 50.000 16.64 0.99 41.50 3.02
1209 1646 1.148949 TTGAGCTGCAGTTGCCTGA 59.851 52.632 16.64 0.00 41.50 3.86
1210 1647 1.285023 GTTGAGCTGCAGTTGCCTG 59.715 57.895 16.64 0.00 41.18 4.85
1211 1648 2.256591 CGTTGAGCTGCAGTTGCCT 61.257 57.895 16.64 3.06 41.18 4.75
1212 1649 2.253452 CGTTGAGCTGCAGTTGCC 59.747 61.111 16.64 0.00 41.18 4.52
1213 1650 2.253452 CCGTTGAGCTGCAGTTGC 59.747 61.111 16.64 1.14 42.50 4.17
1214 1651 2.062361 TTGCCGTTGAGCTGCAGTTG 62.062 55.000 16.64 0.00 38.51 3.16
1215 1652 1.789078 CTTGCCGTTGAGCTGCAGTT 61.789 55.000 16.64 9.79 38.51 3.16
1216 1653 2.203195 TTGCCGTTGAGCTGCAGT 60.203 55.556 16.64 1.59 38.51 4.40
1217 1654 2.559840 CTTGCCGTTGAGCTGCAG 59.440 61.111 10.11 10.11 38.51 4.41
1218 1655 2.979676 CCTTGCCGTTGAGCTGCA 60.980 61.111 1.02 0.00 35.53 4.41
1219 1656 2.669569 TCCTTGCCGTTGAGCTGC 60.670 61.111 0.00 0.00 0.00 5.25
1220 1657 2.671177 CGTCCTTGCCGTTGAGCTG 61.671 63.158 0.00 0.00 0.00 4.24
1221 1658 2.357517 CGTCCTTGCCGTTGAGCT 60.358 61.111 0.00 0.00 0.00 4.09
1222 1659 4.090057 GCGTCCTTGCCGTTGAGC 62.090 66.667 0.00 0.00 0.00 4.26
1223 1660 3.423154 GGCGTCCTTGCCGTTGAG 61.423 66.667 0.00 0.00 46.75 3.02
1230 1667 1.663379 GGGGTTAATGGCGTCCTTGC 61.663 60.000 0.00 0.00 0.00 4.01
1231 1668 0.034477 AGGGGTTAATGGCGTCCTTG 60.034 55.000 0.00 0.00 0.00 3.61
1232 1669 1.211212 GTAGGGGTTAATGGCGTCCTT 59.789 52.381 0.00 0.00 0.00 3.36
1233 1670 0.835276 GTAGGGGTTAATGGCGTCCT 59.165 55.000 0.00 0.00 0.00 3.85
1234 1671 0.542805 TGTAGGGGTTAATGGCGTCC 59.457 55.000 0.00 0.00 0.00 4.79