Multiple sequence alignment - TraesCS6B01G010500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G010500 chr6B 100.000 4352 0 0 1 4352 6272813 6268462 0.000000e+00 8037.0
1 TraesCS6B01G010500 chr6B 74.315 1935 408 63 1764 3637 6025078 6026984 0.000000e+00 737.0
2 TraesCS6B01G010500 chr6B 76.605 701 140 19 996 1690 6240737 6240055 8.890000e-97 364.0
3 TraesCS6B01G010500 chr6B 91.525 59 5 0 513 571 615609560 615609502 1.000000e-11 82.4
4 TraesCS6B01G010500 chr6D 79.330 2569 446 59 1079 3613 2896455 2898972 0.000000e+00 1724.0
5 TraesCS6B01G010500 chr6D 77.033 701 137 19 996 1690 3076775 3076093 8.830000e-102 381.0
6 TraesCS6B01G010500 chr6D 77.491 542 109 11 1167 1701 2911881 2912416 3.270000e-81 313.0
7 TraesCS6B01G010500 chr6A 76.726 507 108 7 1167 1668 1895517 1896018 1.540000e-69 274.0
8 TraesCS6B01G010500 chr3B 87.500 72 7 2 514 583 685896495 685896566 1.000000e-11 82.4
9 TraesCS6B01G010500 chr1A 91.228 57 5 0 515 571 3584157 3584101 1.300000e-10 78.7
10 TraesCS6B01G010500 chr7B 89.831 59 6 0 513 571 78318586 78318644 4.670000e-10 76.8
11 TraesCS6B01G010500 chr7A 90.000 60 4 2 513 571 621351305 621351363 4.670000e-10 76.8
12 TraesCS6B01G010500 chr3D 89.831 59 6 0 515 573 3340415 3340473 4.670000e-10 76.8
13 TraesCS6B01G010500 chr3A 88.710 62 7 0 513 574 9074376 9074315 4.670000e-10 76.8
14 TraesCS6B01G010500 chr2A 89.831 59 6 0 513 571 39175507 39175565 4.670000e-10 76.8
15 TraesCS6B01G010500 chr5A 89.831 59 5 1 513 571 603602600 603602657 1.680000e-09 75.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G010500 chr6B 6268462 6272813 4351 True 8037 8037 100.000 1 4352 1 chr6B.!!$R2 4351
1 TraesCS6B01G010500 chr6B 6025078 6026984 1906 False 737 737 74.315 1764 3637 1 chr6B.!!$F1 1873
2 TraesCS6B01G010500 chr6B 6240055 6240737 682 True 364 364 76.605 996 1690 1 chr6B.!!$R1 694
3 TraesCS6B01G010500 chr6D 2896455 2898972 2517 False 1724 1724 79.330 1079 3613 1 chr6D.!!$F1 2534
4 TraesCS6B01G010500 chr6D 3076093 3076775 682 True 381 381 77.033 996 1690 1 chr6D.!!$R1 694
5 TraesCS6B01G010500 chr6D 2911881 2912416 535 False 313 313 77.491 1167 1701 1 chr6D.!!$F2 534
6 TraesCS6B01G010500 chr6A 1895517 1896018 501 False 274 274 76.726 1167 1668 1 chr6A.!!$F1 501


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
281 282 0.027586 GCGGCACATGATTAACCGTC 59.972 55.0 0.0 0.0 45.53 4.79 F
1037 1038 0.031721 GTCGTGACGGTCCTTGTCTT 59.968 55.0 4.7 0.0 37.26 3.01 F
1815 1822 0.032515 TATGGGGCTTCTCCGAGACA 60.033 55.0 0.0 0.0 34.94 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1465 1469 0.038526 TCGAAGGAGTCTTTGGCGAC 60.039 55.0 0.00 0.00 35.56 5.19 R
2739 2752 0.034574 TATTGTCCTTGCACGCCCAT 60.035 50.0 0.00 0.00 0.00 4.00 R
3364 3385 0.031994 AAACCGGCTTTGATGTGCAC 59.968 50.0 10.75 10.75 0.00 4.57 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 1.740025 GGAAGAAAGAATGTGAGGCGG 59.260 52.381 0.00 0.00 0.00 6.13
21 22 2.615493 GGAAGAAAGAATGTGAGGCGGA 60.615 50.000 0.00 0.00 0.00 5.54
22 23 2.393271 AGAAAGAATGTGAGGCGGAG 57.607 50.000 0.00 0.00 0.00 4.63
23 24 1.902508 AGAAAGAATGTGAGGCGGAGA 59.097 47.619 0.00 0.00 0.00 3.71
24 25 2.303022 AGAAAGAATGTGAGGCGGAGAA 59.697 45.455 0.00 0.00 0.00 2.87
25 26 2.100605 AAGAATGTGAGGCGGAGAAC 57.899 50.000 0.00 0.00 0.00 3.01
27 28 0.389948 GAATGTGAGGCGGAGAACGT 60.390 55.000 0.00 0.00 46.52 3.99
28 29 0.034896 AATGTGAGGCGGAGAACGTT 59.965 50.000 0.00 0.00 46.52 3.99
29 30 0.034896 ATGTGAGGCGGAGAACGTTT 59.965 50.000 0.46 0.00 46.52 3.60
30 31 0.179067 TGTGAGGCGGAGAACGTTTT 60.179 50.000 0.46 0.00 46.52 2.43
31 32 0.234884 GTGAGGCGGAGAACGTTTTG 59.765 55.000 0.46 0.00 46.52 2.44
32 33 1.206831 GAGGCGGAGAACGTTTTGC 59.793 57.895 0.46 0.11 46.52 3.68
33 34 1.503818 GAGGCGGAGAACGTTTTGCA 61.504 55.000 10.82 0.00 46.52 4.08
34 35 1.082104 GGCGGAGAACGTTTTGCAG 60.082 57.895 10.82 4.82 46.52 4.41
35 36 1.082104 GCGGAGAACGTTTTGCAGG 60.082 57.895 10.82 0.00 46.52 4.85
36 37 1.503818 GCGGAGAACGTTTTGCAGGA 61.504 55.000 10.82 0.00 46.52 3.86
37 38 0.512952 CGGAGAACGTTTTGCAGGAG 59.487 55.000 10.82 0.00 37.93 3.69
38 39 0.875059 GGAGAACGTTTTGCAGGAGG 59.125 55.000 0.46 0.00 0.00 4.30
39 40 1.542547 GGAGAACGTTTTGCAGGAGGA 60.543 52.381 0.46 0.00 0.00 3.71
40 41 2.427506 GAGAACGTTTTGCAGGAGGAT 58.572 47.619 0.46 0.00 0.00 3.24
41 42 3.596214 GAGAACGTTTTGCAGGAGGATA 58.404 45.455 0.46 0.00 0.00 2.59
42 43 4.192317 GAGAACGTTTTGCAGGAGGATAT 58.808 43.478 0.46 0.00 0.00 1.63
43 44 5.353394 AGAACGTTTTGCAGGAGGATATA 57.647 39.130 0.46 0.00 0.00 0.86
44 45 5.741011 AGAACGTTTTGCAGGAGGATATAA 58.259 37.500 0.46 0.00 0.00 0.98
45 46 5.817816 AGAACGTTTTGCAGGAGGATATAAG 59.182 40.000 0.46 0.00 0.00 1.73
46 47 4.451900 ACGTTTTGCAGGAGGATATAAGG 58.548 43.478 0.00 0.00 0.00 2.69
47 48 4.080526 ACGTTTTGCAGGAGGATATAAGGT 60.081 41.667 0.00 0.00 0.00 3.50
48 49 5.129815 ACGTTTTGCAGGAGGATATAAGGTA 59.870 40.000 0.00 0.00 0.00 3.08
49 50 6.053005 CGTTTTGCAGGAGGATATAAGGTAA 58.947 40.000 0.00 0.00 0.00 2.85
50 51 6.540914 CGTTTTGCAGGAGGATATAAGGTAAA 59.459 38.462 0.00 0.00 0.00 2.01
51 52 7.066525 CGTTTTGCAGGAGGATATAAGGTAAAA 59.933 37.037 0.00 0.00 0.00 1.52
52 53 7.875327 TTTGCAGGAGGATATAAGGTAAAAC 57.125 36.000 0.00 0.00 0.00 2.43
53 54 6.569127 TGCAGGAGGATATAAGGTAAAACA 57.431 37.500 0.00 0.00 0.00 2.83
54 55 6.964464 TGCAGGAGGATATAAGGTAAAACAA 58.036 36.000 0.00 0.00 0.00 2.83
55 56 6.826741 TGCAGGAGGATATAAGGTAAAACAAC 59.173 38.462 0.00 0.00 0.00 3.32
56 57 6.826741 GCAGGAGGATATAAGGTAAAACAACA 59.173 38.462 0.00 0.00 0.00 3.33
57 58 7.338449 GCAGGAGGATATAAGGTAAAACAACAA 59.662 37.037 0.00 0.00 0.00 2.83
58 59 8.893727 CAGGAGGATATAAGGTAAAACAACAAG 58.106 37.037 0.00 0.00 0.00 3.16
59 60 8.832735 AGGAGGATATAAGGTAAAACAACAAGA 58.167 33.333 0.00 0.00 0.00 3.02
60 61 9.457436 GGAGGATATAAGGTAAAACAACAAGAA 57.543 33.333 0.00 0.00 0.00 2.52
68 69 8.871686 AAGGTAAAACAACAAGAAATAAGCTG 57.128 30.769 0.00 0.00 0.00 4.24
69 70 8.232913 AGGTAAAACAACAAGAAATAAGCTGA 57.767 30.769 0.00 0.00 0.00 4.26
70 71 8.691797 AGGTAAAACAACAAGAAATAAGCTGAA 58.308 29.630 0.00 0.00 0.00 3.02
71 72 8.968242 GGTAAAACAACAAGAAATAAGCTGAAG 58.032 33.333 0.00 0.00 0.00 3.02
72 73 9.516314 GTAAAACAACAAGAAATAAGCTGAAGT 57.484 29.630 0.00 0.00 0.00 3.01
74 75 9.435688 AAAACAACAAGAAATAAGCTGAAGTTT 57.564 25.926 0.00 0.00 0.00 2.66
75 76 8.634475 AACAACAAGAAATAAGCTGAAGTTTC 57.366 30.769 0.00 0.00 0.00 2.78
76 77 7.771183 ACAACAAGAAATAAGCTGAAGTTTCA 58.229 30.769 12.79 0.00 34.02 2.69
83 84 2.863153 CTGAAGTTTCAGCCGGCG 59.137 61.111 23.20 16.49 46.97 6.46
84 85 1.667830 CTGAAGTTTCAGCCGGCGA 60.668 57.895 23.20 18.73 46.97 5.54
85 86 1.630244 CTGAAGTTTCAGCCGGCGAG 61.630 60.000 23.20 18.47 46.97 5.03
86 87 3.028366 GAAGTTTCAGCCGGCGAGC 62.028 63.158 23.20 13.32 0.00 5.03
89 90 4.760047 TTTCAGCCGGCGAGCCTC 62.760 66.667 23.20 3.99 0.00 4.70
103 104 4.394712 CCTCGCCGGCAGGAAACT 62.395 66.667 30.14 0.00 46.44 2.66
104 105 2.577059 CTCGCCGGCAGGAAACTA 59.423 61.111 28.98 1.21 40.21 2.24
105 106 1.144057 CTCGCCGGCAGGAAACTAT 59.856 57.895 28.98 0.00 40.21 2.12
106 107 0.876342 CTCGCCGGCAGGAAACTATC 60.876 60.000 28.98 0.00 40.21 2.08
137 138 4.681074 AAAACCTAACCACCCAATTGTG 57.319 40.909 4.43 0.00 35.98 3.33
138 139 3.603965 AACCTAACCACCCAATTGTGA 57.396 42.857 4.43 0.00 38.55 3.58
139 140 2.871453 ACCTAACCACCCAATTGTGAC 58.129 47.619 4.43 0.00 38.55 3.67
140 141 2.175931 ACCTAACCACCCAATTGTGACA 59.824 45.455 4.43 0.00 38.55 3.58
141 142 2.819608 CCTAACCACCCAATTGTGACAG 59.180 50.000 4.43 0.00 38.55 3.51
142 143 2.452600 AACCACCCAATTGTGACAGT 57.547 45.000 4.43 0.00 38.55 3.55
143 144 2.452600 ACCACCCAATTGTGACAGTT 57.547 45.000 4.43 0.00 38.55 3.16
144 145 2.745968 ACCACCCAATTGTGACAGTTT 58.254 42.857 4.43 0.00 38.55 2.66
145 146 3.103742 ACCACCCAATTGTGACAGTTTT 58.896 40.909 4.43 0.00 38.55 2.43
146 147 3.517500 ACCACCCAATTGTGACAGTTTTT 59.482 39.130 4.43 0.00 38.55 1.94
147 148 4.119136 CCACCCAATTGTGACAGTTTTTC 58.881 43.478 4.43 0.00 38.55 2.29
148 149 3.796178 CACCCAATTGTGACAGTTTTTCG 59.204 43.478 4.43 0.00 38.55 3.46
149 150 2.794350 CCCAATTGTGACAGTTTTTCGC 59.206 45.455 4.43 0.00 0.00 4.70
150 151 3.490761 CCCAATTGTGACAGTTTTTCGCT 60.491 43.478 4.43 0.00 0.00 4.93
151 152 4.261405 CCCAATTGTGACAGTTTTTCGCTA 60.261 41.667 4.43 0.00 0.00 4.26
152 153 5.460646 CCAATTGTGACAGTTTTTCGCTAT 58.539 37.500 4.43 0.00 0.00 2.97
153 154 5.343058 CCAATTGTGACAGTTTTTCGCTATG 59.657 40.000 4.43 0.00 0.00 2.23
154 155 5.689383 ATTGTGACAGTTTTTCGCTATGT 57.311 34.783 0.00 0.00 0.00 2.29
155 156 6.795098 ATTGTGACAGTTTTTCGCTATGTA 57.205 33.333 0.00 0.00 0.00 2.29
156 157 5.585500 TGTGACAGTTTTTCGCTATGTAC 57.415 39.130 0.00 0.00 0.00 2.90
157 158 5.294356 TGTGACAGTTTTTCGCTATGTACT 58.706 37.500 0.00 0.00 0.00 2.73
158 159 5.404366 TGTGACAGTTTTTCGCTATGTACTC 59.596 40.000 0.00 0.00 0.00 2.59
159 160 4.927425 TGACAGTTTTTCGCTATGTACTCC 59.073 41.667 0.00 0.00 0.00 3.85
160 161 5.148651 ACAGTTTTTCGCTATGTACTCCT 57.851 39.130 0.00 0.00 0.00 3.69
161 162 5.169295 ACAGTTTTTCGCTATGTACTCCTC 58.831 41.667 0.00 0.00 0.00 3.71
162 163 4.567159 CAGTTTTTCGCTATGTACTCCTCC 59.433 45.833 0.00 0.00 0.00 4.30
163 164 4.222145 AGTTTTTCGCTATGTACTCCTCCA 59.778 41.667 0.00 0.00 0.00 3.86
164 165 5.104900 AGTTTTTCGCTATGTACTCCTCCAT 60.105 40.000 0.00 0.00 0.00 3.41
165 166 4.585955 TTTCGCTATGTACTCCTCCATC 57.414 45.455 0.00 0.00 0.00 3.51
166 167 3.510531 TCGCTATGTACTCCTCCATCT 57.489 47.619 0.00 0.00 0.00 2.90
167 168 3.833732 TCGCTATGTACTCCTCCATCTT 58.166 45.455 0.00 0.00 0.00 2.40
168 169 3.821600 TCGCTATGTACTCCTCCATCTTC 59.178 47.826 0.00 0.00 0.00 2.87
169 170 3.570125 CGCTATGTACTCCTCCATCTTCA 59.430 47.826 0.00 0.00 0.00 3.02
170 171 4.219507 CGCTATGTACTCCTCCATCTTCAT 59.780 45.833 0.00 0.00 0.00 2.57
171 172 5.621104 CGCTATGTACTCCTCCATCTTCATC 60.621 48.000 0.00 0.00 0.00 2.92
172 173 5.244851 GCTATGTACTCCTCCATCTTCATCA 59.755 44.000 0.00 0.00 0.00 3.07
173 174 5.804944 ATGTACTCCTCCATCTTCATCAG 57.195 43.478 0.00 0.00 0.00 2.90
174 175 4.614475 TGTACTCCTCCATCTTCATCAGT 58.386 43.478 0.00 0.00 0.00 3.41
175 176 4.403752 TGTACTCCTCCATCTTCATCAGTG 59.596 45.833 0.00 0.00 0.00 3.66
176 177 3.717576 ACTCCTCCATCTTCATCAGTGA 58.282 45.455 0.00 0.00 0.00 3.41
177 178 4.099633 ACTCCTCCATCTTCATCAGTGAA 58.900 43.478 0.00 0.00 41.89 3.18
178 179 4.533707 ACTCCTCCATCTTCATCAGTGAAA 59.466 41.667 0.00 0.00 43.39 2.69
179 180 5.191323 ACTCCTCCATCTTCATCAGTGAAAT 59.809 40.000 0.00 0.00 43.39 2.17
180 181 5.678583 TCCTCCATCTTCATCAGTGAAATC 58.321 41.667 0.00 0.00 43.39 2.17
181 182 4.820716 CCTCCATCTTCATCAGTGAAATCC 59.179 45.833 0.00 0.00 43.39 3.01
182 183 5.434408 CTCCATCTTCATCAGTGAAATCCA 58.566 41.667 0.00 0.00 43.39 3.41
183 184 5.434408 TCCATCTTCATCAGTGAAATCCAG 58.566 41.667 0.00 0.00 43.39 3.86
184 185 4.036498 CCATCTTCATCAGTGAAATCCAGC 59.964 45.833 0.00 0.00 43.39 4.85
185 186 4.290711 TCTTCATCAGTGAAATCCAGCA 57.709 40.909 0.00 0.00 43.39 4.41
186 187 4.654915 TCTTCATCAGTGAAATCCAGCAA 58.345 39.130 0.00 0.00 43.39 3.91
187 188 4.456911 TCTTCATCAGTGAAATCCAGCAAC 59.543 41.667 0.00 0.00 43.39 4.17
188 189 2.743664 TCATCAGTGAAATCCAGCAACG 59.256 45.455 0.00 0.00 0.00 4.10
189 190 2.254546 TCAGTGAAATCCAGCAACGT 57.745 45.000 0.00 0.00 0.00 3.99
190 191 3.394674 TCAGTGAAATCCAGCAACGTA 57.605 42.857 0.00 0.00 0.00 3.57
191 192 3.064207 TCAGTGAAATCCAGCAACGTAC 58.936 45.455 0.00 0.00 0.00 3.67
192 193 2.159627 CAGTGAAATCCAGCAACGTACC 59.840 50.000 0.00 0.00 0.00 3.34
193 194 1.127951 GTGAAATCCAGCAACGTACCG 59.872 52.381 0.00 0.00 0.00 4.02
194 195 1.001068 TGAAATCCAGCAACGTACCGA 59.999 47.619 0.00 0.00 0.00 4.69
195 196 2.277084 GAAATCCAGCAACGTACCGAT 58.723 47.619 0.00 0.00 0.00 4.18
196 197 1.651987 AATCCAGCAACGTACCGATG 58.348 50.000 0.00 0.00 32.96 3.84
204 205 2.492001 CAACGTACCGATGCTTTTTCG 58.508 47.619 0.00 0.00 36.38 3.46
205 206 1.787012 ACGTACCGATGCTTTTTCGT 58.213 45.000 0.00 0.00 34.85 3.85
206 207 1.723003 ACGTACCGATGCTTTTTCGTC 59.277 47.619 0.00 0.00 34.85 4.20
207 208 1.722464 CGTACCGATGCTTTTTCGTCA 59.278 47.619 0.00 0.00 34.85 4.35
208 209 2.156117 CGTACCGATGCTTTTTCGTCAA 59.844 45.455 0.00 0.00 34.85 3.18
209 210 2.969443 ACCGATGCTTTTTCGTCAAG 57.031 45.000 0.00 0.00 34.85 3.02
210 211 2.489971 ACCGATGCTTTTTCGTCAAGA 58.510 42.857 0.00 0.00 34.85 3.02
211 212 2.875933 ACCGATGCTTTTTCGTCAAGAA 59.124 40.909 0.00 0.00 37.01 2.52
212 213 3.314080 ACCGATGCTTTTTCGTCAAGAAA 59.686 39.130 0.00 0.00 46.22 2.52
224 225 3.831715 GTCAAGAAAAAGACGGGATGG 57.168 47.619 0.00 0.00 0.00 3.51
225 226 2.488153 GTCAAGAAAAAGACGGGATGGG 59.512 50.000 0.00 0.00 0.00 4.00
226 227 2.107552 TCAAGAAAAAGACGGGATGGGT 59.892 45.455 0.00 0.00 0.00 4.51
227 228 2.488153 CAAGAAAAAGACGGGATGGGTC 59.512 50.000 0.00 0.00 34.62 4.46
228 229 1.004394 AGAAAAAGACGGGATGGGTCC 59.996 52.381 0.00 0.00 44.29 4.46
240 241 4.213564 GGATGGGTCCAGATGACATATC 57.786 50.000 0.00 0.00 46.38 1.63
241 242 3.843027 GGATGGGTCCAGATGACATATCT 59.157 47.826 0.00 0.00 46.38 1.98
242 243 5.026121 GGATGGGTCCAGATGACATATCTA 58.974 45.833 0.00 0.00 46.38 1.98
243 244 5.105146 GGATGGGTCCAGATGACATATCTAC 60.105 48.000 0.00 0.00 46.38 2.59
244 245 4.814967 TGGGTCCAGATGACATATCTACA 58.185 43.478 0.00 0.00 46.38 2.74
245 246 5.406163 TGGGTCCAGATGACATATCTACAT 58.594 41.667 0.00 0.00 46.38 2.29
246 247 5.846164 TGGGTCCAGATGACATATCTACATT 59.154 40.000 0.00 0.00 46.38 2.71
247 248 6.169094 GGGTCCAGATGACATATCTACATTG 58.831 44.000 0.00 0.00 46.38 2.82
248 249 6.014242 GGGTCCAGATGACATATCTACATTGA 60.014 42.308 0.00 0.00 46.38 2.57
249 250 7.445121 GGTCCAGATGACATATCTACATTGAA 58.555 38.462 0.00 0.00 46.38 2.69
250 251 8.099537 GGTCCAGATGACATATCTACATTGAAT 58.900 37.037 0.00 0.00 46.38 2.57
262 263 9.770097 ATATCTACATTGAATAGTCAGTTGTGG 57.230 33.333 16.45 14.40 35.09 4.17
263 264 5.874810 TCTACATTGAATAGTCAGTTGTGGC 59.125 40.000 16.45 0.00 35.09 5.01
264 265 3.436704 ACATTGAATAGTCAGTTGTGGCG 59.563 43.478 9.25 0.00 33.24 5.69
265 266 2.093306 TGAATAGTCAGTTGTGGCGG 57.907 50.000 0.00 0.00 31.53 6.13
266 267 0.727398 GAATAGTCAGTTGTGGCGGC 59.273 55.000 0.00 0.00 31.53 6.53
267 268 0.036164 AATAGTCAGTTGTGGCGGCA 59.964 50.000 7.97 7.97 31.53 5.69
268 269 0.673644 ATAGTCAGTTGTGGCGGCAC 60.674 55.000 33.07 33.07 31.53 5.01
269 270 2.034048 TAGTCAGTTGTGGCGGCACA 62.034 55.000 37.56 37.56 31.53 4.57
270 271 2.112928 TCAGTTGTGGCGGCACAT 59.887 55.556 40.34 26.73 34.76 3.21
271 272 2.256158 CAGTTGTGGCGGCACATG 59.744 61.111 40.34 32.27 34.76 3.21
272 273 2.112928 AGTTGTGGCGGCACATGA 59.887 55.556 40.34 26.73 34.76 3.07
273 274 1.303561 AGTTGTGGCGGCACATGAT 60.304 52.632 40.34 27.04 34.76 2.45
274 275 0.895100 AGTTGTGGCGGCACATGATT 60.895 50.000 40.34 23.34 34.76 2.57
275 276 0.808125 GTTGTGGCGGCACATGATTA 59.192 50.000 40.34 25.27 34.76 1.75
276 277 1.201181 GTTGTGGCGGCACATGATTAA 59.799 47.619 40.34 24.55 34.76 1.40
277 278 0.808125 TGTGGCGGCACATGATTAAC 59.192 50.000 37.56 11.98 0.00 2.01
278 279 0.100503 GTGGCGGCACATGATTAACC 59.899 55.000 34.40 5.14 0.00 2.85
279 280 1.355210 GGCGGCACATGATTAACCG 59.645 57.895 3.07 6.00 46.50 4.44
280 281 1.373590 GGCGGCACATGATTAACCGT 61.374 55.000 3.07 0.00 45.53 4.83
281 282 0.027586 GCGGCACATGATTAACCGTC 59.972 55.000 0.00 0.00 45.53 4.79
282 283 1.651987 CGGCACATGATTAACCGTCT 58.348 50.000 0.00 0.00 39.05 4.18
283 284 2.006888 CGGCACATGATTAACCGTCTT 58.993 47.619 0.00 0.00 39.05 3.01
284 285 3.191669 CGGCACATGATTAACCGTCTTA 58.808 45.455 0.00 0.00 39.05 2.10
285 286 3.000925 CGGCACATGATTAACCGTCTTAC 59.999 47.826 0.00 0.00 39.05 2.34
286 287 3.936453 GGCACATGATTAACCGTCTTACA 59.064 43.478 0.00 0.00 0.00 2.41
287 288 4.574828 GGCACATGATTAACCGTCTTACAT 59.425 41.667 0.00 0.00 0.00 2.29
288 289 5.065988 GGCACATGATTAACCGTCTTACATT 59.934 40.000 0.00 0.00 0.00 2.71
289 290 6.192360 GCACATGATTAACCGTCTTACATTC 58.808 40.000 0.00 0.00 0.00 2.67
290 291 6.183360 GCACATGATTAACCGTCTTACATTCA 60.183 38.462 0.00 0.00 0.00 2.57
291 292 7.625395 GCACATGATTAACCGTCTTACATTCAA 60.625 37.037 0.00 0.00 0.00 2.69
292 293 8.233868 CACATGATTAACCGTCTTACATTCAAA 58.766 33.333 0.00 0.00 0.00 2.69
293 294 8.788806 ACATGATTAACCGTCTTACATTCAAAA 58.211 29.630 0.00 0.00 0.00 2.44
294 295 9.787532 CATGATTAACCGTCTTACATTCAAAAT 57.212 29.630 0.00 0.00 0.00 1.82
301 302 9.620660 AACCGTCTTACATTCAAAATATTTGAC 57.379 29.630 0.39 1.04 0.00 3.18
302 303 7.960738 ACCGTCTTACATTCAAAATATTTGACG 59.039 33.333 17.87 17.87 40.99 4.35
303 304 8.172484 CCGTCTTACATTCAAAATATTTGACGA 58.828 33.333 22.79 10.60 42.99 4.20
304 305 8.985694 CGTCTTACATTCAAAATATTTGACGAC 58.014 33.333 19.13 9.04 42.99 4.34
305 306 9.820229 GTCTTACATTCAAAATATTTGACGACA 57.180 29.630 0.39 0.00 0.00 4.35
310 311 8.914654 ACATTCAAAATATTTGACGACATTGTG 58.085 29.630 0.39 0.00 0.00 3.33
311 312 8.914654 CATTCAAAATATTTGACGACATTGTGT 58.085 29.630 0.39 0.00 0.00 3.72
312 313 7.850268 TCAAAATATTTGACGACATTGTGTG 57.150 32.000 0.39 0.00 0.00 3.82
313 314 7.643579 TCAAAATATTTGACGACATTGTGTGA 58.356 30.769 0.39 0.00 0.00 3.58
314 315 8.296000 TCAAAATATTTGACGACATTGTGTGAT 58.704 29.630 0.39 0.00 0.00 3.06
315 316 8.577939 CAAAATATTTGACGACATTGTGTGATC 58.422 33.333 0.39 0.00 0.00 2.92
316 317 6.983474 ATATTTGACGACATTGTGTGATCA 57.017 33.333 0.00 0.00 0.00 2.92
317 318 5.687770 ATTTGACGACATTGTGTGATCAA 57.312 34.783 0.00 0.00 0.00 2.57
318 319 5.491635 TTTGACGACATTGTGTGATCAAA 57.508 34.783 0.00 11.40 36.41 2.69
319 320 5.491635 TTGACGACATTGTGTGATCAAAA 57.508 34.783 0.00 0.00 30.51 2.44
320 321 5.094429 TGACGACATTGTGTGATCAAAAG 57.906 39.130 0.00 0.00 0.00 2.27
321 322 3.888934 ACGACATTGTGTGATCAAAAGC 58.111 40.909 0.00 0.00 0.00 3.51
322 323 3.565482 ACGACATTGTGTGATCAAAAGCT 59.435 39.130 0.00 0.00 0.00 3.74
323 324 4.153986 CGACATTGTGTGATCAAAAGCTC 58.846 43.478 0.00 0.00 0.00 4.09
324 325 4.083643 CGACATTGTGTGATCAAAAGCTCT 60.084 41.667 0.00 0.00 0.00 4.09
325 326 5.117355 ACATTGTGTGATCAAAAGCTCTG 57.883 39.130 0.00 0.00 0.00 3.35
326 327 4.022589 ACATTGTGTGATCAAAAGCTCTGG 60.023 41.667 0.00 0.00 0.00 3.86
327 328 3.490439 TGTGTGATCAAAAGCTCTGGA 57.510 42.857 0.00 0.00 0.00 3.86
328 329 3.141398 TGTGTGATCAAAAGCTCTGGAC 58.859 45.455 0.00 0.00 0.00 4.02
329 330 3.141398 GTGTGATCAAAAGCTCTGGACA 58.859 45.455 0.00 0.00 0.00 4.02
330 331 3.565482 GTGTGATCAAAAGCTCTGGACAA 59.435 43.478 0.00 0.00 0.00 3.18
331 332 3.565482 TGTGATCAAAAGCTCTGGACAAC 59.435 43.478 0.00 0.00 0.00 3.32
332 333 3.565482 GTGATCAAAAGCTCTGGACAACA 59.435 43.478 0.00 0.00 0.00 3.33
333 334 4.217118 GTGATCAAAAGCTCTGGACAACAT 59.783 41.667 0.00 0.00 0.00 2.71
334 335 5.412594 GTGATCAAAAGCTCTGGACAACATA 59.587 40.000 0.00 0.00 0.00 2.29
335 336 6.003326 TGATCAAAAGCTCTGGACAACATAA 58.997 36.000 0.00 0.00 0.00 1.90
336 337 6.489700 TGATCAAAAGCTCTGGACAACATAAA 59.510 34.615 0.00 0.00 0.00 1.40
337 338 6.707440 TCAAAAGCTCTGGACAACATAAAA 57.293 33.333 0.00 0.00 0.00 1.52
338 339 6.503524 TCAAAAGCTCTGGACAACATAAAAC 58.496 36.000 0.00 0.00 0.00 2.43
339 340 6.096141 TCAAAAGCTCTGGACAACATAAAACA 59.904 34.615 0.00 0.00 0.00 2.83
340 341 6.463995 AAAGCTCTGGACAACATAAAACAA 57.536 33.333 0.00 0.00 0.00 2.83
341 342 5.695851 AGCTCTGGACAACATAAAACAAG 57.304 39.130 0.00 0.00 0.00 3.16
342 343 5.376625 AGCTCTGGACAACATAAAACAAGA 58.623 37.500 0.00 0.00 0.00 3.02
343 344 5.471456 AGCTCTGGACAACATAAAACAAGAG 59.529 40.000 0.00 0.00 0.00 2.85
344 345 5.335191 GCTCTGGACAACATAAAACAAGAGG 60.335 44.000 0.00 0.00 0.00 3.69
345 346 5.070001 TCTGGACAACATAAAACAAGAGGG 58.930 41.667 0.00 0.00 0.00 4.30
346 347 4.798882 TGGACAACATAAAACAAGAGGGT 58.201 39.130 0.00 0.00 0.00 4.34
347 348 4.825085 TGGACAACATAAAACAAGAGGGTC 59.175 41.667 0.00 0.00 0.00 4.46
348 349 4.217767 GGACAACATAAAACAAGAGGGTCC 59.782 45.833 0.00 0.00 34.92 4.46
349 350 5.061721 ACAACATAAAACAAGAGGGTCCT 57.938 39.130 0.00 0.00 0.00 3.85
350 351 4.827284 ACAACATAAAACAAGAGGGTCCTG 59.173 41.667 0.00 0.00 0.00 3.86
351 352 4.993705 ACATAAAACAAGAGGGTCCTGA 57.006 40.909 0.00 0.00 0.00 3.86
352 353 4.652822 ACATAAAACAAGAGGGTCCTGAC 58.347 43.478 0.00 0.00 0.00 3.51
361 362 4.934989 GGTCCTGACCGGAATGAC 57.065 61.111 9.46 9.04 45.32 3.06
362 363 1.980052 GGTCCTGACCGGAATGACA 59.020 57.895 9.46 0.00 45.32 3.58
363 364 0.323629 GGTCCTGACCGGAATGACAA 59.676 55.000 9.46 0.00 45.32 3.18
364 365 1.271163 GGTCCTGACCGGAATGACAAA 60.271 52.381 9.46 0.00 45.32 2.83
365 366 2.076863 GTCCTGACCGGAATGACAAAG 58.923 52.381 9.46 0.00 45.32 2.77
366 367 0.804989 CCTGACCGGAATGACAAAGC 59.195 55.000 9.46 0.00 33.16 3.51
367 368 1.522668 CTGACCGGAATGACAAAGCA 58.477 50.000 9.46 0.00 0.00 3.91
368 369 2.086869 CTGACCGGAATGACAAAGCAT 58.913 47.619 9.46 0.00 0.00 3.79
369 370 3.270027 CTGACCGGAATGACAAAGCATA 58.730 45.455 9.46 0.00 0.00 3.14
370 371 3.680490 TGACCGGAATGACAAAGCATAA 58.320 40.909 9.46 0.00 0.00 1.90
371 372 3.689161 TGACCGGAATGACAAAGCATAAG 59.311 43.478 9.46 0.00 0.00 1.73
372 373 3.686016 ACCGGAATGACAAAGCATAAGT 58.314 40.909 9.46 0.00 0.00 2.24
373 374 4.079253 ACCGGAATGACAAAGCATAAGTT 58.921 39.130 9.46 0.00 0.00 2.66
374 375 5.250200 ACCGGAATGACAAAGCATAAGTTA 58.750 37.500 9.46 0.00 0.00 2.24
375 376 5.354234 ACCGGAATGACAAAGCATAAGTTAG 59.646 40.000 9.46 0.00 0.00 2.34
376 377 5.584649 CCGGAATGACAAAGCATAAGTTAGA 59.415 40.000 0.00 0.00 0.00 2.10
377 378 6.093495 CCGGAATGACAAAGCATAAGTTAGAA 59.907 38.462 0.00 0.00 0.00 2.10
378 379 7.182761 CGGAATGACAAAGCATAAGTTAGAAG 58.817 38.462 0.00 0.00 0.00 2.85
379 380 6.969473 GGAATGACAAAGCATAAGTTAGAAGC 59.031 38.462 0.00 0.00 0.00 3.86
380 381 7.148171 GGAATGACAAAGCATAAGTTAGAAGCT 60.148 37.037 2.45 2.45 37.08 3.74
381 382 7.693969 ATGACAAAGCATAAGTTAGAAGCTT 57.306 32.000 0.00 0.00 46.49 3.74
382 383 8.792830 ATGACAAAGCATAAGTTAGAAGCTTA 57.207 30.769 15.92 5.72 44.03 3.09
383 384 8.792830 TGACAAAGCATAAGTTAGAAGCTTAT 57.207 30.769 15.92 0.00 44.03 1.73
384 385 9.884636 TGACAAAGCATAAGTTAGAAGCTTATA 57.115 29.630 15.92 0.00 44.03 0.98
395 396 9.482627 AAGTTAGAAGCTTATATATGACTGCAC 57.517 33.333 0.00 0.00 0.00 4.57
396 397 8.091449 AGTTAGAAGCTTATATATGACTGCACC 58.909 37.037 0.00 0.00 0.00 5.01
397 398 6.425210 AGAAGCTTATATATGACTGCACCA 57.575 37.500 0.00 0.00 0.00 4.17
398 399 6.830912 AGAAGCTTATATATGACTGCACCAA 58.169 36.000 0.00 0.00 0.00 3.67
399 400 6.708054 AGAAGCTTATATATGACTGCACCAAC 59.292 38.462 0.00 0.00 0.00 3.77
400 401 6.179906 AGCTTATATATGACTGCACCAACT 57.820 37.500 0.00 0.00 0.00 3.16
401 402 6.595682 AGCTTATATATGACTGCACCAACTT 58.404 36.000 0.00 0.00 0.00 2.66
402 403 7.056635 AGCTTATATATGACTGCACCAACTTT 58.943 34.615 0.00 0.00 0.00 2.66
403 404 8.210946 AGCTTATATATGACTGCACCAACTTTA 58.789 33.333 0.00 0.00 0.00 1.85
404 405 9.003658 GCTTATATATGACTGCACCAACTTTAT 57.996 33.333 0.00 0.00 0.00 1.40
408 409 7.944729 ATATGACTGCACCAACTTTATTCTT 57.055 32.000 0.00 0.00 0.00 2.52
410 411 7.759489 ATGACTGCACCAACTTTATTCTTAA 57.241 32.000 0.00 0.00 0.00 1.85
411 412 7.575414 TGACTGCACCAACTTTATTCTTAAA 57.425 32.000 0.00 0.00 0.00 1.52
412 413 8.177119 TGACTGCACCAACTTTATTCTTAAAT 57.823 30.769 0.00 0.00 0.00 1.40
413 414 8.296713 TGACTGCACCAACTTTATTCTTAAATC 58.703 33.333 0.00 0.00 0.00 2.17
414 415 8.177119 ACTGCACCAACTTTATTCTTAAATCA 57.823 30.769 0.00 0.00 0.00 2.57
415 416 8.637986 ACTGCACCAACTTTATTCTTAAATCAA 58.362 29.630 0.00 0.00 0.00 2.57
416 417 9.474920 CTGCACCAACTTTATTCTTAAATCAAA 57.525 29.630 0.00 0.00 0.00 2.69
417 418 9.474920 TGCACCAACTTTATTCTTAAATCAAAG 57.525 29.630 0.00 0.00 33.45 2.77
418 419 8.435430 GCACCAACTTTATTCTTAAATCAAAGC 58.565 33.333 0.00 0.00 30.97 3.51
419 420 9.474920 CACCAACTTTATTCTTAAATCAAAGCA 57.525 29.630 0.00 0.00 30.97 3.91
420 421 9.696917 ACCAACTTTATTCTTAAATCAAAGCAG 57.303 29.630 0.00 0.00 30.97 4.24
421 422 8.650714 CCAACTTTATTCTTAAATCAAAGCAGC 58.349 33.333 0.00 0.00 30.97 5.25
422 423 9.195411 CAACTTTATTCTTAAATCAAAGCAGCA 57.805 29.630 0.00 0.00 30.97 4.41
423 424 9.933723 AACTTTATTCTTAAATCAAAGCAGCAT 57.066 25.926 0.00 0.00 30.97 3.79
424 425 9.362539 ACTTTATTCTTAAATCAAAGCAGCATG 57.637 29.630 0.00 0.00 40.87 4.06
441 442 2.158254 GCATGCTGCTTTAACTTTTGGC 59.842 45.455 11.37 0.00 40.96 4.52
442 443 3.656559 CATGCTGCTTTAACTTTTGGCT 58.343 40.909 0.00 0.00 0.00 4.75
443 444 3.096489 TGCTGCTTTAACTTTTGGCTG 57.904 42.857 0.00 0.00 0.00 4.85
444 445 2.224018 TGCTGCTTTAACTTTTGGCTGG 60.224 45.455 0.00 0.00 0.00 4.85
445 446 2.407090 CTGCTTTAACTTTTGGCTGGC 58.593 47.619 0.00 0.00 0.00 4.85
446 447 1.069978 TGCTTTAACTTTTGGCTGGCC 59.930 47.619 4.43 4.43 0.00 5.36
447 448 1.344438 GCTTTAACTTTTGGCTGGCCT 59.656 47.619 13.05 0.00 36.94 5.19
448 449 2.224281 GCTTTAACTTTTGGCTGGCCTT 60.224 45.455 13.05 1.10 36.94 4.35
449 450 3.744214 GCTTTAACTTTTGGCTGGCCTTT 60.744 43.478 13.05 1.71 36.94 3.11
450 451 3.467374 TTAACTTTTGGCTGGCCTTTG 57.533 42.857 13.05 0.00 36.94 2.77
451 452 0.179048 AACTTTTGGCTGGCCTTTGC 60.179 50.000 13.05 5.80 36.94 3.68
469 470 3.921119 TGCCTTTGCAGTGAATGTAAG 57.079 42.857 0.00 0.00 44.23 2.34
470 471 3.485394 TGCCTTTGCAGTGAATGTAAGA 58.515 40.909 0.00 0.00 44.23 2.10
471 472 3.503363 TGCCTTTGCAGTGAATGTAAGAG 59.497 43.478 0.00 0.00 44.23 2.85
472 473 3.671702 GCCTTTGCAGTGAATGTAAGAGC 60.672 47.826 0.00 0.00 34.79 4.09
473 474 3.425359 CCTTTGCAGTGAATGTAAGAGCG 60.425 47.826 0.00 0.00 34.79 5.03
474 475 1.078709 TGCAGTGAATGTAAGAGCGC 58.921 50.000 0.00 0.00 0.00 5.92
475 476 1.078709 GCAGTGAATGTAAGAGCGCA 58.921 50.000 11.47 0.00 0.00 6.09
476 477 1.667724 GCAGTGAATGTAAGAGCGCAT 59.332 47.619 11.47 0.00 0.00 4.73
477 478 2.286067 GCAGTGAATGTAAGAGCGCATC 60.286 50.000 11.47 4.24 0.00 3.91
478 479 2.931969 CAGTGAATGTAAGAGCGCATCA 59.068 45.455 11.47 0.95 0.00 3.07
479 480 3.371898 CAGTGAATGTAAGAGCGCATCAA 59.628 43.478 11.47 0.00 0.00 2.57
480 481 4.034858 CAGTGAATGTAAGAGCGCATCAAT 59.965 41.667 11.47 0.58 0.00 2.57
481 482 4.272018 AGTGAATGTAAGAGCGCATCAATC 59.728 41.667 11.47 0.00 0.00 2.67
482 483 4.272018 GTGAATGTAAGAGCGCATCAATCT 59.728 41.667 11.47 0.00 0.00 2.40
483 484 5.463392 GTGAATGTAAGAGCGCATCAATCTA 59.537 40.000 11.47 0.00 0.00 1.98
484 485 6.018751 GTGAATGTAAGAGCGCATCAATCTAA 60.019 38.462 11.47 0.00 0.00 2.10
485 486 6.707608 TGAATGTAAGAGCGCATCAATCTAAT 59.292 34.615 11.47 0.00 0.00 1.73
486 487 6.718454 ATGTAAGAGCGCATCAATCTAATC 57.282 37.500 11.47 0.00 0.00 1.75
487 488 5.847304 TGTAAGAGCGCATCAATCTAATCT 58.153 37.500 11.47 0.00 0.00 2.40
488 489 6.283694 TGTAAGAGCGCATCAATCTAATCTT 58.716 36.000 11.47 8.32 0.00 2.40
489 490 6.763135 TGTAAGAGCGCATCAATCTAATCTTT 59.237 34.615 11.47 0.00 0.00 2.52
490 491 5.670149 AGAGCGCATCAATCTAATCTTTG 57.330 39.130 11.47 0.00 0.00 2.77
491 492 5.121811 AGAGCGCATCAATCTAATCTTTGT 58.878 37.500 11.47 0.00 0.00 2.83
492 493 5.236047 AGAGCGCATCAATCTAATCTTTGTC 59.764 40.000 11.47 0.00 0.00 3.18
493 494 4.274459 AGCGCATCAATCTAATCTTTGTCC 59.726 41.667 11.47 0.00 0.00 4.02
494 495 4.035558 GCGCATCAATCTAATCTTTGTCCA 59.964 41.667 0.30 0.00 0.00 4.02
495 496 5.745514 CGCATCAATCTAATCTTTGTCCAG 58.254 41.667 0.00 0.00 0.00 3.86
496 497 5.277683 CGCATCAATCTAATCTTTGTCCAGG 60.278 44.000 0.00 0.00 0.00 4.45
497 498 5.824624 GCATCAATCTAATCTTTGTCCAGGA 59.175 40.000 0.00 0.00 0.00 3.86
498 499 6.017275 GCATCAATCTAATCTTTGTCCAGGAG 60.017 42.308 0.00 0.00 0.00 3.69
499 500 6.874278 TCAATCTAATCTTTGTCCAGGAGA 57.126 37.500 0.00 0.00 0.00 3.71
500 501 7.443302 TCAATCTAATCTTTGTCCAGGAGAT 57.557 36.000 0.00 0.00 0.00 2.75
501 502 7.278135 TCAATCTAATCTTTGTCCAGGAGATG 58.722 38.462 0.00 0.00 30.91 2.90
502 503 6.821616 ATCTAATCTTTGTCCAGGAGATGT 57.178 37.500 0.00 0.00 30.91 3.06
503 504 7.921041 ATCTAATCTTTGTCCAGGAGATGTA 57.079 36.000 0.00 0.00 30.91 2.29
504 505 7.113658 TCTAATCTTTGTCCAGGAGATGTAC 57.886 40.000 0.00 0.00 30.91 2.90
505 506 5.762179 AATCTTTGTCCAGGAGATGTACA 57.238 39.130 0.00 0.00 30.91 2.90
506 507 5.762179 ATCTTTGTCCAGGAGATGTACAA 57.238 39.130 0.00 0.00 0.00 2.41
507 508 5.152623 TCTTTGTCCAGGAGATGTACAAG 57.847 43.478 0.00 0.00 32.18 3.16
508 509 4.593206 TCTTTGTCCAGGAGATGTACAAGT 59.407 41.667 0.00 0.00 32.18 3.16
509 510 4.974645 TTGTCCAGGAGATGTACAAGTT 57.025 40.909 0.00 0.00 0.00 2.66
510 511 4.974645 TGTCCAGGAGATGTACAAGTTT 57.025 40.909 0.00 0.00 0.00 2.66
511 512 4.641396 TGTCCAGGAGATGTACAAGTTTG 58.359 43.478 0.00 0.00 0.00 2.93
512 513 4.003648 GTCCAGGAGATGTACAAGTTTGG 58.996 47.826 0.00 5.12 0.00 3.28
513 514 3.907474 TCCAGGAGATGTACAAGTTTGGA 59.093 43.478 0.00 7.46 0.00 3.53
514 515 4.536090 TCCAGGAGATGTACAAGTTTGGAT 59.464 41.667 0.00 0.00 0.00 3.41
515 516 4.637534 CCAGGAGATGTACAAGTTTGGATG 59.362 45.833 0.00 0.00 0.00 3.51
516 517 4.637534 CAGGAGATGTACAAGTTTGGATGG 59.362 45.833 0.00 0.00 0.00 3.51
517 518 3.378427 GGAGATGTACAAGTTTGGATGGC 59.622 47.826 0.00 0.00 0.00 4.40
518 519 3.356290 AGATGTACAAGTTTGGATGGCC 58.644 45.455 0.00 0.00 0.00 5.36
519 520 1.529226 TGTACAAGTTTGGATGGCCG 58.471 50.000 0.00 0.00 36.79 6.13
520 521 1.202830 TGTACAAGTTTGGATGGCCGT 60.203 47.619 0.00 0.00 36.79 5.68
521 522 2.038689 TGTACAAGTTTGGATGGCCGTA 59.961 45.455 0.00 0.00 36.79 4.02
522 523 2.507407 ACAAGTTTGGATGGCCGTAT 57.493 45.000 0.00 0.00 36.79 3.06
523 524 2.091541 ACAAGTTTGGATGGCCGTATG 58.908 47.619 0.00 0.00 36.79 2.39
524 525 1.102978 AAGTTTGGATGGCCGTATGC 58.897 50.000 0.00 0.00 36.79 3.14
525 526 0.034574 AGTTTGGATGGCCGTATGCA 60.035 50.000 0.00 0.00 43.89 3.96
526 527 1.032014 GTTTGGATGGCCGTATGCAT 58.968 50.000 3.79 3.79 43.89 3.96
527 528 1.001378 GTTTGGATGGCCGTATGCATC 60.001 52.381 0.19 0.00 43.89 3.91
528 529 0.884259 TTGGATGGCCGTATGCATCG 60.884 55.000 0.19 7.03 43.89 3.84
529 530 1.301716 GGATGGCCGTATGCATCGT 60.302 57.895 0.19 0.00 43.89 3.73
530 531 0.884704 GGATGGCCGTATGCATCGTT 60.885 55.000 0.19 0.00 43.89 3.85
531 532 0.944386 GATGGCCGTATGCATCGTTT 59.056 50.000 0.19 0.00 43.89 3.60
532 533 1.333619 GATGGCCGTATGCATCGTTTT 59.666 47.619 0.19 0.00 43.89 2.43
533 534 0.449786 TGGCCGTATGCATCGTTTTG 59.550 50.000 0.19 0.00 43.89 2.44
534 535 0.730265 GGCCGTATGCATCGTTTTGA 59.270 50.000 0.19 0.00 43.89 2.69
535 536 1.333619 GGCCGTATGCATCGTTTTGAT 59.666 47.619 0.19 0.00 43.89 2.57
545 546 1.428448 TCGTTTTGATGCAGAGACCG 58.572 50.000 0.00 0.00 0.00 4.79
546 547 1.000394 TCGTTTTGATGCAGAGACCGA 60.000 47.619 0.00 0.00 0.00 4.69
547 548 1.391485 CGTTTTGATGCAGAGACCGAG 59.609 52.381 0.00 0.00 0.00 4.63
548 549 1.734465 GTTTTGATGCAGAGACCGAGG 59.266 52.381 0.00 0.00 0.00 4.63
549 550 1.266178 TTTGATGCAGAGACCGAGGA 58.734 50.000 0.00 0.00 0.00 3.71
550 551 1.489481 TTGATGCAGAGACCGAGGAT 58.511 50.000 0.00 0.00 0.00 3.24
551 552 2.364972 TGATGCAGAGACCGAGGATA 57.635 50.000 0.00 0.00 0.00 2.59
552 553 2.666317 TGATGCAGAGACCGAGGATAA 58.334 47.619 0.00 0.00 0.00 1.75
553 554 2.362397 TGATGCAGAGACCGAGGATAAC 59.638 50.000 0.00 0.00 0.00 1.89
554 555 1.112113 TGCAGAGACCGAGGATAACC 58.888 55.000 0.00 0.00 0.00 2.85
588 589 5.494632 AAAAAGGAGACGTACAAGTTTGG 57.505 39.130 0.00 0.00 0.00 3.28
589 590 4.411256 AAAGGAGACGTACAAGTTTGGA 57.589 40.909 0.00 0.00 0.00 3.53
590 591 3.662247 AGGAGACGTACAAGTTTGGAG 57.338 47.619 0.00 0.00 0.00 3.86
591 592 2.299297 AGGAGACGTACAAGTTTGGAGG 59.701 50.000 0.00 0.00 33.26 4.30
592 593 2.298163 GGAGACGTACAAGTTTGGAGGA 59.702 50.000 3.95 0.00 31.55 3.71
593 594 3.243975 GGAGACGTACAAGTTTGGAGGAA 60.244 47.826 3.95 0.00 31.55 3.36
594 595 4.562963 GGAGACGTACAAGTTTGGAGGAAT 60.563 45.833 3.95 0.00 31.55 3.01
595 596 5.337009 GGAGACGTACAAGTTTGGAGGAATA 60.337 44.000 3.95 0.00 31.55 1.75
596 597 6.295719 AGACGTACAAGTTTGGAGGAATAT 57.704 37.500 3.95 0.00 31.55 1.28
597 598 6.708285 AGACGTACAAGTTTGGAGGAATATT 58.292 36.000 3.95 0.00 31.55 1.28
598 599 7.166167 AGACGTACAAGTTTGGAGGAATATTT 58.834 34.615 3.95 0.00 31.55 1.40
599 600 8.316214 AGACGTACAAGTTTGGAGGAATATTTA 58.684 33.333 3.95 0.00 31.55 1.40
600 601 8.851541 ACGTACAAGTTTGGAGGAATATTTAA 57.148 30.769 3.95 0.00 31.55 1.52
601 602 9.287373 ACGTACAAGTTTGGAGGAATATTTAAA 57.713 29.630 3.95 0.00 31.55 1.52
602 603 9.769093 CGTACAAGTTTGGAGGAATATTTAAAG 57.231 33.333 0.00 0.00 0.00 1.85
605 606 8.803235 ACAAGTTTGGAGGAATATTTAAAGACC 58.197 33.333 0.00 0.00 0.00 3.85
606 607 7.956328 AGTTTGGAGGAATATTTAAAGACCC 57.044 36.000 0.00 0.00 0.00 4.46
607 608 6.895756 AGTTTGGAGGAATATTTAAAGACCCC 59.104 38.462 0.00 0.00 0.00 4.95
608 609 5.043737 TGGAGGAATATTTAAAGACCCCG 57.956 43.478 0.00 0.00 0.00 5.73
609 610 4.722781 TGGAGGAATATTTAAAGACCCCGA 59.277 41.667 0.00 0.00 0.00 5.14
610 611 5.163237 TGGAGGAATATTTAAAGACCCCGAG 60.163 44.000 0.00 0.00 0.00 4.63
611 612 5.071384 GGAGGAATATTTAAAGACCCCGAGA 59.929 44.000 0.00 0.00 0.00 4.04
612 613 6.176014 AGGAATATTTAAAGACCCCGAGAG 57.824 41.667 0.00 0.00 0.00 3.20
613 614 5.903589 AGGAATATTTAAAGACCCCGAGAGA 59.096 40.000 0.00 0.00 0.00 3.10
614 615 6.559157 AGGAATATTTAAAGACCCCGAGAGAT 59.441 38.462 0.00 0.00 0.00 2.75
615 616 6.651225 GGAATATTTAAAGACCCCGAGAGATG 59.349 42.308 0.00 0.00 0.00 2.90
616 617 2.981859 TTAAAGACCCCGAGAGATGC 57.018 50.000 0.00 0.00 0.00 3.91
617 618 2.160721 TAAAGACCCCGAGAGATGCT 57.839 50.000 0.00 0.00 0.00 3.79
618 619 0.539051 AAAGACCCCGAGAGATGCTG 59.461 55.000 0.00 0.00 0.00 4.41
619 620 1.965754 AAGACCCCGAGAGATGCTGC 61.966 60.000 0.00 0.00 0.00 5.25
620 621 3.781770 GACCCCGAGAGATGCTGCG 62.782 68.421 0.00 0.00 0.00 5.18
621 622 4.598894 CCCCGAGAGATGCTGCGG 62.599 72.222 0.00 0.00 43.20 5.69
622 623 3.531207 CCCGAGAGATGCTGCGGA 61.531 66.667 0.00 0.00 46.29 5.54
623 624 2.496341 CCGAGAGATGCTGCGGAA 59.504 61.111 0.00 0.00 46.29 4.30
624 625 1.153568 CCGAGAGATGCTGCGGAAA 60.154 57.895 0.00 0.00 46.29 3.13
625 626 1.150567 CCGAGAGATGCTGCGGAAAG 61.151 60.000 0.00 0.00 46.29 2.62
626 627 0.179127 CGAGAGATGCTGCGGAAAGA 60.179 55.000 0.00 0.00 0.00 2.52
627 628 1.737029 CGAGAGATGCTGCGGAAAGAA 60.737 52.381 0.00 0.00 0.00 2.52
628 629 1.932511 GAGAGATGCTGCGGAAAGAAG 59.067 52.381 0.00 0.00 0.00 2.85
629 630 1.552337 AGAGATGCTGCGGAAAGAAGA 59.448 47.619 0.00 0.00 0.00 2.87
630 631 1.932511 GAGATGCTGCGGAAAGAAGAG 59.067 52.381 0.00 0.00 0.00 2.85
631 632 1.552337 AGATGCTGCGGAAAGAAGAGA 59.448 47.619 0.00 0.00 0.00 3.10
632 633 2.027745 AGATGCTGCGGAAAGAAGAGAA 60.028 45.455 0.00 0.00 0.00 2.87
633 634 1.800805 TGCTGCGGAAAGAAGAGAAG 58.199 50.000 0.00 0.00 0.00 2.85
634 635 0.445829 GCTGCGGAAAGAAGAGAAGC 59.554 55.000 0.00 0.00 0.00 3.86
635 636 1.082690 CTGCGGAAAGAAGAGAAGCC 58.917 55.000 0.00 0.00 0.00 4.35
636 637 0.396435 TGCGGAAAGAAGAGAAGCCA 59.604 50.000 0.00 0.00 0.00 4.75
637 638 1.003580 TGCGGAAAGAAGAGAAGCCAT 59.996 47.619 0.00 0.00 0.00 4.40
638 639 1.399791 GCGGAAAGAAGAGAAGCCATG 59.600 52.381 0.00 0.00 0.00 3.66
639 640 2.012673 CGGAAAGAAGAGAAGCCATGG 58.987 52.381 7.63 7.63 0.00 3.66
640 641 2.616510 CGGAAAGAAGAGAAGCCATGGT 60.617 50.000 14.67 0.00 0.00 3.55
641 642 3.013219 GGAAAGAAGAGAAGCCATGGTC 58.987 50.000 14.67 3.65 0.00 4.02
642 643 3.560025 GGAAAGAAGAGAAGCCATGGTCA 60.560 47.826 14.67 0.00 0.00 4.02
643 644 3.795688 AAGAAGAGAAGCCATGGTCAA 57.204 42.857 14.67 0.00 0.00 3.18
644 645 4.313020 AAGAAGAGAAGCCATGGTCAAT 57.687 40.909 14.67 0.00 0.00 2.57
645 646 3.883669 AGAAGAGAAGCCATGGTCAATC 58.116 45.455 14.67 7.29 0.00 2.67
646 647 3.522750 AGAAGAGAAGCCATGGTCAATCT 59.477 43.478 14.67 11.56 0.00 2.40
647 648 3.278668 AGAGAAGCCATGGTCAATCTG 57.721 47.619 14.67 0.00 0.00 2.90
648 649 2.575279 AGAGAAGCCATGGTCAATCTGT 59.425 45.455 14.67 7.71 0.00 3.41
649 650 3.009916 AGAGAAGCCATGGTCAATCTGTT 59.990 43.478 14.67 0.87 0.00 3.16
650 651 3.760684 GAGAAGCCATGGTCAATCTGTTT 59.239 43.478 14.67 0.00 0.00 2.83
651 652 3.508793 AGAAGCCATGGTCAATCTGTTTG 59.491 43.478 14.67 0.00 36.61 2.93
652 653 2.880443 AGCCATGGTCAATCTGTTTGT 58.120 42.857 14.67 0.00 36.65 2.83
653 654 2.821969 AGCCATGGTCAATCTGTTTGTC 59.178 45.455 14.67 0.00 36.65 3.18
654 655 2.094545 GCCATGGTCAATCTGTTTGTCC 60.095 50.000 14.67 7.51 42.03 4.02
659 660 5.261209 TGGTCAATCTGTTTGTCCAAAAG 57.739 39.130 12.82 0.00 46.26 2.27
660 661 4.099266 TGGTCAATCTGTTTGTCCAAAAGG 59.901 41.667 12.82 0.00 46.26 3.11
661 662 4.340950 GGTCAATCTGTTTGTCCAAAAGGA 59.659 41.667 9.05 0.00 41.52 3.36
662 663 5.011023 GGTCAATCTGTTTGTCCAAAAGGAT 59.989 40.000 9.05 0.00 41.52 3.24
663 664 5.922544 GTCAATCTGTTTGTCCAAAAGGATG 59.077 40.000 0.00 0.36 36.65 3.51
664 665 5.832595 TCAATCTGTTTGTCCAAAAGGATGA 59.167 36.000 0.00 2.18 36.65 2.92
665 666 5.712152 ATCTGTTTGTCCAAAAGGATGAC 57.288 39.130 0.00 0.00 31.33 3.06
666 667 3.563808 TCTGTTTGTCCAAAAGGATGACG 59.436 43.478 0.00 0.00 31.33 4.35
667 668 2.034053 TGTTTGTCCAAAAGGATGACGC 59.966 45.455 0.00 0.00 31.33 5.19
668 669 2.270352 TTGTCCAAAAGGATGACGCT 57.730 45.000 0.00 0.00 0.00 5.07
669 670 2.270352 TGTCCAAAAGGATGACGCTT 57.730 45.000 0.00 0.00 0.00 4.68
670 671 2.151202 TGTCCAAAAGGATGACGCTTC 58.849 47.619 0.00 0.00 0.00 3.86
671 672 2.224523 TGTCCAAAAGGATGACGCTTCT 60.225 45.455 0.00 0.00 0.00 2.85
672 673 2.814336 GTCCAAAAGGATGACGCTTCTT 59.186 45.455 0.00 0.00 0.00 2.52
673 674 3.074412 TCCAAAAGGATGACGCTTCTTC 58.926 45.455 0.00 0.00 0.00 2.87
674 675 3.077359 CCAAAAGGATGACGCTTCTTCT 58.923 45.455 6.13 0.00 0.00 2.85
675 676 3.503748 CCAAAAGGATGACGCTTCTTCTT 59.496 43.478 6.13 0.00 0.00 2.52
676 677 4.022849 CCAAAAGGATGACGCTTCTTCTTT 60.023 41.667 6.13 2.53 29.45 2.52
677 678 4.756084 AAAGGATGACGCTTCTTCTTTG 57.244 40.909 4.63 0.00 28.99 2.77
678 679 2.704572 AGGATGACGCTTCTTCTTTGG 58.295 47.619 6.13 0.00 0.00 3.28
679 680 2.303022 AGGATGACGCTTCTTCTTTGGA 59.697 45.455 6.13 0.00 0.00 3.53
680 681 3.074412 GGATGACGCTTCTTCTTTGGAA 58.926 45.455 6.13 0.00 0.00 3.53
691 692 3.961480 TTCTTTGGAAGAGAGCATCGA 57.039 42.857 0.00 0.00 42.67 3.59
692 693 4.478206 TTCTTTGGAAGAGAGCATCGAT 57.522 40.909 0.00 0.00 42.67 3.59
693 694 4.052159 TCTTTGGAAGAGAGCATCGATC 57.948 45.455 0.00 0.00 42.67 3.69
694 695 2.898729 TTGGAAGAGAGCATCGATCC 57.101 50.000 0.00 0.00 42.67 3.36
695 696 2.079170 TGGAAGAGAGCATCGATCCT 57.921 50.000 0.00 0.00 42.67 3.24
696 697 2.392662 TGGAAGAGAGCATCGATCCTT 58.607 47.619 0.00 0.00 42.67 3.36
697 698 2.102084 TGGAAGAGAGCATCGATCCTTG 59.898 50.000 0.00 0.00 42.67 3.61
698 699 2.102252 GGAAGAGAGCATCGATCCTTGT 59.898 50.000 0.00 0.00 42.67 3.16
699 700 3.380142 GAAGAGAGCATCGATCCTTGTC 58.620 50.000 0.00 0.00 42.67 3.18
700 701 1.336440 AGAGAGCATCGATCCTTGTCG 59.664 52.381 0.00 0.00 42.67 4.35
701 702 1.066303 GAGAGCATCGATCCTTGTCGT 59.934 52.381 0.00 0.00 42.67 4.34
702 703 1.202348 AGAGCATCGATCCTTGTCGTG 60.202 52.381 0.00 0.00 42.67 4.35
703 704 0.807667 AGCATCGATCCTTGTCGTGC 60.808 55.000 0.00 12.47 42.91 5.34
704 705 1.766143 GCATCGATCCTTGTCGTGCC 61.766 60.000 0.00 0.00 42.07 5.01
705 706 0.460109 CATCGATCCTTGTCGTGCCA 60.460 55.000 0.00 0.00 42.07 4.92
706 707 0.249120 ATCGATCCTTGTCGTGCCAA 59.751 50.000 0.00 0.00 42.07 4.52
707 708 0.389817 TCGATCCTTGTCGTGCCAAG 60.390 55.000 5.61 5.61 42.07 3.61
711 712 4.141144 CTTGTCGTGCCAAGGTGT 57.859 55.556 0.00 0.00 38.51 4.16
712 713 1.941812 CTTGTCGTGCCAAGGTGTC 59.058 57.895 0.00 0.00 38.51 3.67
713 714 0.813610 CTTGTCGTGCCAAGGTGTCA 60.814 55.000 0.00 0.00 38.51 3.58
714 715 0.179032 TTGTCGTGCCAAGGTGTCAT 60.179 50.000 0.00 0.00 0.00 3.06
715 716 0.602638 TGTCGTGCCAAGGTGTCATC 60.603 55.000 0.00 0.00 0.00 2.92
716 717 0.320771 GTCGTGCCAAGGTGTCATCT 60.321 55.000 0.00 0.00 0.00 2.90
717 718 0.320683 TCGTGCCAAGGTGTCATCTG 60.321 55.000 0.00 0.00 0.00 2.90
718 719 1.300971 CGTGCCAAGGTGTCATCTGG 61.301 60.000 0.00 0.00 0.00 3.86
719 720 0.250901 GTGCCAAGGTGTCATCTGGT 60.251 55.000 0.00 0.00 0.00 4.00
720 721 0.250858 TGCCAAGGTGTCATCTGGTG 60.251 55.000 0.00 0.00 0.00 4.17
721 722 0.250901 GCCAAGGTGTCATCTGGTGT 60.251 55.000 0.00 0.00 0.00 4.16
722 723 1.813513 CCAAGGTGTCATCTGGTGTC 58.186 55.000 0.00 0.00 0.00 3.67
723 724 1.611673 CCAAGGTGTCATCTGGTGTCC 60.612 57.143 0.00 0.00 0.00 4.02
724 725 1.072173 CAAGGTGTCATCTGGTGTCCA 59.928 52.381 0.00 0.00 0.00 4.02
725 726 0.687354 AGGTGTCATCTGGTGTCCAC 59.313 55.000 5.35 5.35 33.20 4.02
726 727 0.396435 GGTGTCATCTGGTGTCCACA 59.604 55.000 12.86 0.00 34.59 4.17
727 728 1.202758 GGTGTCATCTGGTGTCCACAA 60.203 52.381 12.86 0.00 34.59 3.33
728 729 1.873591 GTGTCATCTGGTGTCCACAAC 59.126 52.381 8.06 0.00 33.75 3.32
729 730 1.202758 TGTCATCTGGTGTCCACAACC 60.203 52.381 0.00 0.00 31.06 3.77
730 731 1.135960 TCATCTGGTGTCCACAACCA 58.864 50.000 0.00 0.00 31.06 3.67
731 732 1.704628 TCATCTGGTGTCCACAACCAT 59.295 47.619 0.00 0.00 31.06 3.55
732 733 1.814394 CATCTGGTGTCCACAACCATG 59.186 52.381 0.00 0.00 31.06 3.66
733 734 0.843309 TCTGGTGTCCACAACCATGT 59.157 50.000 0.00 0.00 41.61 3.21
734 735 1.214175 TCTGGTGTCCACAACCATGTT 59.786 47.619 0.00 0.00 37.82 2.71
735 736 2.031120 CTGGTGTCCACAACCATGTTT 58.969 47.619 0.00 0.00 37.82 2.83
736 737 2.430332 CTGGTGTCCACAACCATGTTTT 59.570 45.455 0.00 0.00 37.82 2.43
737 738 2.167281 TGGTGTCCACAACCATGTTTTG 59.833 45.455 0.00 3.35 37.82 2.44
738 739 2.167487 GGTGTCCACAACCATGTTTTGT 59.833 45.455 4.49 4.49 37.82 2.83
743 744 2.458951 CACAACCATGTTTTGTGTCGG 58.541 47.619 21.30 4.53 45.85 4.79
744 745 2.096248 ACAACCATGTTTTGTGTCGGT 58.904 42.857 8.71 0.00 35.91 4.69
745 746 2.098443 ACAACCATGTTTTGTGTCGGTC 59.902 45.455 8.71 0.00 35.91 4.79
746 747 2.045561 ACCATGTTTTGTGTCGGTCA 57.954 45.000 0.00 0.00 0.00 4.02
747 748 2.582052 ACCATGTTTTGTGTCGGTCAT 58.418 42.857 0.00 0.00 0.00 3.06
748 749 2.293122 ACCATGTTTTGTGTCGGTCATG 59.707 45.455 0.00 0.00 34.41 3.07
749 750 2.293122 CCATGTTTTGTGTCGGTCATGT 59.707 45.455 0.00 0.00 33.27 3.21
750 751 3.299162 CATGTTTTGTGTCGGTCATGTG 58.701 45.455 0.00 0.00 0.00 3.21
751 752 2.360844 TGTTTTGTGTCGGTCATGTGT 58.639 42.857 0.00 0.00 0.00 3.72
752 753 2.096657 TGTTTTGTGTCGGTCATGTGTG 59.903 45.455 0.00 0.00 0.00 3.82
753 754 2.031258 TTTGTGTCGGTCATGTGTGT 57.969 45.000 0.00 0.00 0.00 3.72
754 755 2.892784 TTGTGTCGGTCATGTGTGTA 57.107 45.000 0.00 0.00 0.00 2.90
755 756 2.432206 TGTGTCGGTCATGTGTGTAG 57.568 50.000 0.00 0.00 0.00 2.74
756 757 1.684450 TGTGTCGGTCATGTGTGTAGT 59.316 47.619 0.00 0.00 0.00 2.73
757 758 2.885894 TGTGTCGGTCATGTGTGTAGTA 59.114 45.455 0.00 0.00 0.00 1.82
758 759 3.508402 TGTGTCGGTCATGTGTGTAGTAT 59.492 43.478 0.00 0.00 0.00 2.12
759 760 4.021807 TGTGTCGGTCATGTGTGTAGTATT 60.022 41.667 0.00 0.00 0.00 1.89
760 761 5.183522 TGTGTCGGTCATGTGTGTAGTATTA 59.816 40.000 0.00 0.00 0.00 0.98
761 762 6.127563 TGTGTCGGTCATGTGTGTAGTATTAT 60.128 38.462 0.00 0.00 0.00 1.28
762 763 7.067251 TGTGTCGGTCATGTGTGTAGTATTATA 59.933 37.037 0.00 0.00 0.00 0.98
763 764 8.080417 GTGTCGGTCATGTGTGTAGTATTATAT 58.920 37.037 0.00 0.00 0.00 0.86
764 765 9.287373 TGTCGGTCATGTGTGTAGTATTATATA 57.713 33.333 0.00 0.00 0.00 0.86
783 784 8.741603 TTATATATATATAGATAGCGGCGGCA 57.258 34.615 19.21 4.99 43.41 5.69
784 785 3.644884 ATATATAGATAGCGGCGGCAC 57.355 47.619 19.21 9.21 43.41 5.01
785 786 1.182667 ATATAGATAGCGGCGGCACA 58.817 50.000 19.21 6.03 43.41 4.57
786 787 0.242825 TATAGATAGCGGCGGCACAC 59.757 55.000 19.21 8.52 43.41 3.82
787 788 1.744320 ATAGATAGCGGCGGCACACA 61.744 55.000 19.21 0.77 43.41 3.72
788 789 2.622903 TAGATAGCGGCGGCACACAC 62.623 60.000 19.21 5.13 43.41 3.82
789 790 4.386951 ATAGCGGCGGCACACACA 62.387 61.111 19.21 0.00 43.41 3.72
794 795 4.250431 GGCGGCACACACACACAC 62.250 66.667 3.07 0.00 0.00 3.82
795 796 3.504273 GCGGCACACACACACACA 61.504 61.111 0.00 0.00 0.00 3.72
796 797 2.403186 CGGCACACACACACACAC 59.597 61.111 0.00 0.00 0.00 3.82
797 798 2.394563 CGGCACACACACACACACA 61.395 57.895 0.00 0.00 0.00 3.72
798 799 1.136565 GGCACACACACACACACAC 59.863 57.895 0.00 0.00 0.00 3.82
799 800 1.305219 GGCACACACACACACACACT 61.305 55.000 0.00 0.00 0.00 3.55
800 801 0.096976 GCACACACACACACACACTC 59.903 55.000 0.00 0.00 0.00 3.51
801 802 1.437625 CACACACACACACACACTCA 58.562 50.000 0.00 0.00 0.00 3.41
802 803 1.128507 CACACACACACACACACTCAC 59.871 52.381 0.00 0.00 0.00 3.51
803 804 1.270571 ACACACACACACACACTCACA 60.271 47.619 0.00 0.00 0.00 3.58
804 805 1.128507 CACACACACACACACTCACAC 59.871 52.381 0.00 0.00 0.00 3.82
805 806 1.270571 ACACACACACACACTCACACA 60.271 47.619 0.00 0.00 0.00 3.72
806 807 1.128507 CACACACACACACTCACACAC 59.871 52.381 0.00 0.00 0.00 3.82
807 808 1.270571 ACACACACACACTCACACACA 60.271 47.619 0.00 0.00 0.00 3.72
808 809 1.128507 CACACACACACTCACACACAC 59.871 52.381 0.00 0.00 0.00 3.82
809 810 1.270571 ACACACACACTCACACACACA 60.271 47.619 0.00 0.00 0.00 3.72
810 811 1.128507 CACACACACTCACACACACAC 59.871 52.381 0.00 0.00 0.00 3.82
811 812 1.270571 ACACACACTCACACACACACA 60.271 47.619 0.00 0.00 0.00 3.72
812 813 1.128507 CACACACTCACACACACACAC 59.871 52.381 0.00 0.00 0.00 3.82
813 814 1.270571 ACACACTCACACACACACACA 60.271 47.619 0.00 0.00 0.00 3.72
814 815 1.128507 CACACTCACACACACACACAC 59.871 52.381 0.00 0.00 0.00 3.82
815 816 0.369931 CACTCACACACACACACACG 59.630 55.000 0.00 0.00 0.00 4.49
816 817 1.348250 CTCACACACACACACACGC 59.652 57.895 0.00 0.00 0.00 5.34
817 818 1.357991 CTCACACACACACACACGCA 61.358 55.000 0.00 0.00 0.00 5.24
818 819 1.225991 CACACACACACACACGCAC 60.226 57.895 0.00 0.00 0.00 5.34
819 820 1.669437 ACACACACACACACGCACA 60.669 52.632 0.00 0.00 0.00 4.57
820 821 1.225991 CACACACACACACGCACAC 60.226 57.895 0.00 0.00 0.00 3.82
821 822 1.669437 ACACACACACACGCACACA 60.669 52.632 0.00 0.00 0.00 3.72
822 823 1.225991 CACACACACACGCACACAC 60.226 57.895 0.00 0.00 0.00 3.82
823 824 1.669437 ACACACACACGCACACACA 60.669 52.632 0.00 0.00 0.00 3.72
824 825 1.225991 CACACACACGCACACACAC 60.226 57.895 0.00 0.00 0.00 3.82
825 826 1.669437 ACACACACGCACACACACA 60.669 52.632 0.00 0.00 0.00 3.72
826 827 1.225991 CACACACGCACACACACAC 60.226 57.895 0.00 0.00 0.00 3.82
827 828 1.669437 ACACACGCACACACACACA 60.669 52.632 0.00 0.00 0.00 3.72
828 829 1.225991 CACACGCACACACACACAC 60.226 57.895 0.00 0.00 0.00 3.82
829 830 1.669437 ACACGCACACACACACACA 60.669 52.632 0.00 0.00 0.00 3.72
830 831 1.225991 CACGCACACACACACACAC 60.226 57.895 0.00 0.00 0.00 3.82
831 832 1.669437 ACGCACACACACACACACA 60.669 52.632 0.00 0.00 0.00 3.72
832 833 1.225991 CGCACACACACACACACAC 60.226 57.895 0.00 0.00 0.00 3.82
833 834 1.634757 CGCACACACACACACACACT 61.635 55.000 0.00 0.00 0.00 3.55
834 835 1.364721 GCACACACACACACACACTA 58.635 50.000 0.00 0.00 0.00 2.74
835 836 1.062002 GCACACACACACACACACTAC 59.938 52.381 0.00 0.00 0.00 2.73
836 837 2.616960 CACACACACACACACACTACT 58.383 47.619 0.00 0.00 0.00 2.57
837 838 3.776340 CACACACACACACACACTACTA 58.224 45.455 0.00 0.00 0.00 1.82
838 839 3.550275 CACACACACACACACACTACTAC 59.450 47.826 0.00 0.00 0.00 2.73
839 840 2.787129 CACACACACACACACTACTACG 59.213 50.000 0.00 0.00 0.00 3.51
840 841 1.784856 CACACACACACACTACTACGC 59.215 52.381 0.00 0.00 0.00 4.42
841 842 1.269413 ACACACACACACTACTACGCC 60.269 52.381 0.00 0.00 0.00 5.68
842 843 1.000607 CACACACACACTACTACGCCT 60.001 52.381 0.00 0.00 0.00 5.52
843 844 1.000607 ACACACACACTACTACGCCTG 60.001 52.381 0.00 0.00 0.00 4.85
844 845 0.038526 ACACACACTACTACGCCTGC 60.039 55.000 0.00 0.00 0.00 4.85
845 846 0.736325 CACACACTACTACGCCTGCC 60.736 60.000 0.00 0.00 0.00 4.85
846 847 0.898789 ACACACTACTACGCCTGCCT 60.899 55.000 0.00 0.00 0.00 4.75
847 848 0.458543 CACACTACTACGCCTGCCTG 60.459 60.000 0.00 0.00 0.00 4.85
848 849 1.519455 CACTACTACGCCTGCCTGC 60.519 63.158 0.00 0.00 0.00 4.85
849 850 1.982395 ACTACTACGCCTGCCTGCA 60.982 57.895 0.00 0.00 0.00 4.41
850 851 1.519455 CTACTACGCCTGCCTGCAC 60.519 63.158 0.00 0.00 0.00 4.57
851 852 2.907897 CTACTACGCCTGCCTGCACC 62.908 65.000 0.00 0.00 0.00 5.01
857 858 2.676608 CCTGCCTGCACCCACATA 59.323 61.111 0.00 0.00 0.00 2.29
858 859 1.452651 CCTGCCTGCACCCACATAG 60.453 63.158 0.00 0.00 0.00 2.23
859 860 1.452651 CTGCCTGCACCCACATAGG 60.453 63.158 0.00 0.00 37.03 2.57
868 869 3.754043 CCACATAGGGGAGGCCAA 58.246 61.111 5.01 0.00 0.00 4.52
869 870 1.533711 CCACATAGGGGAGGCCAAG 59.466 63.158 5.01 0.00 0.00 3.61
870 871 1.533711 CACATAGGGGAGGCCAAGG 59.466 63.158 5.01 0.00 0.00 3.61
871 872 1.697754 ACATAGGGGAGGCCAAGGG 60.698 63.158 5.01 0.00 0.00 3.95
872 873 2.038330 ATAGGGGAGGCCAAGGGG 60.038 66.667 5.01 0.00 37.18 4.79
873 874 2.667943 ATAGGGGAGGCCAAGGGGA 61.668 63.158 5.01 0.00 35.59 4.81
874 875 2.644628 ATAGGGGAGGCCAAGGGGAG 62.645 65.000 5.01 0.00 35.59 4.30
875 876 4.760220 GGGGAGGCCAAGGGGAGA 62.760 72.222 5.01 0.00 35.59 3.71
876 877 3.093172 GGGAGGCCAAGGGGAGAG 61.093 72.222 5.01 0.00 35.59 3.20
877 878 3.093172 GGAGGCCAAGGGGAGAGG 61.093 72.222 5.01 0.00 35.59 3.69
878 879 3.093172 GAGGCCAAGGGGAGAGGG 61.093 72.222 5.01 0.00 35.59 4.30
895 896 3.541713 GCCGGGCAGAGGAGGTAG 61.542 72.222 15.62 0.00 0.00 3.18
896 897 3.541713 CCGGGCAGAGGAGGTAGC 61.542 72.222 0.00 0.00 0.00 3.58
897 898 3.541713 CGGGCAGAGGAGGTAGCC 61.542 72.222 0.00 0.00 46.28 3.93
899 900 3.978164 GGCAGAGGAGGTAGCCAT 58.022 61.111 0.00 0.00 46.26 4.40
900 901 1.449353 GGCAGAGGAGGTAGCCATG 59.551 63.158 0.00 0.00 46.26 3.66
901 902 1.341156 GGCAGAGGAGGTAGCCATGT 61.341 60.000 0.00 0.00 46.26 3.21
902 903 1.414158 GCAGAGGAGGTAGCCATGTA 58.586 55.000 0.00 0.00 0.00 2.29
903 904 1.069358 GCAGAGGAGGTAGCCATGTAC 59.931 57.143 0.00 0.00 0.00 2.90
904 905 2.388735 CAGAGGAGGTAGCCATGTACA 58.611 52.381 0.00 0.00 0.00 2.90
905 906 2.766263 CAGAGGAGGTAGCCATGTACAA 59.234 50.000 0.00 0.00 0.00 2.41
906 907 2.766828 AGAGGAGGTAGCCATGTACAAC 59.233 50.000 0.00 0.00 0.00 3.32
907 908 2.766828 GAGGAGGTAGCCATGTACAACT 59.233 50.000 0.00 0.29 0.00 3.16
908 909 2.766828 AGGAGGTAGCCATGTACAACTC 59.233 50.000 0.00 0.00 0.00 3.01
909 910 2.158943 GGAGGTAGCCATGTACAACTCC 60.159 54.545 0.00 0.00 36.81 3.85
910 911 1.480954 AGGTAGCCATGTACAACTCCG 59.519 52.381 0.00 0.00 0.00 4.63
911 912 1.472728 GGTAGCCATGTACAACTCCGG 60.473 57.143 0.00 0.00 0.00 5.14
912 913 0.177141 TAGCCATGTACAACTCCGGC 59.823 55.000 0.00 7.54 39.90 6.13
913 914 2.461110 GCCATGTACAACTCCGGCG 61.461 63.158 0.00 0.00 0.00 6.46
914 915 1.813753 CCATGTACAACTCCGGCGG 60.814 63.158 22.51 22.51 0.00 6.13
915 916 2.125269 ATGTACAACTCCGGCGGC 60.125 61.111 23.83 5.69 0.00 6.53
916 917 4.728102 TGTACAACTCCGGCGGCG 62.728 66.667 26.12 26.12 0.00 6.46
966 967 2.670934 GTGTGCACCAGCCCAGAG 60.671 66.667 15.69 0.00 41.13 3.35
967 968 3.170672 TGTGCACCAGCCCAGAGT 61.171 61.111 15.69 0.00 41.13 3.24
968 969 1.841103 TGTGCACCAGCCCAGAGTA 60.841 57.895 15.69 0.00 41.13 2.59
969 970 1.376037 GTGCACCAGCCCAGAGTAC 60.376 63.158 5.22 0.00 41.13 2.73
970 971 1.841103 TGCACCAGCCCAGAGTACA 60.841 57.895 0.00 0.00 41.13 2.90
971 972 1.374947 GCACCAGCCCAGAGTACAA 59.625 57.895 0.00 0.00 33.58 2.41
972 973 0.250727 GCACCAGCCCAGAGTACAAA 60.251 55.000 0.00 0.00 33.58 2.83
973 974 1.813513 CACCAGCCCAGAGTACAAAG 58.186 55.000 0.00 0.00 0.00 2.77
974 975 1.347707 CACCAGCCCAGAGTACAAAGA 59.652 52.381 0.00 0.00 0.00 2.52
975 976 1.348036 ACCAGCCCAGAGTACAAAGAC 59.652 52.381 0.00 0.00 0.00 3.01
976 977 1.673033 CCAGCCCAGAGTACAAAGACG 60.673 57.143 0.00 0.00 0.00 4.18
977 978 1.000955 CAGCCCAGAGTACAAAGACGT 59.999 52.381 0.00 0.00 0.00 4.34
978 979 1.272769 AGCCCAGAGTACAAAGACGTC 59.727 52.381 7.70 7.70 0.00 4.34
979 980 1.000506 GCCCAGAGTACAAAGACGTCA 59.999 52.381 19.50 0.00 0.00 4.35
980 981 2.353803 GCCCAGAGTACAAAGACGTCAT 60.354 50.000 19.50 1.86 0.00 3.06
981 982 3.254060 CCCAGAGTACAAAGACGTCATG 58.746 50.000 19.50 17.97 0.00 3.07
982 983 2.668457 CCAGAGTACAAAGACGTCATGC 59.332 50.000 19.50 3.81 0.00 4.06
983 984 3.317150 CAGAGTACAAAGACGTCATGCA 58.683 45.455 19.50 4.21 0.00 3.96
984 985 3.121944 CAGAGTACAAAGACGTCATGCAC 59.878 47.826 19.50 16.06 0.00 4.57
992 993 3.176661 CGTCATGCACGCCAATGA 58.823 55.556 0.00 0.00 42.87 2.57
993 994 1.723273 CGTCATGCACGCCAATGAT 59.277 52.632 0.00 0.00 42.87 2.45
994 995 0.099259 CGTCATGCACGCCAATGATT 59.901 50.000 0.00 0.00 42.87 2.57
1036 1037 1.658673 GTCGTGACGGTCCTTGTCT 59.341 57.895 4.70 0.00 37.26 3.41
1037 1038 0.031721 GTCGTGACGGTCCTTGTCTT 59.968 55.000 4.70 0.00 37.26 3.01
1038 1039 0.748450 TCGTGACGGTCCTTGTCTTT 59.252 50.000 4.70 0.00 37.26 2.52
1040 1041 1.226746 GTGACGGTCCTTGTCTTTGG 58.773 55.000 5.55 0.00 37.26 3.28
1041 1042 0.107831 TGACGGTCCTTGTCTTTGGG 59.892 55.000 5.55 0.00 37.26 4.12
1045 1046 0.955919 GGTCCTTGTCTTTGGGCTCG 60.956 60.000 0.00 0.00 0.00 5.03
1048 1049 1.291877 CCTTGTCTTTGGGCTCGTCG 61.292 60.000 0.00 0.00 0.00 5.12
1050 1051 0.878523 TTGTCTTTGGGCTCGTCGTG 60.879 55.000 0.00 0.00 0.00 4.35
1054 1055 2.771763 CTTTGGGCTCGTCGTGCTCT 62.772 60.000 18.99 0.00 0.00 4.09
1057 1058 4.724602 GGCTCGTCGTGCTCTGCA 62.725 66.667 17.79 0.00 35.60 4.41
1059 1060 2.796425 GCTCGTCGTGCTCTGCATG 61.796 63.158 11.84 5.49 45.79 4.06
1060 1061 2.796425 CTCGTCGTGCTCTGCATGC 61.796 63.158 11.82 11.82 44.29 4.06
1062 1063 2.385875 CGTCGTGCTCTGCATGCTT 61.386 57.895 20.33 0.00 44.29 3.91
1097 1098 3.031417 GCCACAGCGGGTACTCCAT 62.031 63.158 0.00 0.00 34.36 3.41
1103 1104 3.138625 CGGGTACTCCATCGCCAT 58.861 61.111 0.00 0.00 34.36 4.40
1104 1105 1.300931 CGGGTACTCCATCGCCATG 60.301 63.158 0.00 0.00 34.36 3.66
1118 1119 1.815003 CCATGCGCGTCATCTTCCA 60.815 57.895 8.43 0.00 31.79 3.53
1124 1125 1.769098 CGCGTCATCTTCCAGGCATG 61.769 60.000 0.00 0.00 0.00 4.06
1129 1130 1.282738 TCATCTTCCAGGCATGCTTCA 59.717 47.619 18.92 0.00 0.00 3.02
1161 1162 4.111577 TCCCCTTCATGTCCTACATCTTT 58.888 43.478 0.00 0.00 36.53 2.52
1168 1169 4.782691 TCATGTCCTACATCTTTTCCCAGA 59.217 41.667 0.00 0.00 36.53 3.86
1189 1193 2.818169 AAGAGCAAGCCCGACACCA 61.818 57.895 0.00 0.00 0.00 4.17
1259 1263 0.174617 CTCCTCCGCAAGAAGGTCTC 59.825 60.000 0.00 0.00 43.02 3.36
1263 1267 3.181967 CGCAAGAAGGTCTCCGCG 61.182 66.667 0.00 0.00 40.29 6.46
1264 1268 2.815647 GCAAGAAGGTCTCCGCGG 60.816 66.667 22.12 22.12 0.00 6.46
1265 1269 2.125512 CAAGAAGGTCTCCGCGGG 60.126 66.667 27.83 16.54 0.00 6.13
1267 1271 3.899545 AAGAAGGTCTCCGCGGGGA 62.900 63.158 27.50 27.50 41.08 4.81
1269 1273 3.447025 GAAGGTCTCCGCGGGGATG 62.447 68.421 33.88 16.05 42.83 3.51
1293 1297 3.435186 GCCGCTGAAGCCTTCACC 61.435 66.667 2.24 0.00 37.91 4.02
1317 1321 3.521995 CATCGGGTGCTATAGCCTG 57.478 57.895 21.84 12.23 44.97 4.85
1320 1324 0.464036 TCGGGTGCTATAGCCTGTTG 59.536 55.000 21.84 8.29 44.97 3.33
1321 1325 0.178068 CGGGTGCTATAGCCTGTTGT 59.822 55.000 21.84 0.00 44.97 3.32
1324 1328 2.484947 GGGTGCTATAGCCTGTTGTACC 60.485 54.545 21.84 18.61 43.77 3.34
1327 1331 1.766496 GCTATAGCCTGTTGTACCCCA 59.234 52.381 14.13 0.00 34.31 4.96
1329 1333 3.807209 GCTATAGCCTGTTGTACCCCATG 60.807 52.174 14.13 0.00 34.31 3.66
1337 1341 0.120377 TTGTACCCCATGGAGGAGGT 59.880 55.000 22.03 18.14 41.85 3.85
1340 1344 1.833055 TACCCCATGGAGGAGGTGGT 61.833 60.000 22.03 16.55 40.08 4.16
1389 1393 1.715585 CGCCTACGTTCATGGCTTG 59.284 57.895 15.76 0.00 44.09 4.01
1393 1397 0.676466 CTACGTTCATGGCTTGGGCA 60.676 55.000 0.00 0.00 43.52 5.36
1398 1402 1.275856 GTTCATGGCTTGGGCATCAAA 59.724 47.619 3.61 0.12 45.69 2.69
1422 1426 4.842948 CCCTTCTTCATCATCCTCTGGATA 59.157 45.833 0.00 0.00 40.98 2.59
1425 1429 7.460071 CCTTCTTCATCATCCTCTGGATATTT 58.540 38.462 0.00 0.00 40.98 1.40
1426 1430 7.390996 CCTTCTTCATCATCCTCTGGATATTTG 59.609 40.741 0.00 0.00 40.98 2.32
1434 1438 0.176910 TCTGGATATTTGGCGTCGCA 59.823 50.000 20.50 2.14 0.00 5.10
1436 1440 0.730265 TGGATATTTGGCGTCGCAAC 59.270 50.000 20.50 2.72 0.00 4.17
1464 1468 4.552365 CGGGCCGTCTGCATCCAT 62.552 66.667 19.97 0.00 43.89 3.41
1465 1469 2.903855 GGGCCGTCTGCATCCATG 60.904 66.667 0.00 0.00 43.89 3.66
1473 1477 0.322366 TCTGCATCCATGTCGCCAAA 60.322 50.000 0.00 0.00 0.00 3.28
1474 1478 0.099968 CTGCATCCATGTCGCCAAAG 59.900 55.000 0.00 0.00 0.00 2.77
1475 1479 0.322366 TGCATCCATGTCGCCAAAGA 60.322 50.000 0.00 0.00 0.00 2.52
1498 1502 1.136305 CCTTCGACCTCGCCAAGAATA 59.864 52.381 0.00 0.00 39.60 1.75
1556 1560 2.112297 GGGCCGACAACTGTCCAA 59.888 61.111 0.00 0.00 41.86 3.53
1560 1564 1.155424 GCCGACAACTGTCCAACGAA 61.155 55.000 4.30 0.00 41.86 3.85
1566 1573 1.521423 CAACTGTCCAACGAAGACGAC 59.479 52.381 0.00 0.00 42.66 4.34
1567 1574 0.742505 ACTGTCCAACGAAGACGACA 59.257 50.000 0.00 0.00 42.66 4.35
1568 1575 1.129326 CTGTCCAACGAAGACGACAC 58.871 55.000 0.00 0.00 42.66 3.67
1624 1631 4.502259 GCAACTATGTAGTCATGGGAGAGG 60.502 50.000 0.00 0.00 36.95 3.69
1639 1646 2.607750 AGGGCCGGCTCAAGAGAA 60.608 61.111 31.81 0.00 0.00 2.87
1668 1675 1.905215 CCCTATGGCTTCGAGATCCAT 59.095 52.381 16.04 16.04 42.70 3.41
1673 1680 0.250081 GGCTTCGAGATCCATGACCC 60.250 60.000 0.00 0.00 0.00 4.46
1687 1694 2.526304 TGACCCAGAAGTGAAGAACG 57.474 50.000 0.00 0.00 0.00 3.95
1702 1709 1.625818 AGAACGTTGGCCTTGAGATCT 59.374 47.619 5.00 0.00 0.00 2.75
1703 1710 1.734465 GAACGTTGGCCTTGAGATCTG 59.266 52.381 5.00 0.00 0.00 2.90
1704 1711 0.674895 ACGTTGGCCTTGAGATCTGC 60.675 55.000 3.32 0.00 0.00 4.26
1706 1713 1.078214 TTGGCCTTGAGATCTGCGG 60.078 57.895 3.32 0.00 0.00 5.69
1708 1715 3.267860 GCCTTGAGATCTGCGGCG 61.268 66.667 0.00 0.51 0.00 6.46
1710 1717 1.153568 CCTTGAGATCTGCGGCGAA 60.154 57.895 12.98 0.00 0.00 4.70
1711 1718 1.150567 CCTTGAGATCTGCGGCGAAG 61.151 60.000 12.98 10.94 0.00 3.79
1715 1722 0.926846 GAGATCTGCGGCGAAGAAAG 59.073 55.000 23.46 4.68 0.00 2.62
1717 1724 1.432270 GATCTGCGGCGAAGAAAGGG 61.432 60.000 23.46 0.00 0.00 3.95
1726 1733 2.162408 GGCGAAGAAAGGGAGAACATTG 59.838 50.000 0.00 0.00 0.00 2.82
1727 1734 2.814336 GCGAAGAAAGGGAGAACATTGT 59.186 45.455 0.00 0.00 0.00 2.71
1728 1735 3.120165 GCGAAGAAAGGGAGAACATTGTC 60.120 47.826 0.00 0.00 0.00 3.18
1729 1736 3.437049 CGAAGAAAGGGAGAACATTGTCC 59.563 47.826 0.00 0.00 39.75 4.02
1734 1741 3.948735 GGAGAACATTGTCCCCGAA 57.051 52.632 0.00 0.00 34.72 4.30
1735 1742 1.739067 GGAGAACATTGTCCCCGAAG 58.261 55.000 0.00 0.00 34.72 3.79
1751 1758 1.806623 CGAAGGAGGCGGTCTAAATGG 60.807 57.143 0.00 0.00 0.00 3.16
1757 1764 1.153429 GCGGTCTAAATGGCGACCT 60.153 57.895 6.85 0.00 45.88 3.85
1792 1799 0.459585 CGAGTTGGTCCGGGTATGTG 60.460 60.000 0.00 0.00 0.00 3.21
1802 1809 1.003118 CCGGGTATGTGACATATGGGG 59.997 57.143 8.72 6.49 0.00 4.96
1804 1811 1.705186 GGGTATGTGACATATGGGGCT 59.295 52.381 8.72 0.00 0.00 5.19
1806 1813 3.412386 GGTATGTGACATATGGGGCTTC 58.588 50.000 8.72 0.00 0.00 3.86
1807 1814 3.073062 GGTATGTGACATATGGGGCTTCT 59.927 47.826 8.72 0.00 0.00 2.85
1815 1822 0.032515 TATGGGGCTTCTCCGAGACA 60.033 55.000 0.00 0.00 34.94 3.41
1818 1825 1.258445 GGGGCTTCTCCGAGACAGAA 61.258 60.000 0.00 0.00 34.94 3.02
1819 1826 0.174617 GGGCTTCTCCGAGACAGAAG 59.825 60.000 0.00 5.27 46.71 2.85
1837 1844 3.585862 GAAGCCATCTTCAAGTACGACA 58.414 45.455 0.00 0.00 46.14 4.35
1842 1849 4.810790 CCATCTTCAAGTACGACAAGAGT 58.189 43.478 8.70 0.00 0.00 3.24
1848 1855 6.263842 TCTTCAAGTACGACAAGAGTAGGAAA 59.736 38.462 0.00 0.00 0.00 3.13
1849 1856 6.585695 TCAAGTACGACAAGAGTAGGAAAT 57.414 37.500 0.00 0.00 0.00 2.17
1850 1857 6.387465 TCAAGTACGACAAGAGTAGGAAATG 58.613 40.000 0.00 0.00 0.00 2.32
1851 1858 5.326200 AGTACGACAAGAGTAGGAAATGG 57.674 43.478 0.00 0.00 0.00 3.16
1870 1877 3.565307 TGGAAGTTGGAGAACATTTGCT 58.435 40.909 0.00 0.00 34.17 3.91
1893 1900 0.532573 CCCTCGCACTCTTCAAGCTA 59.467 55.000 0.00 0.00 0.00 3.32
1915 1922 1.084370 CCGACGAAAGATGGAGCACC 61.084 60.000 0.00 0.00 0.00 5.01
1931 1938 3.408229 CCTCCACATGGCAGAGGT 58.592 61.111 16.03 0.00 41.96 3.85
1932 1939 1.222936 CCTCCACATGGCAGAGGTC 59.777 63.158 16.03 0.00 41.96 3.85
1963 1970 2.101185 CGCGTGATCTCGTGCTCT 59.899 61.111 16.62 0.00 34.73 4.09
1976 1983 3.478274 GCTCTGGGGCCTCCTCAG 61.478 72.222 0.00 6.40 36.20 3.35
1989 1996 2.765807 CTCAGGCTCACGGGGGAT 60.766 66.667 0.00 0.00 0.00 3.85
1992 1999 2.285368 AGGCTCACGGGGGATGAA 60.285 61.111 0.00 0.00 0.00 2.57
1994 2001 2.670148 GGCTCACGGGGGATGAAGT 61.670 63.158 0.00 0.00 0.00 3.01
1995 2002 1.450312 GCTCACGGGGGATGAAGTG 60.450 63.158 0.00 0.00 36.06 3.16
1996 2003 1.983224 CTCACGGGGGATGAAGTGT 59.017 57.895 0.00 0.00 36.16 3.55
2005 2012 1.359459 GGATGAAGTGTTCGACGCCC 61.359 60.000 0.00 0.00 0.00 6.13
2006 2013 1.683790 GATGAAGTGTTCGACGCCCG 61.684 60.000 0.00 0.00 40.25 6.13
2025 2038 2.266372 CGGGCGTTCCATGTGGTA 59.734 61.111 0.00 0.00 36.34 3.25
2028 2041 0.462047 GGGCGTTCCATGTGGTAGAG 60.462 60.000 0.00 0.00 36.34 2.43
2061 2074 5.030147 AGGTTCATGGATGAGTACTACCAA 58.970 41.667 16.27 2.98 35.92 3.67
2063 2076 5.128827 GGTTCATGGATGAGTACTACCAAGA 59.871 44.000 16.27 14.77 38.19 3.02
2064 2077 6.183361 GGTTCATGGATGAGTACTACCAAGAT 60.183 42.308 16.27 2.42 38.19 2.40
2079 2092 0.036952 AAGATATCATCCCGCTGGCG 60.037 55.000 8.08 8.08 39.44 5.69
2097 2110 1.153269 GTTGCCTAGGCCAGAGCTC 60.153 63.158 30.81 5.27 41.09 4.09
2100 2113 0.911525 TGCCTAGGCCAGAGCTCTTT 60.912 55.000 30.81 2.72 41.09 2.52
2101 2114 0.179059 GCCTAGGCCAGAGCTCTTTC 60.179 60.000 24.19 8.51 39.73 2.62
2130 2143 0.320374 TCGCCTTGTCCATCGTCTTT 59.680 50.000 0.00 0.00 0.00 2.52
2131 2144 0.443869 CGCCTTGTCCATCGTCTTTG 59.556 55.000 0.00 0.00 0.00 2.77
2134 2147 1.726791 CCTTGTCCATCGTCTTTGTCG 59.273 52.381 0.00 0.00 0.00 4.35
2139 2152 2.155155 GTCCATCGTCTTTGTCGTGTTC 59.845 50.000 0.00 0.00 0.00 3.18
2142 2155 4.082408 TCCATCGTCTTTGTCGTGTTCTAT 60.082 41.667 0.00 0.00 0.00 1.98
2143 2156 4.031765 CCATCGTCTTTGTCGTGTTCTATG 59.968 45.833 0.00 0.00 0.00 2.23
2146 2159 2.092211 GTCTTTGTCGTGTTCTATGGCG 59.908 50.000 0.00 0.00 0.00 5.69
2151 2164 0.885879 TCGTGTTCTATGGCGTCACT 59.114 50.000 0.00 0.00 0.00 3.41
2155 2168 1.343142 TGTTCTATGGCGTCACTGTGT 59.657 47.619 7.79 0.00 0.00 3.72
2157 2170 2.078849 TCTATGGCGTCACTGTGTTG 57.921 50.000 7.79 2.86 0.00 3.33
2166 2179 0.869880 TCACTGTGTTGCTCGTCACG 60.870 55.000 7.79 0.00 37.38 4.35
2167 2180 0.869880 CACTGTGTTGCTCGTCACGA 60.870 55.000 0.00 0.00 37.38 4.35
2182 2195 0.522626 CACGAGCAATGCCAACATCA 59.477 50.000 0.00 0.00 34.62 3.07
2186 2199 2.034179 CGAGCAATGCCAACATCATCAT 59.966 45.455 0.00 0.00 34.62 2.45
2187 2200 3.639538 GAGCAATGCCAACATCATCATC 58.360 45.455 0.00 0.00 34.62 2.92
2190 2203 3.003585 GCAATGCCAACATCATCATCGTA 59.996 43.478 0.00 0.00 34.62 3.43
2199 2212 2.438868 TCATCATCGTATTGGGCTCG 57.561 50.000 0.00 0.00 0.00 5.03
2202 2215 0.249447 TCATCGTATTGGGCTCGCTG 60.249 55.000 0.00 0.00 0.00 5.18
2206 2219 0.739462 CGTATTGGGCTCGCTGTTCA 60.739 55.000 0.00 0.00 0.00 3.18
2207 2220 1.448985 GTATTGGGCTCGCTGTTCAA 58.551 50.000 0.00 0.00 0.00 2.69
2220 2233 1.299976 GTTCAAGGGGCTCATCGGT 59.700 57.895 0.00 0.00 0.00 4.69
2225 2238 1.417890 CAAGGGGCTCATCGGTCTATT 59.582 52.381 0.00 0.00 0.00 1.73
2231 2244 1.989165 GCTCATCGGTCTATTCATCGC 59.011 52.381 0.00 0.00 0.00 4.58
2236 2249 0.792640 CGGTCTATTCATCGCCATGC 59.207 55.000 0.00 0.00 0.00 4.06
2241 2254 2.632512 TCTATTCATCGCCATGCTGGTA 59.367 45.455 4.45 0.00 40.46 3.25
2244 2257 0.461870 TCATCGCCATGCTGGTACAC 60.462 55.000 0.00 0.00 40.46 2.90
2245 2258 1.153168 ATCGCCATGCTGGTACACC 60.153 57.895 0.00 0.00 40.46 4.16
2270 2283 1.006922 GCTTTCTGCACCAAGTGGC 60.007 57.895 0.00 0.00 42.31 5.01
2273 2286 0.823356 TTTCTGCACCAAGTGGCCTC 60.823 55.000 3.32 0.00 39.32 4.70
2275 2288 3.177884 TGCACCAAGTGGCCTCCT 61.178 61.111 3.32 0.00 39.32 3.69
2277 2290 2.270986 GCACCAAGTGGCCTCCTTG 61.271 63.158 21.88 21.88 39.19 3.61
2280 2293 4.929807 CAAGTGGCCTCCTTGGTT 57.070 55.556 21.37 0.05 36.50 3.67
2282 2295 0.468029 CAAGTGGCCTCCTTGGTTGT 60.468 55.000 21.37 0.00 36.50 3.32
2285 2298 1.150536 TGGCCTCCTTGGTTGTCAC 59.849 57.895 3.32 0.00 38.35 3.67
2286 2299 1.603739 GGCCTCCTTGGTTGTCACC 60.604 63.158 0.00 0.00 44.56 4.02
2296 2309 1.592131 GTTGTCACCGTGCGTACCA 60.592 57.895 0.00 0.00 0.00 3.25
2298 2311 2.018727 TTGTCACCGTGCGTACCACT 62.019 55.000 11.21 0.00 42.42 4.00
2300 2313 0.877213 GTCACCGTGCGTACCACTTT 60.877 55.000 11.21 0.00 42.42 2.66
2301 2314 0.179078 TCACCGTGCGTACCACTTTT 60.179 50.000 11.21 0.00 42.42 2.27
2305 2318 0.931702 CGTGCGTACCACTTTTGACA 59.068 50.000 11.21 0.00 42.42 3.58
2318 2331 5.882000 CCACTTTTGACATCATCATCACCTA 59.118 40.000 0.00 0.00 37.11 3.08
2327 2340 4.204792 TCATCATCACCTACCTCCTCAT 57.795 45.455 0.00 0.00 0.00 2.90
2332 2345 0.387202 CACCTACCTCCTCATGCTCG 59.613 60.000 0.00 0.00 0.00 5.03
2341 2354 3.157252 TCATGCTCGCCCTCCTCC 61.157 66.667 0.00 0.00 0.00 4.30
2342 2355 3.160047 CATGCTCGCCCTCCTCCT 61.160 66.667 0.00 0.00 0.00 3.69
2347 2360 4.816984 TCGCCCTCCTCCTCGTCC 62.817 72.222 0.00 0.00 0.00 4.79
2356 2369 2.817258 CTCCTCCTCGTCCAGACATATC 59.183 54.545 0.00 0.00 0.00 1.63
2361 2374 3.381590 TCCTCGTCCAGACATATCAGTTG 59.618 47.826 0.00 0.00 0.00 3.16
2362 2375 3.381590 CCTCGTCCAGACATATCAGTTGA 59.618 47.826 0.00 0.00 0.00 3.18
2364 2377 5.188327 TCGTCCAGACATATCAGTTGATC 57.812 43.478 0.00 0.00 36.05 2.92
2367 2380 5.510349 CGTCCAGACATATCAGTTGATCCAT 60.510 44.000 0.00 0.00 36.05 3.41
2374 2387 6.816136 ACATATCAGTTGATCCATTACGTGA 58.184 36.000 0.00 0.00 36.05 4.35
2388 2401 4.866508 TTACGTGATCTCTGACTGGTTT 57.133 40.909 0.00 0.00 0.00 3.27
2389 2402 3.305398 ACGTGATCTCTGACTGGTTTC 57.695 47.619 0.00 0.00 0.00 2.78
2391 2404 4.079970 ACGTGATCTCTGACTGGTTTCTA 58.920 43.478 0.00 0.00 0.00 2.10
2412 2425 3.931578 AGTGTCCTTGATCTGCAACTAC 58.068 45.455 0.00 0.00 31.96 2.73
2414 2427 2.299013 TGTCCTTGATCTGCAACTACGT 59.701 45.455 0.00 0.00 31.96 3.57
2421 2434 2.512485 TCTGCAACTACGTCCGAAAA 57.488 45.000 0.00 0.00 0.00 2.29
2446 2459 1.133790 GCATGCAGAGATTGTTCCACC 59.866 52.381 14.21 0.00 0.00 4.61
2447 2460 2.439409 CATGCAGAGATTGTTCCACCA 58.561 47.619 0.00 0.00 0.00 4.17
2448 2461 2.885135 TGCAGAGATTGTTCCACCAT 57.115 45.000 0.00 0.00 0.00 3.55
2449 2462 3.998913 TGCAGAGATTGTTCCACCATA 57.001 42.857 0.00 0.00 0.00 2.74
2453 2466 2.846206 AGAGATTGTTCCACCATAGGCA 59.154 45.455 0.00 0.00 0.00 4.75
2454 2467 3.266772 AGAGATTGTTCCACCATAGGCAA 59.733 43.478 0.00 0.00 0.00 4.52
2455 2468 4.016444 GAGATTGTTCCACCATAGGCAAA 58.984 43.478 0.00 0.00 0.00 3.68
2464 2477 4.079844 TCCACCATAGGCAAATCATCAAGA 60.080 41.667 0.00 0.00 0.00 3.02
2465 2478 4.831155 CCACCATAGGCAAATCATCAAGAT 59.169 41.667 0.00 0.00 39.09 2.40
2468 2481 6.208797 CACCATAGGCAAATCATCAAGATCAT 59.791 38.462 0.00 0.00 35.39 2.45
2470 2483 6.659668 CCATAGGCAAATCATCAAGATCATCT 59.340 38.462 0.00 0.00 35.39 2.90
2497 2510 1.076632 AAGCACCGTTTGTTCCCCA 60.077 52.632 0.00 0.00 0.00 4.96
2515 2528 1.386533 CATCATCAAGGTCCACCAGC 58.613 55.000 0.00 0.00 38.89 4.85
2519 2532 1.067295 ATCAAGGTCCACCAGCTCAA 58.933 50.000 0.00 0.00 38.89 3.02
2523 2536 0.773644 AGGTCCACCAGCTCAACATT 59.226 50.000 0.00 0.00 38.89 2.71
2524 2537 1.145738 AGGTCCACCAGCTCAACATTT 59.854 47.619 0.00 0.00 38.89 2.32
2526 2539 2.288395 GGTCCACCAGCTCAACATTTTG 60.288 50.000 0.00 0.00 35.64 2.44
2533 2546 3.005050 CCAGCTCAACATTTTGAAGCTCA 59.995 43.478 12.62 0.00 41.34 4.26
2535 2548 5.227908 CAGCTCAACATTTTGAAGCTCAAT 58.772 37.500 12.62 0.00 41.34 2.57
2537 2550 4.624452 GCTCAACATTTTGAAGCTCAATCC 59.376 41.667 0.00 0.00 41.34 3.01
2546 2559 0.326264 AAGCTCAATCCGCTTCACCT 59.674 50.000 0.00 0.00 43.79 4.00
2552 2565 1.098050 AATCCGCTTCACCTGCATTC 58.902 50.000 0.00 0.00 0.00 2.67
2553 2566 0.254178 ATCCGCTTCACCTGCATTCT 59.746 50.000 0.00 0.00 0.00 2.40
2569 2582 1.191489 TTCTCGGGTGTGGATGCTCA 61.191 55.000 0.00 0.00 0.00 4.26
2574 2587 0.835941 GGGTGTGGATGCTCATCTCT 59.164 55.000 9.44 0.00 37.92 3.10
2575 2588 2.042464 GGGTGTGGATGCTCATCTCTA 58.958 52.381 9.44 0.00 37.92 2.43
2576 2589 2.224161 GGGTGTGGATGCTCATCTCTAC 60.224 54.545 9.44 7.38 37.92 2.59
2578 2591 2.697751 GTGTGGATGCTCATCTCTACCT 59.302 50.000 9.44 0.00 37.92 3.08
2586 2599 3.194062 GCTCATCTCTACCTTGCTCAAC 58.806 50.000 0.00 0.00 0.00 3.18
2592 2605 0.320771 CTACCTTGCTCAACAGGCGT 60.321 55.000 0.00 0.00 0.00 5.68
2605 2618 3.745803 GGCGTCTCGTCGGGTTCT 61.746 66.667 0.00 0.00 0.00 3.01
2607 2620 2.097918 CGTCTCGTCGGGTTCTCG 59.902 66.667 0.00 0.00 0.00 4.04
2624 2637 1.227645 CGGATGCCATCGTCACCAT 60.228 57.895 0.00 0.00 0.00 3.55
2628 2641 2.224606 GATGCCATCGTCACCATTGAT 58.775 47.619 0.00 0.00 33.11 2.57
2629 2642 1.381522 TGCCATCGTCACCATTGATG 58.618 50.000 0.00 0.00 39.80 3.07
2634 2647 3.628942 CCATCGTCACCATTGATGTCAAT 59.371 43.478 2.48 2.48 46.62 2.57
2675 2688 3.437213 TGAAGAACATCCTCGACCCTAA 58.563 45.455 0.00 0.00 0.00 2.69
2728 2741 2.159156 GCATTGGAGCAGCATGAATTCA 60.159 45.455 11.26 11.26 39.69 2.57
2733 2746 2.751259 GGAGCAGCATGAATTCACTCAA 59.249 45.455 11.07 0.00 39.69 3.02
2739 2752 5.765176 CAGCATGAATTCACTCAACTCAAA 58.235 37.500 11.07 0.00 39.69 2.69
2751 2764 0.314935 AACTCAAATGGGCGTGCAAG 59.685 50.000 0.00 0.00 0.00 4.01
2757 2770 0.899717 AATGGGCGTGCAAGGACAAT 60.900 50.000 0.79 0.00 0.00 2.71
2763 2776 1.949525 GCGTGCAAGGACAATATGGAT 59.050 47.619 0.79 0.00 0.00 3.41
2765 2778 2.945008 CGTGCAAGGACAATATGGATGT 59.055 45.455 0.00 0.00 0.00 3.06
2796 2809 2.977456 GTGGTGTGGCACATCGCA 60.977 61.111 33.14 12.87 44.52 5.10
2818 2831 1.120530 GGCCCTATTTGAGACGAGGA 58.879 55.000 0.00 0.00 0.00 3.71
2847 2860 4.100479 CACCCATTGCAGCCAGAA 57.900 55.556 0.00 0.00 0.00 3.02
2880 2893 2.744202 CCTGATGTTGTCAAGGTACTGC 59.256 50.000 0.00 0.00 40.86 4.40
2926 2939 0.612174 CCTCCTCCCAGACGACAAGA 60.612 60.000 0.00 0.00 0.00 3.02
2934 2947 1.340658 CAGACGACAAGACATGGACG 58.659 55.000 0.00 0.00 38.33 4.79
2969 2982 1.610624 GGACATCAAGGCGGAACTCAA 60.611 52.381 0.00 0.00 0.00 3.02
2987 3000 2.899900 TCAACAGCTTCTTCCAGAGCTA 59.100 45.455 0.00 0.00 35.68 3.32
2998 3011 0.035152 CCAGAGCTATTGCACCACCA 60.035 55.000 1.12 0.00 42.74 4.17
3010 3023 2.263227 CCACCATGCACCGTCGTA 59.737 61.111 0.00 0.00 0.00 3.43
3065 3081 2.503356 AGGAGATGTCAACCATGGAGAC 59.497 50.000 25.29 25.29 32.56 3.36
3069 3085 1.745489 GTCAACCATGGAGACGGGC 60.745 63.158 21.47 0.00 0.00 6.13
3104 3120 4.529109 AGCAACTAGAGGAAAGAGACAC 57.471 45.455 0.00 0.00 0.00 3.67
3187 3203 2.049156 CGGAGCTGCTCGTGTTCA 60.049 61.111 22.25 0.00 0.00 3.18
3192 3208 2.037136 GCTGCTCGTGTTCATGGCT 61.037 57.895 0.00 0.00 0.00 4.75
3246 3262 3.131478 GCGTTGGGCAATAGCGGT 61.131 61.111 0.00 0.00 43.41 5.68
3306 3322 1.139853 GGCATCCGTCTCTCCAAGAAT 59.860 52.381 0.00 0.00 35.21 2.40
3327 3343 1.221840 CCAGGAGGACCATGTTCCG 59.778 63.158 3.30 0.00 41.04 4.30
3345 3361 2.366837 TGGTGCCATCCCGATCCT 60.367 61.111 0.00 0.00 0.00 3.24
3355 3371 3.544684 CATCCCGATCCTGTTTGATCAA 58.455 45.455 3.38 3.38 41.00 2.57
3374 3395 4.143543 TCAAAAGGATCAGTGCACATCAA 58.856 39.130 21.04 0.93 0.00 2.57
3391 3412 3.641437 TCAAAGCCGGTTTCAATGAAG 57.359 42.857 3.21 0.00 0.00 3.02
3490 3534 2.149578 CAGTAGCTGGCTGGCATAATC 58.850 52.381 3.74 0.00 34.17 1.75
3513 3560 1.594862 GCAATGAGCTAGTTGGCGTAG 59.405 52.381 11.30 0.00 41.15 3.51
3519 3566 0.806492 GCTAGTTGGCGTAGTCCTGC 60.806 60.000 0.00 0.00 0.00 4.85
3531 3578 4.790123 GCGTAGTCCTGCTATGTTCTAGTG 60.790 50.000 0.00 0.00 38.60 2.74
3539 3586 3.873361 TGCTATGTTCTAGTGCAAGATGC 59.127 43.478 0.00 0.00 45.29 3.91
3557 3613 9.694520 GCAAGATGCGTTCACATAATATATTAG 57.305 33.333 10.79 6.03 31.71 1.73
3600 3657 8.879759 CATGCAGCTGATTTCATCTTAAATTTT 58.120 29.630 20.43 0.00 0.00 1.82
3637 3694 8.474831 TCTCGATGTAGATCTGGTGATTTTTAA 58.525 33.333 5.18 0.00 32.19 1.52
3638 3695 9.265901 CTCGATGTAGATCTGGTGATTTTTAAT 57.734 33.333 5.18 0.00 32.19 1.40
3639 3696 9.045223 TCGATGTAGATCTGGTGATTTTTAATG 57.955 33.333 5.18 0.00 32.19 1.90
3640 3697 9.045223 CGATGTAGATCTGGTGATTTTTAATGA 57.955 33.333 5.18 0.00 32.19 2.57
3670 3727 7.770801 AAAAACAAAGCTAAAGTTCCATCAC 57.229 32.000 0.00 0.00 0.00 3.06
3671 3728 6.463995 AAACAAAGCTAAAGTTCCATCACA 57.536 33.333 0.00 0.00 0.00 3.58
3672 3729 6.463995 AACAAAGCTAAAGTTCCATCACAA 57.536 33.333 0.00 0.00 0.00 3.33
3673 3730 6.076981 ACAAAGCTAAAGTTCCATCACAAG 57.923 37.500 0.00 0.00 0.00 3.16
3674 3731 5.827797 ACAAAGCTAAAGTTCCATCACAAGA 59.172 36.000 0.00 0.00 0.00 3.02
3675 3732 6.491403 ACAAAGCTAAAGTTCCATCACAAGAT 59.509 34.615 0.00 0.00 33.87 2.40
3685 3742 3.314763 CATCACAAGATGTCGATGTGC 57.685 47.619 10.54 0.00 45.28 4.57
3686 3743 2.453983 TCACAAGATGTCGATGTGCA 57.546 45.000 10.54 0.00 43.15 4.57
3687 3744 2.976589 TCACAAGATGTCGATGTGCAT 58.023 42.857 10.54 0.00 43.15 3.96
3688 3745 2.931969 TCACAAGATGTCGATGTGCATC 59.068 45.455 10.54 8.16 43.15 3.91
3689 3746 2.674357 CACAAGATGTCGATGTGCATCA 59.326 45.455 14.12 0.00 42.72 3.07
3690 3747 2.674852 ACAAGATGTCGATGTGCATCAC 59.325 45.455 14.12 9.38 42.72 3.06
3704 3761 2.357327 CATCACACAATGCACCTTGG 57.643 50.000 5.11 0.00 0.00 3.61
3705 3762 1.887854 CATCACACAATGCACCTTGGA 59.112 47.619 5.11 0.00 0.00 3.53
3706 3763 2.064434 TCACACAATGCACCTTGGAA 57.936 45.000 5.11 0.00 0.00 3.53
3707 3764 1.680735 TCACACAATGCACCTTGGAAC 59.319 47.619 5.11 0.00 0.00 3.62
3708 3765 1.408340 CACACAATGCACCTTGGAACA 59.592 47.619 5.11 0.00 0.00 3.18
3709 3766 2.036217 CACACAATGCACCTTGGAACAT 59.964 45.455 5.11 0.00 39.30 2.71
3710 3767 3.255395 CACACAATGCACCTTGGAACATA 59.745 43.478 5.11 0.00 39.30 2.29
3711 3768 4.082081 CACACAATGCACCTTGGAACATAT 60.082 41.667 5.11 0.00 39.30 1.78
3712 3769 4.158394 ACACAATGCACCTTGGAACATATC 59.842 41.667 5.11 0.00 39.30 1.63
3727 3784 7.296628 GGAACATATCCTAACACAGAGATCT 57.703 40.000 0.00 0.00 45.56 2.75
3728 3785 7.731054 GGAACATATCCTAACACAGAGATCTT 58.269 38.462 0.00 0.00 45.56 2.40
3729 3786 8.207545 GGAACATATCCTAACACAGAGATCTTT 58.792 37.037 0.00 0.00 45.56 2.52
3730 3787 9.606631 GAACATATCCTAACACAGAGATCTTTT 57.393 33.333 0.00 0.00 0.00 2.27
3731 3788 9.965902 AACATATCCTAACACAGAGATCTTTTT 57.034 29.630 0.00 0.00 0.00 1.94
3758 3815 7.807977 TTTTTGAGCTTTAACACAGAGATCT 57.192 32.000 0.00 0.00 0.00 2.75
3759 3816 7.807977 TTTTGAGCTTTAACACAGAGATCTT 57.192 32.000 0.00 0.00 0.00 2.40
3760 3817 6.791887 TTGAGCTTTAACACAGAGATCTTG 57.208 37.500 0.00 0.00 0.00 3.02
3761 3818 5.240891 TGAGCTTTAACACAGAGATCTTGG 58.759 41.667 0.00 0.00 0.00 3.61
3762 3819 4.006319 AGCTTTAACACAGAGATCTTGGC 58.994 43.478 0.00 0.00 0.00 4.52
3763 3820 3.753272 GCTTTAACACAGAGATCTTGGCA 59.247 43.478 0.00 0.00 0.00 4.92
3764 3821 4.216257 GCTTTAACACAGAGATCTTGGCAA 59.784 41.667 0.00 0.00 0.00 4.52
3765 3822 5.618640 GCTTTAACACAGAGATCTTGGCAAG 60.619 44.000 21.17 21.17 0.00 4.01
3766 3823 2.486472 ACACAGAGATCTTGGCAAGG 57.514 50.000 25.92 11.83 0.00 3.61
3767 3824 1.701847 ACACAGAGATCTTGGCAAGGT 59.298 47.619 25.92 20.70 0.00 3.50
3768 3825 2.906389 ACACAGAGATCTTGGCAAGGTA 59.094 45.455 25.92 9.25 0.00 3.08
3769 3826 3.521126 ACACAGAGATCTTGGCAAGGTAT 59.479 43.478 25.92 17.77 0.00 2.73
3770 3827 4.125703 CACAGAGATCTTGGCAAGGTATC 58.874 47.826 23.98 23.98 30.01 2.24
3771 3828 3.181471 ACAGAGATCTTGGCAAGGTATCG 60.181 47.826 24.72 21.27 35.08 2.92
3772 3829 3.068732 CAGAGATCTTGGCAAGGTATCGA 59.931 47.826 24.72 8.11 35.08 3.59
3773 3830 3.068873 AGAGATCTTGGCAAGGTATCGAC 59.931 47.826 24.72 18.81 35.08 4.20
3774 3831 3.034635 AGATCTTGGCAAGGTATCGACT 58.965 45.455 25.92 9.92 0.00 4.18
3775 3832 2.672961 TCTTGGCAAGGTATCGACTG 57.327 50.000 25.92 0.00 0.00 3.51
3776 3833 1.899814 TCTTGGCAAGGTATCGACTGT 59.100 47.619 25.92 0.00 0.00 3.55
3777 3834 3.093814 TCTTGGCAAGGTATCGACTGTA 58.906 45.455 25.92 0.00 0.00 2.74
3778 3835 2.953466 TGGCAAGGTATCGACTGTAC 57.047 50.000 0.00 0.00 0.00 2.90
3779 3836 2.172679 TGGCAAGGTATCGACTGTACA 58.827 47.619 0.00 0.00 0.00 2.90
3780 3837 2.563620 TGGCAAGGTATCGACTGTACAA 59.436 45.455 0.00 0.00 0.00 2.41
3781 3838 2.928116 GGCAAGGTATCGACTGTACAAC 59.072 50.000 0.00 0.00 0.00 3.32
3782 3839 3.581755 GCAAGGTATCGACTGTACAACA 58.418 45.455 0.00 0.00 0.00 3.33
3783 3840 3.367025 GCAAGGTATCGACTGTACAACAC 59.633 47.826 0.00 0.00 0.00 3.32
3784 3841 4.806330 CAAGGTATCGACTGTACAACACT 58.194 43.478 0.00 0.00 0.00 3.55
3785 3842 5.620654 GCAAGGTATCGACTGTACAACACTA 60.621 44.000 0.00 0.00 0.00 2.74
3786 3843 5.814764 AGGTATCGACTGTACAACACTAG 57.185 43.478 0.00 0.00 0.00 2.57
3787 3844 4.639310 AGGTATCGACTGTACAACACTAGG 59.361 45.833 0.00 0.00 0.00 3.02
3788 3845 3.505464 ATCGACTGTACAACACTAGGC 57.495 47.619 0.00 0.00 0.00 3.93
3789 3846 1.198408 TCGACTGTACAACACTAGGCG 59.802 52.381 0.00 0.00 37.83 5.52
3790 3847 1.731424 CGACTGTACAACACTAGGCGG 60.731 57.143 0.00 0.00 34.87 6.13
3791 3848 0.606604 ACTGTACAACACTAGGCGGG 59.393 55.000 0.00 0.00 0.00 6.13
3792 3849 0.108329 CTGTACAACACTAGGCGGGG 60.108 60.000 0.00 0.00 0.00 5.73
3793 3850 1.449070 GTACAACACTAGGCGGGGC 60.449 63.158 0.00 0.00 0.00 5.80
3805 3862 2.281091 CGGGGCCAGGAGGTACTA 59.719 66.667 4.39 0.00 41.55 1.82
3806 3863 1.152312 CGGGGCCAGGAGGTACTAT 60.152 63.158 4.39 0.00 41.55 2.12
3807 3864 1.186267 CGGGGCCAGGAGGTACTATC 61.186 65.000 4.39 0.00 41.55 2.08
3808 3865 0.191314 GGGGCCAGGAGGTACTATCT 59.809 60.000 4.39 0.00 41.55 1.98
3809 3866 1.432024 GGGGCCAGGAGGTACTATCTA 59.568 57.143 4.39 0.00 41.55 1.98
3810 3867 2.044630 GGGGCCAGGAGGTACTATCTAT 59.955 54.545 4.39 0.00 41.55 1.98
3811 3868 3.100671 GGGCCAGGAGGTACTATCTATG 58.899 54.545 4.39 0.00 41.55 2.23
3812 3869 3.100671 GGCCAGGAGGTACTATCTATGG 58.899 54.545 0.00 13.64 41.55 2.74
3813 3870 3.245658 GGCCAGGAGGTACTATCTATGGA 60.246 52.174 18.25 0.00 41.55 3.41
3814 3871 3.764972 GCCAGGAGGTACTATCTATGGAC 59.235 52.174 18.25 10.97 41.55 4.02
3815 3872 4.509482 GCCAGGAGGTACTATCTATGGACT 60.509 50.000 18.25 0.00 41.55 3.85
3816 3873 5.258051 CCAGGAGGTACTATCTATGGACTC 58.742 50.000 13.12 0.00 41.55 3.36
3817 3874 4.938832 CAGGAGGTACTATCTATGGACTCG 59.061 50.000 0.00 0.00 41.55 4.18
3818 3875 3.690628 GGAGGTACTATCTATGGACTCGC 59.309 52.174 0.00 0.00 41.55 5.03
3819 3876 4.325119 GAGGTACTATCTATGGACTCGCA 58.675 47.826 0.00 0.00 41.55 5.10
3820 3877 4.924625 AGGTACTATCTATGGACTCGCAT 58.075 43.478 0.00 0.00 36.02 4.73
3821 3878 4.702612 AGGTACTATCTATGGACTCGCATG 59.297 45.833 0.00 0.00 36.02 4.06
3822 3879 3.584406 ACTATCTATGGACTCGCATGC 57.416 47.619 7.91 7.91 0.00 4.06
3823 3880 2.893489 ACTATCTATGGACTCGCATGCA 59.107 45.455 19.57 4.02 0.00 3.96
3824 3881 2.916702 ATCTATGGACTCGCATGCAA 57.083 45.000 19.57 0.00 0.00 4.08
3825 3882 2.689553 TCTATGGACTCGCATGCAAA 57.310 45.000 19.57 3.85 0.00 3.68
3826 3883 3.198409 TCTATGGACTCGCATGCAAAT 57.802 42.857 19.57 0.67 0.00 2.32
3827 3884 4.335400 TCTATGGACTCGCATGCAAATA 57.665 40.909 19.57 4.89 0.00 1.40
3828 3885 4.898320 TCTATGGACTCGCATGCAAATAT 58.102 39.130 19.57 6.46 0.00 1.28
3829 3886 6.036577 TCTATGGACTCGCATGCAAATATA 57.963 37.500 19.57 7.25 0.00 0.86
3830 3887 6.643388 TCTATGGACTCGCATGCAAATATAT 58.357 36.000 19.57 7.51 0.00 0.86
3831 3888 7.105588 TCTATGGACTCGCATGCAAATATATT 58.894 34.615 19.57 0.00 0.00 1.28
3832 3889 6.579666 ATGGACTCGCATGCAAATATATTT 57.420 33.333 19.57 4.81 0.00 1.40
3833 3890 6.389830 TGGACTCGCATGCAAATATATTTT 57.610 33.333 19.57 0.00 0.00 1.82
3834 3891 6.804677 TGGACTCGCATGCAAATATATTTTT 58.195 32.000 19.57 0.00 0.00 1.94
3835 3892 6.696583 TGGACTCGCATGCAAATATATTTTTG 59.303 34.615 19.57 12.68 39.16 2.44
3836 3893 6.697019 GGACTCGCATGCAAATATATTTTTGT 59.303 34.615 19.57 0.00 38.55 2.83
3837 3894 7.222611 GGACTCGCATGCAAATATATTTTTGTT 59.777 33.333 19.57 5.77 38.55 2.83
3838 3895 8.477984 ACTCGCATGCAAATATATTTTTGTTT 57.522 26.923 19.57 5.49 38.55 2.83
3839 3896 9.579768 ACTCGCATGCAAATATATTTTTGTTTA 57.420 25.926 19.57 7.35 38.55 2.01
3860 3917 8.682710 TGTTTAATTCCATAACATAGTTGGAGC 58.317 33.333 0.00 0.00 40.48 4.70
3861 3918 8.682710 GTTTAATTCCATAACATAGTTGGAGCA 58.317 33.333 0.00 0.00 40.48 4.26
3862 3919 6.949352 AATTCCATAACATAGTTGGAGCAG 57.051 37.500 0.00 0.00 40.48 4.24
3863 3920 3.808728 TCCATAACATAGTTGGAGCAGC 58.191 45.455 0.00 0.00 34.65 5.25
3864 3921 3.199727 TCCATAACATAGTTGGAGCAGCA 59.800 43.478 0.00 0.00 34.65 4.41
3865 3922 3.947196 CCATAACATAGTTGGAGCAGCAA 59.053 43.478 0.00 0.00 31.94 3.91
3866 3923 4.036027 CCATAACATAGTTGGAGCAGCAAG 59.964 45.833 0.00 0.00 31.94 4.01
3867 3924 3.423539 AACATAGTTGGAGCAGCAAGA 57.576 42.857 0.00 0.00 0.00 3.02
3868 3925 3.641434 ACATAGTTGGAGCAGCAAGAT 57.359 42.857 0.00 0.00 0.00 2.40
3869 3926 4.760530 ACATAGTTGGAGCAGCAAGATA 57.239 40.909 0.00 0.00 0.00 1.98
3870 3927 4.446371 ACATAGTTGGAGCAGCAAGATAC 58.554 43.478 0.00 0.00 0.00 2.24
3871 3928 4.163078 ACATAGTTGGAGCAGCAAGATACT 59.837 41.667 0.00 0.00 0.00 2.12
3872 3929 2.983229 AGTTGGAGCAGCAAGATACTG 58.017 47.619 0.00 0.00 38.22 2.74
3873 3930 2.012673 GTTGGAGCAGCAAGATACTGG 58.987 52.381 0.00 0.00 35.62 4.00
3879 3936 4.065321 AGCAGCAAGATACTGGTCATAC 57.935 45.455 0.00 0.00 41.87 2.39
3880 3937 2.797156 GCAGCAAGATACTGGTCATACG 59.203 50.000 0.00 0.00 35.62 3.06
3881 3938 3.384668 CAGCAAGATACTGGTCATACGG 58.615 50.000 0.00 0.00 0.00 4.02
3882 3939 3.068165 CAGCAAGATACTGGTCATACGGA 59.932 47.826 0.00 0.00 0.00 4.69
3883 3940 3.898123 AGCAAGATACTGGTCATACGGAT 59.102 43.478 0.00 0.00 0.00 4.18
3884 3941 5.048013 CAGCAAGATACTGGTCATACGGATA 60.048 44.000 0.00 0.00 0.00 2.59
3885 3942 5.538813 AGCAAGATACTGGTCATACGGATAA 59.461 40.000 0.00 0.00 0.00 1.75
3886 3943 6.211584 AGCAAGATACTGGTCATACGGATAAT 59.788 38.462 0.00 0.00 0.00 1.28
3887 3944 6.311445 GCAAGATACTGGTCATACGGATAATG 59.689 42.308 0.00 0.00 0.00 1.90
3888 3945 7.602753 CAAGATACTGGTCATACGGATAATGA 58.397 38.462 0.00 0.00 0.00 2.57
3889 3946 7.776618 AGATACTGGTCATACGGATAATGAA 57.223 36.000 0.00 0.00 35.23 2.57
3890 3947 7.603651 AGATACTGGTCATACGGATAATGAAC 58.396 38.462 0.00 0.00 40.73 3.18
3891 3948 4.617959 ACTGGTCATACGGATAATGAACG 58.382 43.478 0.00 0.00 42.80 3.95
3892 3949 4.340097 ACTGGTCATACGGATAATGAACGA 59.660 41.667 0.00 0.00 42.80 3.85
3893 3950 5.010719 ACTGGTCATACGGATAATGAACGAT 59.989 40.000 0.00 0.00 42.80 3.73
3894 3951 5.849510 TGGTCATACGGATAATGAACGATT 58.150 37.500 0.00 0.00 42.80 3.34
3895 3952 6.285224 TGGTCATACGGATAATGAACGATTT 58.715 36.000 0.00 0.00 42.80 2.17
3896 3953 6.764085 TGGTCATACGGATAATGAACGATTTT 59.236 34.615 0.00 0.00 42.80 1.82
3897 3954 7.042321 TGGTCATACGGATAATGAACGATTTTC 60.042 37.037 0.00 0.00 42.80 2.29
3898 3955 7.042321 GGTCATACGGATAATGAACGATTTTCA 60.042 37.037 0.00 0.00 35.23 2.69
3899 3956 8.332464 GTCATACGGATAATGAACGATTTTCAA 58.668 33.333 0.00 0.00 35.23 2.69
3900 3957 8.884726 TCATACGGATAATGAACGATTTTCAAA 58.115 29.630 0.00 0.00 30.52 2.69
3901 3958 8.943925 CATACGGATAATGAACGATTTTCAAAC 58.056 33.333 0.00 0.00 31.55 2.93
3902 3959 6.319399 ACGGATAATGAACGATTTTCAAACC 58.681 36.000 0.00 0.00 31.55 3.27
3903 3960 6.072397 ACGGATAATGAACGATTTTCAAACCA 60.072 34.615 0.00 0.00 31.55 3.67
3904 3961 6.972328 CGGATAATGAACGATTTTCAAACCAT 59.028 34.615 0.00 0.00 31.55 3.55
3905 3962 7.044117 CGGATAATGAACGATTTTCAAACCATG 60.044 37.037 0.00 0.00 31.55 3.66
3906 3963 7.222611 GGATAATGAACGATTTTCAAACCATGG 59.777 37.037 11.19 11.19 31.55 3.66
3907 3964 4.927978 TGAACGATTTTCAAACCATGGT 57.072 36.364 13.00 13.00 0.00 3.55
3908 3965 5.269505 TGAACGATTTTCAAACCATGGTT 57.730 34.783 24.86 24.86 40.45 3.67
3910 3967 6.806751 TGAACGATTTTCAAACCATGGTTTA 58.193 32.000 36.22 24.12 45.32 2.01
3911 3968 6.920758 TGAACGATTTTCAAACCATGGTTTAG 59.079 34.615 36.22 28.76 45.32 1.85
3912 3969 5.778862 ACGATTTTCAAACCATGGTTTAGG 58.221 37.500 36.22 26.45 45.32 2.69
3913 3970 5.303333 ACGATTTTCAAACCATGGTTTAGGT 59.697 36.000 36.22 23.11 45.32 3.08
3914 3971 5.633182 CGATTTTCAAACCATGGTTTAGGTG 59.367 40.000 36.22 26.55 45.32 4.00
3915 3972 4.329462 TTTCAAACCATGGTTTAGGTGC 57.671 40.909 36.22 0.00 45.32 5.01
3916 3973 1.883275 TCAAACCATGGTTTAGGTGCG 59.117 47.619 36.22 24.55 45.32 5.34
3917 3974 1.883275 CAAACCATGGTTTAGGTGCGA 59.117 47.619 36.22 0.00 45.32 5.10
3918 3975 1.821216 AACCATGGTTTAGGTGCGAG 58.179 50.000 24.86 0.00 38.37 5.03
3919 3976 0.981183 ACCATGGTTTAGGTGCGAGA 59.019 50.000 13.00 0.00 36.60 4.04
3920 3977 1.066143 ACCATGGTTTAGGTGCGAGAG 60.066 52.381 13.00 0.00 36.60 3.20
3921 3978 1.656652 CATGGTTTAGGTGCGAGAGG 58.343 55.000 0.00 0.00 0.00 3.69
3922 3979 0.541863 ATGGTTTAGGTGCGAGAGGG 59.458 55.000 0.00 0.00 0.00 4.30
3923 3980 1.221021 GGTTTAGGTGCGAGAGGGG 59.779 63.158 0.00 0.00 0.00 4.79
3924 3981 1.449778 GTTTAGGTGCGAGAGGGGC 60.450 63.158 0.00 0.00 0.00 5.80
3925 3982 2.666098 TTTAGGTGCGAGAGGGGCC 61.666 63.158 0.00 0.00 0.00 5.80
3929 3986 2.844839 GTGCGAGAGGGGCCCTAT 60.845 66.667 28.92 25.58 31.76 2.57
3930 3987 2.844362 TGCGAGAGGGGCCCTATG 60.844 66.667 27.57 18.80 31.76 2.23
3931 3988 3.631046 GCGAGAGGGGCCCTATGG 61.631 72.222 27.57 25.21 31.76 2.74
3932 3989 2.201490 CGAGAGGGGCCCTATGGA 59.799 66.667 27.57 0.00 31.76 3.41
3933 3990 1.910772 CGAGAGGGGCCCTATGGAG 60.911 68.421 27.57 12.01 31.76 3.86
3934 3991 1.549297 GAGAGGGGCCCTATGGAGA 59.451 63.158 27.57 0.00 31.76 3.71
3935 3992 0.118144 GAGAGGGGCCCTATGGAGAT 59.882 60.000 27.57 0.00 31.76 2.75
3936 3993 0.118144 AGAGGGGCCCTATGGAGATC 59.882 60.000 28.92 10.96 31.76 2.75
3937 3994 0.178891 GAGGGGCCCTATGGAGATCA 60.179 60.000 28.92 0.00 31.76 2.92
3938 3995 0.474660 AGGGGCCCTATGGAGATCAC 60.475 60.000 27.62 0.00 28.47 3.06
3939 3996 0.768221 GGGGCCCTATGGAGATCACA 60.768 60.000 24.38 0.00 0.00 3.58
3940 3997 1.140312 GGGCCCTATGGAGATCACAA 58.860 55.000 17.04 0.00 0.00 3.33
3941 3998 1.202818 GGGCCCTATGGAGATCACAAC 60.203 57.143 17.04 0.00 0.00 3.32
3942 3999 1.490490 GGCCCTATGGAGATCACAACA 59.510 52.381 0.00 0.00 0.00 3.33
3943 4000 2.565841 GCCCTATGGAGATCACAACAC 58.434 52.381 0.00 0.00 0.00 3.32
3944 4001 2.092968 GCCCTATGGAGATCACAACACA 60.093 50.000 0.00 0.00 0.00 3.72
3945 4002 3.535561 CCCTATGGAGATCACAACACAC 58.464 50.000 0.00 0.00 0.00 3.82
3946 4003 3.055167 CCCTATGGAGATCACAACACACA 60.055 47.826 0.00 0.00 0.00 3.72
3947 4004 3.935203 CCTATGGAGATCACAACACACAC 59.065 47.826 0.00 0.00 0.00 3.82
3948 4005 1.864565 TGGAGATCACAACACACACG 58.135 50.000 0.00 0.00 0.00 4.49
3949 4006 0.512952 GGAGATCACAACACACACGC 59.487 55.000 0.00 0.00 0.00 5.34
3950 4007 1.217001 GAGATCACAACACACACGCA 58.783 50.000 0.00 0.00 0.00 5.24
3951 4008 1.800586 GAGATCACAACACACACGCAT 59.199 47.619 0.00 0.00 0.00 4.73
3952 4009 1.800586 AGATCACAACACACACGCATC 59.199 47.619 0.00 0.00 0.00 3.91
3953 4010 0.512518 ATCACAACACACACGCATCG 59.487 50.000 0.00 0.00 0.00 3.84
3954 4011 1.722163 CACAACACACACGCATCGC 60.722 57.895 0.00 0.00 0.00 4.58
3955 4012 1.887242 ACAACACACACGCATCGCT 60.887 52.632 0.00 0.00 0.00 4.93
3956 4013 0.598942 ACAACACACACGCATCGCTA 60.599 50.000 0.00 0.00 0.00 4.26
3957 4014 0.510790 CAACACACACGCATCGCTAA 59.489 50.000 0.00 0.00 0.00 3.09
3958 4015 0.511221 AACACACACGCATCGCTAAC 59.489 50.000 0.00 0.00 0.00 2.34
3959 4016 1.057208 CACACACGCATCGCTAACG 59.943 57.895 0.00 0.00 42.01 3.18
3960 4017 1.372499 ACACACGCATCGCTAACGT 60.372 52.632 0.00 0.00 41.45 3.99
3961 4018 1.340465 CACACGCATCGCTAACGTC 59.660 57.895 0.00 0.00 38.09 4.34
3962 4019 1.804326 ACACGCATCGCTAACGTCC 60.804 57.895 0.00 0.00 38.09 4.79
3963 4020 1.516386 CACGCATCGCTAACGTCCT 60.516 57.895 0.00 0.00 38.09 3.85
3964 4021 1.516386 ACGCATCGCTAACGTCCTG 60.516 57.895 0.00 0.00 41.18 3.86
3965 4022 2.860628 CGCATCGCTAACGTCCTGC 61.861 63.158 0.00 0.00 41.18 4.85
3966 4023 2.526120 GCATCGCTAACGTCCTGCC 61.526 63.158 0.00 0.00 41.18 4.85
3967 4024 1.153647 CATCGCTAACGTCCTGCCA 60.154 57.895 0.00 0.00 41.18 4.92
3968 4025 1.141881 ATCGCTAACGTCCTGCCAG 59.858 57.895 0.00 0.00 41.18 4.85
3969 4026 2.907897 ATCGCTAACGTCCTGCCAGC 62.908 60.000 0.00 0.00 41.18 4.85
3970 4027 2.820037 GCTAACGTCCTGCCAGCC 60.820 66.667 0.00 0.00 0.00 4.85
3971 4028 2.125106 CTAACGTCCTGCCAGCCC 60.125 66.667 0.00 0.00 0.00 5.19
3972 4029 2.925706 TAACGTCCTGCCAGCCCA 60.926 61.111 0.00 0.00 0.00 5.36
3973 4030 2.463589 CTAACGTCCTGCCAGCCCAA 62.464 60.000 0.00 0.00 0.00 4.12
3974 4031 2.463589 TAACGTCCTGCCAGCCCAAG 62.464 60.000 0.00 0.00 0.00 3.61
3975 4032 4.020617 CGTCCTGCCAGCCCAAGA 62.021 66.667 0.00 0.00 0.00 3.02
3976 4033 2.436109 GTCCTGCCAGCCCAAGAA 59.564 61.111 0.00 0.00 0.00 2.52
3977 4034 1.228552 GTCCTGCCAGCCCAAGAAA 60.229 57.895 0.00 0.00 0.00 2.52
3978 4035 1.075482 TCCTGCCAGCCCAAGAAAG 59.925 57.895 0.00 0.00 0.00 2.62
3979 4036 1.980772 CCTGCCAGCCCAAGAAAGG 60.981 63.158 0.00 0.00 0.00 3.11
3985 4042 4.966005 GCCCAAGAAAGGCGAAAC 57.034 55.556 0.00 0.00 41.41 2.78
3986 4043 1.081442 GCCCAAGAAAGGCGAAACG 60.081 57.895 0.00 0.00 41.41 3.60
3987 4044 1.579429 CCCAAGAAAGGCGAAACGG 59.421 57.895 0.00 0.00 0.00 4.44
3988 4045 1.579429 CCAAGAAAGGCGAAACGGG 59.421 57.895 0.00 0.00 0.00 5.28
3989 4046 1.170290 CCAAGAAAGGCGAAACGGGT 61.170 55.000 0.00 0.00 0.00 5.28
3990 4047 0.040425 CAAGAAAGGCGAAACGGGTG 60.040 55.000 0.00 0.00 0.00 4.61
3991 4048 1.170290 AAGAAAGGCGAAACGGGTGG 61.170 55.000 0.00 0.00 0.00 4.61
3992 4049 1.895231 GAAAGGCGAAACGGGTGGT 60.895 57.895 0.00 0.00 0.00 4.16
3993 4050 2.125202 GAAAGGCGAAACGGGTGGTG 62.125 60.000 0.00 0.00 0.00 4.17
3994 4051 2.612095 AAAGGCGAAACGGGTGGTGA 62.612 55.000 0.00 0.00 0.00 4.02
3995 4052 3.351416 GGCGAAACGGGTGGTGAC 61.351 66.667 0.00 0.00 0.00 3.67
3996 4053 3.708734 GCGAAACGGGTGGTGACG 61.709 66.667 0.00 0.00 0.00 4.35
3997 4054 2.027897 CGAAACGGGTGGTGACGA 59.972 61.111 0.00 0.00 32.38 4.20
3998 4055 1.592131 CGAAACGGGTGGTGACGAA 60.592 57.895 0.00 0.00 32.38 3.85
3999 4056 1.554042 CGAAACGGGTGGTGACGAAG 61.554 60.000 0.00 0.00 32.38 3.79
4000 4057 0.249573 GAAACGGGTGGTGACGAAGA 60.250 55.000 0.00 0.00 0.00 2.87
4001 4058 0.531311 AAACGGGTGGTGACGAAGAC 60.531 55.000 0.00 0.00 0.00 3.01
4002 4059 1.678598 AACGGGTGGTGACGAAGACA 61.679 55.000 0.00 0.00 0.00 3.41
4003 4060 1.372997 CGGGTGGTGACGAAGACAG 60.373 63.158 0.00 0.00 30.17 3.51
4004 4061 1.746517 GGGTGGTGACGAAGACAGT 59.253 57.895 0.00 0.00 30.17 3.55
4005 4062 0.319641 GGGTGGTGACGAAGACAGTC 60.320 60.000 0.00 0.00 38.98 3.51
4006 4063 0.663568 GGTGGTGACGAAGACAGTCG 60.664 60.000 0.00 0.00 46.54 4.18
4007 4064 0.663568 GTGGTGACGAAGACAGTCGG 60.664 60.000 0.00 0.00 45.40 4.79
4008 4065 1.105167 TGGTGACGAAGACAGTCGGT 61.105 55.000 0.00 0.00 45.40 4.69
4009 4066 0.663568 GGTGACGAAGACAGTCGGTG 60.664 60.000 0.00 0.00 45.40 4.94
4010 4067 1.007734 TGACGAAGACAGTCGGTGC 60.008 57.895 0.00 0.00 45.40 5.01
4011 4068 1.007734 GACGAAGACAGTCGGTGCA 60.008 57.895 0.00 0.00 45.40 4.57
4012 4069 0.388649 GACGAAGACAGTCGGTGCAT 60.389 55.000 0.00 0.00 45.40 3.96
4013 4070 0.885879 ACGAAGACAGTCGGTGCATA 59.114 50.000 0.00 0.00 45.40 3.14
4014 4071 1.476891 ACGAAGACAGTCGGTGCATAT 59.523 47.619 0.00 0.00 45.40 1.78
4015 4072 2.686405 ACGAAGACAGTCGGTGCATATA 59.314 45.455 0.00 0.00 45.40 0.86
4016 4073 3.318275 ACGAAGACAGTCGGTGCATATAT 59.682 43.478 0.00 0.00 45.40 0.86
4017 4074 4.517832 ACGAAGACAGTCGGTGCATATATA 59.482 41.667 0.00 0.00 45.40 0.86
4018 4075 4.852104 CGAAGACAGTCGGTGCATATATAC 59.148 45.833 0.00 0.00 37.37 1.47
4019 4076 5.562113 CGAAGACAGTCGGTGCATATATACA 60.562 44.000 0.00 0.00 37.37 2.29
4020 4077 5.784578 AGACAGTCGGTGCATATATACAA 57.215 39.130 0.00 0.00 0.00 2.41
4021 4078 5.773575 AGACAGTCGGTGCATATATACAAG 58.226 41.667 0.00 0.00 0.00 3.16
4022 4079 4.307432 ACAGTCGGTGCATATATACAAGC 58.693 43.478 0.00 0.00 0.00 4.01
4023 4080 3.679980 CAGTCGGTGCATATATACAAGCC 59.320 47.826 0.00 0.00 0.00 4.35
4024 4081 3.323691 AGTCGGTGCATATATACAAGCCA 59.676 43.478 0.00 0.00 0.00 4.75
4025 4082 4.062293 GTCGGTGCATATATACAAGCCAA 58.938 43.478 0.00 0.00 0.00 4.52
4026 4083 4.152402 GTCGGTGCATATATACAAGCCAAG 59.848 45.833 0.00 0.00 0.00 3.61
4027 4084 3.120199 CGGTGCATATATACAAGCCAAGC 60.120 47.826 0.00 0.00 0.00 4.01
4028 4085 4.074970 GGTGCATATATACAAGCCAAGCT 58.925 43.478 0.00 0.00 42.56 3.74
4039 4096 2.583472 GCCAAGCTTTAGGGCATGT 58.417 52.632 18.76 0.00 46.92 3.21
4040 4097 0.897621 GCCAAGCTTTAGGGCATGTT 59.102 50.000 18.76 0.00 46.92 2.71
4041 4098 1.134995 GCCAAGCTTTAGGGCATGTTC 60.135 52.381 18.76 0.00 46.92 3.18
4042 4099 1.133025 CCAAGCTTTAGGGCATGTTCG 59.867 52.381 0.00 0.00 34.17 3.95
4043 4100 2.083774 CAAGCTTTAGGGCATGTTCGA 58.916 47.619 0.00 0.00 34.17 3.71
4044 4101 2.684881 CAAGCTTTAGGGCATGTTCGAT 59.315 45.455 0.00 0.00 34.17 3.59
4045 4102 2.292267 AGCTTTAGGGCATGTTCGATG 58.708 47.619 0.00 0.00 34.17 3.84
4046 4103 1.334869 GCTTTAGGGCATGTTCGATGG 59.665 52.381 0.00 0.00 0.00 3.51
4047 4104 2.643551 CTTTAGGGCATGTTCGATGGT 58.356 47.619 0.00 0.00 0.00 3.55
4048 4105 2.799126 TTAGGGCATGTTCGATGGTT 57.201 45.000 0.00 0.00 0.00 3.67
4049 4106 2.036958 TAGGGCATGTTCGATGGTTG 57.963 50.000 0.00 0.00 0.00 3.77
4050 4107 0.038166 AGGGCATGTTCGATGGTTGT 59.962 50.000 0.00 0.00 0.00 3.32
4051 4108 0.451783 GGGCATGTTCGATGGTTGTC 59.548 55.000 0.00 0.00 0.00 3.18
4052 4109 0.096976 GGCATGTTCGATGGTTGTCG 59.903 55.000 0.00 0.00 42.74 4.35
4053 4110 0.096976 GCATGTTCGATGGTTGTCGG 59.903 55.000 0.00 0.00 41.74 4.79
4054 4111 0.726827 CATGTTCGATGGTTGTCGGG 59.273 55.000 0.00 0.00 41.74 5.14
4055 4112 0.611200 ATGTTCGATGGTTGTCGGGA 59.389 50.000 0.00 0.00 41.74 5.14
4056 4113 0.611200 TGTTCGATGGTTGTCGGGAT 59.389 50.000 0.00 0.00 41.74 3.85
4057 4114 1.287425 GTTCGATGGTTGTCGGGATC 58.713 55.000 0.00 0.00 41.74 3.36
4058 4115 0.179121 TTCGATGGTTGTCGGGATCG 60.179 55.000 0.00 0.00 41.74 3.69
4059 4116 1.033202 TCGATGGTTGTCGGGATCGA 61.033 55.000 0.00 0.00 43.21 3.59
4060 4117 0.595053 CGATGGTTGTCGGGATCGAG 60.595 60.000 0.00 0.00 46.91 4.04
4061 4118 0.249489 GATGGTTGTCGGGATCGAGG 60.249 60.000 0.00 0.00 46.91 4.63
4062 4119 0.686441 ATGGTTGTCGGGATCGAGGA 60.686 55.000 0.00 0.00 46.91 3.71
4063 4120 1.320344 TGGTTGTCGGGATCGAGGAG 61.320 60.000 0.00 0.00 46.91 3.69
4064 4121 1.321074 GGTTGTCGGGATCGAGGAGT 61.321 60.000 0.00 0.00 46.91 3.85
4065 4122 0.531200 GTTGTCGGGATCGAGGAGTT 59.469 55.000 0.00 0.00 46.91 3.01
4066 4123 0.530744 TTGTCGGGATCGAGGAGTTG 59.469 55.000 0.00 0.00 46.91 3.16
4067 4124 1.227002 GTCGGGATCGAGGAGTTGC 60.227 63.158 0.00 0.00 46.91 4.17
4068 4125 2.107141 CGGGATCGAGGAGTTGCC 59.893 66.667 0.00 0.00 39.00 4.52
4069 4126 2.506472 GGGATCGAGGAGTTGCCC 59.494 66.667 0.00 0.00 37.37 5.36
4070 4127 2.066999 GGGATCGAGGAGTTGCCCT 61.067 63.158 0.00 0.00 39.77 5.19
4089 4146 3.330267 CCTCAAGGGATATTCTTAGCGC 58.670 50.000 0.00 0.00 37.23 5.92
4090 4147 3.330267 CTCAAGGGATATTCTTAGCGCC 58.670 50.000 2.29 0.00 0.00 6.53
4091 4148 2.703536 TCAAGGGATATTCTTAGCGCCA 59.296 45.455 2.29 0.00 0.00 5.69
4092 4149 3.070018 CAAGGGATATTCTTAGCGCCAG 58.930 50.000 2.29 0.00 0.00 4.85
4093 4150 2.609747 AGGGATATTCTTAGCGCCAGA 58.390 47.619 2.29 2.58 0.00 3.86
4094 4151 2.564947 AGGGATATTCTTAGCGCCAGAG 59.435 50.000 2.29 0.00 0.00 3.35
4095 4152 2.354203 GGGATATTCTTAGCGCCAGAGG 60.354 54.545 2.29 0.00 0.00 3.69
4096 4153 2.563179 GGATATTCTTAGCGCCAGAGGA 59.437 50.000 2.29 0.00 0.00 3.71
4097 4154 3.006967 GGATATTCTTAGCGCCAGAGGAA 59.993 47.826 2.29 2.32 0.00 3.36
4098 4155 2.317530 ATTCTTAGCGCCAGAGGAAC 57.682 50.000 2.29 0.00 0.00 3.62
4099 4156 0.973632 TTCTTAGCGCCAGAGGAACA 59.026 50.000 2.29 0.00 0.00 3.18
4100 4157 0.973632 TCTTAGCGCCAGAGGAACAA 59.026 50.000 2.29 0.00 0.00 2.83
4101 4158 1.079503 CTTAGCGCCAGAGGAACAAC 58.920 55.000 2.29 0.00 0.00 3.32
4102 4159 0.394938 TTAGCGCCAGAGGAACAACA 59.605 50.000 2.29 0.00 0.00 3.33
4103 4160 0.394938 TAGCGCCAGAGGAACAACAA 59.605 50.000 2.29 0.00 0.00 2.83
4104 4161 0.250901 AGCGCCAGAGGAACAACAAT 60.251 50.000 2.29 0.00 0.00 2.71
4105 4162 0.109597 GCGCCAGAGGAACAACAATG 60.110 55.000 0.00 0.00 0.00 2.82
4106 4163 1.522668 CGCCAGAGGAACAACAATGA 58.477 50.000 0.00 0.00 0.00 2.57
4107 4164 2.086869 CGCCAGAGGAACAACAATGAT 58.913 47.619 0.00 0.00 0.00 2.45
4108 4165 3.270027 CGCCAGAGGAACAACAATGATA 58.730 45.455 0.00 0.00 0.00 2.15
4109 4166 3.310774 CGCCAGAGGAACAACAATGATAG 59.689 47.826 0.00 0.00 0.00 2.08
4110 4167 4.517285 GCCAGAGGAACAACAATGATAGA 58.483 43.478 0.00 0.00 0.00 1.98
4111 4168 4.333926 GCCAGAGGAACAACAATGATAGAC 59.666 45.833 0.00 0.00 0.00 2.59
4112 4169 4.568359 CCAGAGGAACAACAATGATAGACG 59.432 45.833 0.00 0.00 0.00 4.18
4113 4170 4.568359 CAGAGGAACAACAATGATAGACGG 59.432 45.833 0.00 0.00 0.00 4.79
4114 4171 4.223032 AGAGGAACAACAATGATAGACGGT 59.777 41.667 0.00 0.00 0.00 4.83
4115 4172 4.253685 AGGAACAACAATGATAGACGGTG 58.746 43.478 0.00 0.00 0.00 4.94
4116 4173 4.020573 AGGAACAACAATGATAGACGGTGA 60.021 41.667 0.00 0.00 0.00 4.02
4117 4174 4.876107 GGAACAACAATGATAGACGGTGAT 59.124 41.667 0.00 0.00 0.00 3.06
4118 4175 5.220662 GGAACAACAATGATAGACGGTGATG 60.221 44.000 0.00 0.00 0.00 3.07
4119 4176 3.623060 ACAACAATGATAGACGGTGATGC 59.377 43.478 0.00 0.00 0.00 3.91
4120 4177 2.473816 ACAATGATAGACGGTGATGCG 58.526 47.619 0.00 0.00 0.00 4.73
4121 4178 2.100749 ACAATGATAGACGGTGATGCGA 59.899 45.455 0.00 0.00 0.00 5.10
4122 4179 2.713895 ATGATAGACGGTGATGCGAG 57.286 50.000 0.00 0.00 0.00 5.03
4123 4180 0.668535 TGATAGACGGTGATGCGAGG 59.331 55.000 0.00 0.00 0.00 4.63
4124 4181 0.952280 GATAGACGGTGATGCGAGGA 59.048 55.000 0.00 0.00 0.00 3.71
4125 4182 1.337071 GATAGACGGTGATGCGAGGAA 59.663 52.381 0.00 0.00 0.00 3.36
4126 4183 1.399714 TAGACGGTGATGCGAGGAAT 58.600 50.000 0.00 0.00 0.00 3.01
4127 4184 0.537188 AGACGGTGATGCGAGGAATT 59.463 50.000 0.00 0.00 0.00 2.17
4128 4185 0.652592 GACGGTGATGCGAGGAATTG 59.347 55.000 0.00 0.00 0.00 2.32
4129 4186 1.353103 CGGTGATGCGAGGAATTGC 59.647 57.895 0.00 0.00 0.00 3.56
4130 4187 1.729881 GGTGATGCGAGGAATTGCC 59.270 57.895 0.00 0.00 0.00 4.52
4131 4188 1.728490 GGTGATGCGAGGAATTGCCC 61.728 60.000 0.00 0.00 37.37 5.36
4132 4189 1.453745 TGATGCGAGGAATTGCCCC 60.454 57.895 0.00 0.00 37.37 5.80
4133 4190 1.453745 GATGCGAGGAATTGCCCCA 60.454 57.895 0.00 0.00 37.37 4.96
4134 4191 0.825010 GATGCGAGGAATTGCCCCAT 60.825 55.000 0.00 0.00 37.37 4.00
4135 4192 1.111116 ATGCGAGGAATTGCCCCATG 61.111 55.000 0.00 0.00 37.37 3.66
4136 4193 3.122850 CGAGGAATTGCCCCATGC 58.877 61.111 0.00 0.00 41.77 4.06
4137 4194 2.492773 CGAGGAATTGCCCCATGCC 61.493 63.158 0.00 0.00 40.16 4.40
4138 4195 2.041612 AGGAATTGCCCCATGCCC 60.042 61.111 0.00 0.00 40.16 5.36
4139 4196 3.539791 GGAATTGCCCCATGCCCG 61.540 66.667 0.00 0.00 40.16 6.13
4140 4197 2.441901 GAATTGCCCCATGCCCGA 60.442 61.111 0.00 0.00 40.16 5.14
4141 4198 1.833934 GAATTGCCCCATGCCCGAT 60.834 57.895 0.00 0.00 40.16 4.18
4142 4199 1.382971 AATTGCCCCATGCCCGATT 60.383 52.632 0.00 0.00 40.16 3.34
4143 4200 1.688269 AATTGCCCCATGCCCGATTG 61.688 55.000 0.00 0.00 40.16 2.67
4144 4201 4.837797 TGCCCCATGCCCGATTGG 62.838 66.667 0.00 0.00 40.16 3.16
4145 4202 4.521292 GCCCCATGCCCGATTGGA 62.521 66.667 0.00 0.00 37.49 3.53
4146 4203 2.203394 CCCCATGCCCGATTGGAG 60.203 66.667 0.00 0.00 37.49 3.86
4147 4204 2.597340 CCCATGCCCGATTGGAGT 59.403 61.111 0.00 0.00 37.49 3.85
4148 4205 1.076777 CCCATGCCCGATTGGAGTT 60.077 57.895 0.00 0.00 37.49 3.01
4149 4206 1.386525 CCCATGCCCGATTGGAGTTG 61.387 60.000 0.00 0.00 37.49 3.16
4150 4207 0.680921 CCATGCCCGATTGGAGTTGT 60.681 55.000 0.00 0.00 37.49 3.32
4151 4208 0.452987 CATGCCCGATTGGAGTTGTG 59.547 55.000 0.00 0.00 37.49 3.33
4152 4209 0.680921 ATGCCCGATTGGAGTTGTGG 60.681 55.000 0.00 0.00 37.49 4.17
4153 4210 1.303317 GCCCGATTGGAGTTGTGGT 60.303 57.895 0.00 0.00 37.49 4.16
4154 4211 1.586154 GCCCGATTGGAGTTGTGGTG 61.586 60.000 0.00 0.00 37.49 4.17
4155 4212 0.960364 CCCGATTGGAGTTGTGGTGG 60.960 60.000 0.00 0.00 37.49 4.61
4156 4213 0.250727 CCGATTGGAGTTGTGGTGGT 60.251 55.000 0.00 0.00 37.49 4.16
4157 4214 0.874390 CGATTGGAGTTGTGGTGGTG 59.126 55.000 0.00 0.00 0.00 4.17
4158 4215 1.247567 GATTGGAGTTGTGGTGGTGG 58.752 55.000 0.00 0.00 0.00 4.61
4159 4216 0.850100 ATTGGAGTTGTGGTGGTGGA 59.150 50.000 0.00 0.00 0.00 4.02
4160 4217 0.850100 TTGGAGTTGTGGTGGTGGAT 59.150 50.000 0.00 0.00 0.00 3.41
4161 4218 1.735926 TGGAGTTGTGGTGGTGGATA 58.264 50.000 0.00 0.00 0.00 2.59
4162 4219 2.058705 TGGAGTTGTGGTGGTGGATAA 58.941 47.619 0.00 0.00 0.00 1.75
4163 4220 2.039746 TGGAGTTGTGGTGGTGGATAAG 59.960 50.000 0.00 0.00 0.00 1.73
4164 4221 2.618045 GGAGTTGTGGTGGTGGATAAGG 60.618 54.545 0.00 0.00 0.00 2.69
4165 4222 2.039879 GAGTTGTGGTGGTGGATAAGGT 59.960 50.000 0.00 0.00 0.00 3.50
4166 4223 2.039879 AGTTGTGGTGGTGGATAAGGTC 59.960 50.000 0.00 0.00 0.00 3.85
4167 4224 0.611200 TGTGGTGGTGGATAAGGTCG 59.389 55.000 0.00 0.00 0.00 4.79
4168 4225 0.107848 GTGGTGGTGGATAAGGTCGG 60.108 60.000 0.00 0.00 0.00 4.79
4169 4226 1.268992 TGGTGGTGGATAAGGTCGGG 61.269 60.000 0.00 0.00 0.00 5.14
4170 4227 1.153229 GTGGTGGATAAGGTCGGGC 60.153 63.158 0.00 0.00 0.00 6.13
4171 4228 1.306654 TGGTGGATAAGGTCGGGCT 60.307 57.895 0.00 0.00 0.00 5.19
4172 4229 0.031917 TGGTGGATAAGGTCGGGCTA 60.032 55.000 0.00 0.00 0.00 3.93
4173 4230 0.680061 GGTGGATAAGGTCGGGCTAG 59.320 60.000 0.00 0.00 0.00 3.42
4174 4231 0.033642 GTGGATAAGGTCGGGCTAGC 59.966 60.000 6.04 6.04 0.00 3.42
4175 4232 1.119574 TGGATAAGGTCGGGCTAGCC 61.120 60.000 26.55 26.55 0.00 3.93
4185 4242 4.237207 GGCTAGCCCGCCTACCAC 62.237 72.222 24.19 0.00 46.63 4.16
4186 4243 4.237207 GCTAGCCCGCCTACCACC 62.237 72.222 2.29 0.00 0.00 4.61
4187 4244 2.444140 CTAGCCCGCCTACCACCT 60.444 66.667 0.00 0.00 0.00 4.00
4188 4245 2.762459 TAGCCCGCCTACCACCTG 60.762 66.667 0.00 0.00 0.00 4.00
4191 4248 4.778143 CCCGCCTACCACCTGCAC 62.778 72.222 0.00 0.00 0.00 4.57
4192 4249 4.778143 CCGCCTACCACCTGCACC 62.778 72.222 0.00 0.00 0.00 5.01
4193 4250 4.015406 CGCCTACCACCTGCACCA 62.015 66.667 0.00 0.00 0.00 4.17
4194 4251 2.359975 GCCTACCACCTGCACCAC 60.360 66.667 0.00 0.00 0.00 4.16
4195 4252 2.351276 CCTACCACCTGCACCACC 59.649 66.667 0.00 0.00 0.00 4.61
4196 4253 2.525124 CCTACCACCTGCACCACCA 61.525 63.158 0.00 0.00 0.00 4.17
4197 4254 1.003355 CTACCACCTGCACCACCAG 60.003 63.158 0.00 0.00 0.00 4.00
4198 4255 3.190738 TACCACCTGCACCACCAGC 62.191 63.158 0.00 0.00 0.00 4.85
4199 4256 4.275508 CCACCTGCACCACCAGCT 62.276 66.667 0.00 0.00 0.00 4.24
4200 4257 2.670934 CACCTGCACCACCAGCTC 60.671 66.667 0.00 0.00 0.00 4.09
4201 4258 2.851102 ACCTGCACCACCAGCTCT 60.851 61.111 0.00 0.00 0.00 4.09
4202 4259 2.359602 CCTGCACCACCAGCTCTG 60.360 66.667 0.00 0.00 0.00 3.35
4203 4260 2.429058 CTGCACCACCAGCTCTGT 59.571 61.111 0.00 0.00 0.00 3.41
4204 4261 1.964891 CTGCACCACCAGCTCTGTG 60.965 63.158 6.01 6.01 0.00 3.66
4205 4262 2.670934 GCACCACCAGCTCTGTGG 60.671 66.667 24.10 24.10 44.01 4.17
4206 4263 2.670934 CACCACCAGCTCTGTGGC 60.671 66.667 25.16 0.00 41.90 5.01
4207 4264 2.851102 ACCACCAGCTCTGTGGCT 60.851 61.111 25.16 13.64 41.90 4.75
4208 4265 2.433446 CCACCAGCTCTGTGGCTT 59.567 61.111 16.81 0.00 41.90 4.35
4209 4266 1.673665 CCACCAGCTCTGTGGCTTC 60.674 63.158 16.81 0.00 41.90 3.86
4210 4267 1.673665 CACCAGCTCTGTGGCTTCC 60.674 63.158 5.20 0.00 41.90 3.46
4211 4268 2.149383 ACCAGCTCTGTGGCTTCCA 61.149 57.895 0.00 0.00 41.90 3.53
4212 4269 1.073722 CCAGCTCTGTGGCTTCCAA 59.926 57.895 0.00 0.00 41.00 3.53
4213 4270 1.239968 CCAGCTCTGTGGCTTCCAAC 61.240 60.000 0.00 0.00 41.00 3.77
4214 4271 0.250640 CAGCTCTGTGGCTTCCAACT 60.251 55.000 0.00 0.00 41.00 3.16
4215 4272 0.250640 AGCTCTGTGGCTTCCAACTG 60.251 55.000 0.00 0.00 39.86 3.16
4216 4273 1.860484 GCTCTGTGGCTTCCAACTGC 61.860 60.000 0.00 0.00 34.18 4.40
4221 4278 3.365265 GGCTTCCAACTGCCGTGG 61.365 66.667 0.00 0.00 39.71 4.94
4222 4279 2.281484 GCTTCCAACTGCCGTGGA 60.281 61.111 0.00 0.00 0.00 4.02
4223 4280 1.675641 GCTTCCAACTGCCGTGGAT 60.676 57.895 1.33 0.00 0.00 3.41
4224 4281 1.926511 GCTTCCAACTGCCGTGGATG 61.927 60.000 1.33 5.27 0.00 3.51
4225 4282 1.926511 CTTCCAACTGCCGTGGATGC 61.927 60.000 1.33 0.00 0.00 3.91
4226 4283 3.443045 CCAACTGCCGTGGATGCC 61.443 66.667 0.00 0.00 0.00 4.40
4227 4284 3.443045 CAACTGCCGTGGATGCCC 61.443 66.667 0.00 0.00 0.00 5.36
4230 4287 4.552365 CTGCCGTGGATGCCCGAT 62.552 66.667 0.00 0.00 34.29 4.18
4231 4288 4.108299 TGCCGTGGATGCCCGATT 62.108 61.111 0.00 0.00 34.29 3.34
4232 4289 3.585990 GCCGTGGATGCCCGATTG 61.586 66.667 0.00 0.00 34.29 2.67
4233 4290 2.124736 CCGTGGATGCCCGATTGT 60.125 61.111 0.00 0.00 34.29 2.71
4234 4291 2.472059 CCGTGGATGCCCGATTGTG 61.472 63.158 0.00 0.00 34.29 3.33
4235 4292 1.449423 CGTGGATGCCCGATTGTGA 60.449 57.895 0.00 0.00 34.29 3.58
4236 4293 1.024046 CGTGGATGCCCGATTGTGAA 61.024 55.000 0.00 0.00 34.29 3.18
4237 4294 0.451783 GTGGATGCCCGATTGTGAAC 59.548 55.000 0.00 0.00 34.29 3.18
4238 4295 0.037447 TGGATGCCCGATTGTGAACA 59.963 50.000 0.00 0.00 34.29 3.18
4239 4296 0.734889 GGATGCCCGATTGTGAACAG 59.265 55.000 0.00 0.00 0.00 3.16
4240 4297 1.453155 GATGCCCGATTGTGAACAGT 58.547 50.000 0.00 0.00 0.00 3.55
4241 4298 1.812571 GATGCCCGATTGTGAACAGTT 59.187 47.619 0.00 0.00 0.00 3.16
4242 4299 1.686355 TGCCCGATTGTGAACAGTTT 58.314 45.000 0.00 0.00 0.00 2.66
4243 4300 2.028130 TGCCCGATTGTGAACAGTTTT 58.972 42.857 0.00 0.00 0.00 2.43
4244 4301 2.428890 TGCCCGATTGTGAACAGTTTTT 59.571 40.909 0.00 0.00 0.00 1.94
4245 4302 3.632604 TGCCCGATTGTGAACAGTTTTTA 59.367 39.130 0.00 0.00 0.00 1.52
4246 4303 4.098044 TGCCCGATTGTGAACAGTTTTTAA 59.902 37.500 0.00 0.00 0.00 1.52
4247 4304 4.443063 GCCCGATTGTGAACAGTTTTTAAC 59.557 41.667 0.00 0.00 0.00 2.01
4248 4305 5.583495 CCCGATTGTGAACAGTTTTTAACA 58.417 37.500 0.00 0.00 0.00 2.41
4249 4306 5.685511 CCCGATTGTGAACAGTTTTTAACAG 59.314 40.000 0.00 0.00 0.00 3.16
4250 4307 5.173131 CCGATTGTGAACAGTTTTTAACAGC 59.827 40.000 0.00 0.00 0.00 4.40
4251 4308 5.108780 CGATTGTGAACAGTTTTTAACAGCG 60.109 40.000 0.00 0.00 0.00 5.18
4252 4309 4.688511 TGTGAACAGTTTTTAACAGCGT 57.311 36.364 0.00 0.00 0.00 5.07
4253 4310 4.407818 TGTGAACAGTTTTTAACAGCGTG 58.592 39.130 0.00 0.00 0.00 5.34
4254 4311 4.154375 TGTGAACAGTTTTTAACAGCGTGA 59.846 37.500 0.00 0.00 0.00 4.35
4255 4312 5.090083 GTGAACAGTTTTTAACAGCGTGAA 58.910 37.500 0.00 0.00 0.00 3.18
4256 4313 5.003121 GTGAACAGTTTTTAACAGCGTGAAC 59.997 40.000 0.00 0.00 0.00 3.18
4257 4314 4.688511 ACAGTTTTTAACAGCGTGAACA 57.311 36.364 0.00 0.00 0.00 3.18
4258 4315 5.049398 ACAGTTTTTAACAGCGTGAACAA 57.951 34.783 0.00 0.00 0.00 2.83
4259 4316 5.646606 ACAGTTTTTAACAGCGTGAACAAT 58.353 33.333 0.00 0.00 0.00 2.71
4260 4317 6.096695 ACAGTTTTTAACAGCGTGAACAATT 58.903 32.000 0.00 0.00 0.00 2.32
4261 4318 6.588373 ACAGTTTTTAACAGCGTGAACAATTT 59.412 30.769 0.00 0.00 0.00 1.82
4262 4319 7.117092 ACAGTTTTTAACAGCGTGAACAATTTT 59.883 29.630 0.00 0.00 0.00 1.82
4263 4320 7.954786 CAGTTTTTAACAGCGTGAACAATTTTT 59.045 29.630 0.00 0.00 0.00 1.94
4264 4321 7.954786 AGTTTTTAACAGCGTGAACAATTTTTG 59.045 29.630 0.00 0.00 0.00 2.44
4265 4322 5.957910 TTAACAGCGTGAACAATTTTTGG 57.042 34.783 0.00 0.00 34.12 3.28
4266 4323 2.200899 ACAGCGTGAACAATTTTTGGC 58.799 42.857 0.00 0.00 34.12 4.52
4267 4324 2.159114 ACAGCGTGAACAATTTTTGGCT 60.159 40.909 0.00 0.00 34.12 4.75
4268 4325 2.865551 CAGCGTGAACAATTTTTGGCTT 59.134 40.909 0.00 0.00 34.12 4.35
4269 4326 4.047822 CAGCGTGAACAATTTTTGGCTTA 58.952 39.130 0.00 0.00 34.12 3.09
4270 4327 4.685628 CAGCGTGAACAATTTTTGGCTTAT 59.314 37.500 0.00 0.00 34.12 1.73
4271 4328 5.177327 CAGCGTGAACAATTTTTGGCTTATT 59.823 36.000 0.00 0.00 34.12 1.40
4272 4329 5.757808 AGCGTGAACAATTTTTGGCTTATTT 59.242 32.000 0.00 0.00 34.12 1.40
4273 4330 6.259829 AGCGTGAACAATTTTTGGCTTATTTT 59.740 30.769 0.00 0.00 34.12 1.82
4274 4331 6.909895 GCGTGAACAATTTTTGGCTTATTTTT 59.090 30.769 0.00 0.00 34.12 1.94
4297 4354 9.861138 TTTTTGAAAGAACATGATTTTATTGCG 57.139 25.926 0.00 0.00 0.00 4.85
4298 4355 6.630676 TGAAAGAACATGATTTTATTGCGC 57.369 33.333 0.00 0.00 0.00 6.09
4299 4356 6.155136 TGAAAGAACATGATTTTATTGCGCA 58.845 32.000 5.66 5.66 0.00 6.09
4300 4357 6.644181 TGAAAGAACATGATTTTATTGCGCAA 59.356 30.769 27.24 27.24 0.00 4.85
4301 4358 7.170489 TGAAAGAACATGATTTTATTGCGCAAA 59.830 29.630 28.81 11.29 0.00 3.68
4302 4359 7.599630 AAGAACATGATTTTATTGCGCAAAT 57.400 28.000 28.81 16.20 0.00 2.32
4303 4360 8.700722 AAGAACATGATTTTATTGCGCAAATA 57.299 26.923 28.81 15.18 0.00 1.40
4304 4361 8.876275 AGAACATGATTTTATTGCGCAAATAT 57.124 26.923 28.81 16.94 30.74 1.28
4305 4362 8.757789 AGAACATGATTTTATTGCGCAAATATG 58.242 29.630 28.81 21.86 30.74 1.78
4306 4363 8.645730 AACATGATTTTATTGCGCAAATATGA 57.354 26.923 28.81 12.63 30.74 2.15
4307 4364 8.645730 ACATGATTTTATTGCGCAAATATGAA 57.354 26.923 28.81 16.95 30.74 2.57
4308 4365 8.757789 ACATGATTTTATTGCGCAAATATGAAG 58.242 29.630 28.81 14.23 30.74 3.02
4309 4366 8.970293 CATGATTTTATTGCGCAAATATGAAGA 58.030 29.630 28.81 11.55 30.74 2.87
4310 4367 9.701098 ATGATTTTATTGCGCAAATATGAAGAT 57.299 25.926 28.81 15.40 30.74 2.40
4311 4368 9.531942 TGATTTTATTGCGCAAATATGAAGATT 57.468 25.926 28.81 8.93 30.74 2.40
4318 4375 8.978564 TTGCGCAAATATGAAGATTTTTAGAA 57.021 26.923 22.78 0.00 0.00 2.10
4319 4376 8.978564 TGCGCAAATATGAAGATTTTTAGAAA 57.021 26.923 8.16 0.00 0.00 2.52
4320 4377 8.859156 TGCGCAAATATGAAGATTTTTAGAAAC 58.141 29.630 8.16 0.00 0.00 2.78
4321 4378 8.859156 GCGCAAATATGAAGATTTTTAGAAACA 58.141 29.630 0.30 0.00 0.00 2.83
4327 4384 9.774742 ATATGAAGATTTTTAGAAACAGCGAAC 57.225 29.630 0.00 0.00 0.00 3.95
4328 4385 7.022055 TGAAGATTTTTAGAAACAGCGAACA 57.978 32.000 0.00 0.00 0.00 3.18
4329 4386 7.476667 TGAAGATTTTTAGAAACAGCGAACAA 58.523 30.769 0.00 0.00 0.00 2.83
4330 4387 8.134895 TGAAGATTTTTAGAAACAGCGAACAAT 58.865 29.630 0.00 0.00 0.00 2.71
4331 4388 8.871686 AAGATTTTTAGAAACAGCGAACAATT 57.128 26.923 0.00 0.00 0.00 2.32
4332 4389 8.871686 AGATTTTTAGAAACAGCGAACAATTT 57.128 26.923 0.00 0.00 0.00 1.82
4333 4390 9.313118 AGATTTTTAGAAACAGCGAACAATTTT 57.687 25.926 0.00 0.00 0.00 1.82
4334 4391 9.914923 GATTTTTAGAAACAGCGAACAATTTTT 57.085 25.926 0.00 0.00 0.00 1.94
4335 4392 9.701355 ATTTTTAGAAACAGCGAACAATTTTTG 57.299 25.926 0.00 0.00 0.00 2.44
4336 4393 8.467402 TTTTAGAAACAGCGAACAATTTTTGA 57.533 26.923 0.00 0.00 0.00 2.69
4337 4394 8.467402 TTTAGAAACAGCGAACAATTTTTGAA 57.533 26.923 0.00 0.00 0.00 2.69
4338 4395 6.959671 AGAAACAGCGAACAATTTTTGAAA 57.040 29.167 0.00 0.00 0.00 2.69
4339 4396 7.538303 AGAAACAGCGAACAATTTTTGAAAT 57.462 28.000 0.00 0.00 0.00 2.17
4340 4397 7.401080 AGAAACAGCGAACAATTTTTGAAATG 58.599 30.769 0.00 0.00 0.00 2.32
4341 4398 6.900568 AACAGCGAACAATTTTTGAAATGA 57.099 29.167 0.00 0.00 0.00 2.57
4342 4399 6.272698 ACAGCGAACAATTTTTGAAATGAC 57.727 33.333 0.00 0.00 0.00 3.06
4343 4400 5.051774 ACAGCGAACAATTTTTGAAATGACG 60.052 36.000 0.00 0.00 0.00 4.35
4344 4401 5.172951 CAGCGAACAATTTTTGAAATGACGA 59.827 36.000 0.00 0.00 0.00 4.20
4345 4402 5.746245 AGCGAACAATTTTTGAAATGACGAA 59.254 32.000 0.00 0.00 0.00 3.85
4346 4403 5.833627 GCGAACAATTTTTGAAATGACGAAC 59.166 36.000 0.00 0.00 0.00 3.95
4347 4404 6.507141 GCGAACAATTTTTGAAATGACGAACA 60.507 34.615 0.00 0.00 0.00 3.18
4348 4405 7.554732 CGAACAATTTTTGAAATGACGAACAT 58.445 30.769 0.00 0.00 41.45 2.71
<
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 1.740025 CCGCCTCACATTCTTTCTTCC 59.260 52.381 0.00 0.00 0.00 3.46
1 2 2.675348 CTCCGCCTCACATTCTTTCTTC 59.325 50.000 0.00 0.00 0.00 2.87
2 3 2.303022 TCTCCGCCTCACATTCTTTCTT 59.697 45.455 0.00 0.00 0.00 2.52
3 4 1.902508 TCTCCGCCTCACATTCTTTCT 59.097 47.619 0.00 0.00 0.00 2.52
4 5 2.386661 TCTCCGCCTCACATTCTTTC 57.613 50.000 0.00 0.00 0.00 2.62
5 6 2.427506 GTTCTCCGCCTCACATTCTTT 58.572 47.619 0.00 0.00 0.00 2.52
6 7 1.673033 CGTTCTCCGCCTCACATTCTT 60.673 52.381 0.00 0.00 0.00 2.52
7 8 0.108615 CGTTCTCCGCCTCACATTCT 60.109 55.000 0.00 0.00 0.00 2.40
8 9 0.389948 ACGTTCTCCGCCTCACATTC 60.390 55.000 0.00 0.00 41.42 2.67
9 10 0.034896 AACGTTCTCCGCCTCACATT 59.965 50.000 0.00 0.00 41.42 2.71
10 11 0.034896 AAACGTTCTCCGCCTCACAT 59.965 50.000 0.00 0.00 41.42 3.21
11 12 0.179067 AAAACGTTCTCCGCCTCACA 60.179 50.000 0.00 0.00 41.42 3.58
12 13 0.234884 CAAAACGTTCTCCGCCTCAC 59.765 55.000 0.00 0.00 41.42 3.51
13 14 1.503818 GCAAAACGTTCTCCGCCTCA 61.504 55.000 0.00 0.00 41.42 3.86
14 15 1.206831 GCAAAACGTTCTCCGCCTC 59.793 57.895 0.00 0.00 41.42 4.70
15 16 1.507141 CTGCAAAACGTTCTCCGCCT 61.507 55.000 0.00 0.00 41.42 5.52
16 17 1.082104 CTGCAAAACGTTCTCCGCC 60.082 57.895 0.00 0.00 41.42 6.13
17 18 1.082104 CCTGCAAAACGTTCTCCGC 60.082 57.895 0.00 2.65 41.42 5.54
18 19 0.512952 CTCCTGCAAAACGTTCTCCG 59.487 55.000 0.00 0.00 44.03 4.63
19 20 0.875059 CCTCCTGCAAAACGTTCTCC 59.125 55.000 0.00 0.00 0.00 3.71
20 21 1.878953 TCCTCCTGCAAAACGTTCTC 58.121 50.000 0.00 0.00 0.00 2.87
21 22 2.568623 ATCCTCCTGCAAAACGTTCT 57.431 45.000 0.00 0.00 0.00 3.01
22 23 5.007724 CCTTATATCCTCCTGCAAAACGTTC 59.992 44.000 0.00 0.00 0.00 3.95
23 24 4.881850 CCTTATATCCTCCTGCAAAACGTT 59.118 41.667 0.00 0.00 0.00 3.99
24 25 4.080526 ACCTTATATCCTCCTGCAAAACGT 60.081 41.667 0.00 0.00 0.00 3.99
25 26 4.451900 ACCTTATATCCTCCTGCAAAACG 58.548 43.478 0.00 0.00 0.00 3.60
26 27 7.875327 TTTACCTTATATCCTCCTGCAAAAC 57.125 36.000 0.00 0.00 0.00 2.43
27 28 7.891183 TGTTTTACCTTATATCCTCCTGCAAAA 59.109 33.333 0.00 0.00 0.00 2.44
28 29 7.406916 TGTTTTACCTTATATCCTCCTGCAAA 58.593 34.615 0.00 0.00 0.00 3.68
29 30 6.964464 TGTTTTACCTTATATCCTCCTGCAA 58.036 36.000 0.00 0.00 0.00 4.08
30 31 6.569127 TGTTTTACCTTATATCCTCCTGCA 57.431 37.500 0.00 0.00 0.00 4.41
31 32 6.826741 TGTTGTTTTACCTTATATCCTCCTGC 59.173 38.462 0.00 0.00 0.00 4.85
32 33 8.801882 TTGTTGTTTTACCTTATATCCTCCTG 57.198 34.615 0.00 0.00 0.00 3.86
33 34 8.832735 TCTTGTTGTTTTACCTTATATCCTCCT 58.167 33.333 0.00 0.00 0.00 3.69
34 35 9.457436 TTCTTGTTGTTTTACCTTATATCCTCC 57.543 33.333 0.00 0.00 0.00 4.30
42 43 9.959749 CAGCTTATTTCTTGTTGTTTTACCTTA 57.040 29.630 0.00 0.00 0.00 2.69
43 44 8.691797 TCAGCTTATTTCTTGTTGTTTTACCTT 58.308 29.630 0.00 0.00 0.00 3.50
44 45 8.232913 TCAGCTTATTTCTTGTTGTTTTACCT 57.767 30.769 0.00 0.00 0.00 3.08
45 46 8.865590 TTCAGCTTATTTCTTGTTGTTTTACC 57.134 30.769 0.00 0.00 0.00 2.85
46 47 9.516314 ACTTCAGCTTATTTCTTGTTGTTTTAC 57.484 29.630 0.00 0.00 0.00 2.01
48 49 9.435688 AAACTTCAGCTTATTTCTTGTTGTTTT 57.564 25.926 0.00 0.00 0.00 2.43
49 50 9.087424 GAAACTTCAGCTTATTTCTTGTTGTTT 57.913 29.630 0.00 0.00 0.00 2.83
50 51 8.250332 TGAAACTTCAGCTTATTTCTTGTTGTT 58.750 29.630 9.11 0.00 33.21 2.83
51 52 7.771183 TGAAACTTCAGCTTATTTCTTGTTGT 58.229 30.769 9.11 0.00 33.21 3.32
52 53 8.278482 CTGAAACTTCAGCTTATTTCTTGTTG 57.722 34.615 6.53 0.00 46.97 3.33
67 68 1.667830 CTCGCCGGCTGAAACTTCA 60.668 57.895 26.68 0.00 35.57 3.02
68 69 3.028366 GCTCGCCGGCTGAAACTTC 62.028 63.158 26.68 6.63 0.00 3.01
69 70 3.050275 GCTCGCCGGCTGAAACTT 61.050 61.111 26.68 0.00 0.00 2.66
86 87 2.311688 ATAGTTTCCTGCCGGCGAGG 62.312 60.000 28.82 28.82 44.97 4.63
87 88 0.876342 GATAGTTTCCTGCCGGCGAG 60.876 60.000 23.90 19.37 0.00 5.03
88 89 1.143183 GATAGTTTCCTGCCGGCGA 59.857 57.895 23.90 11.45 0.00 5.54
89 90 1.887707 GGATAGTTTCCTGCCGGCG 60.888 63.158 23.90 16.52 41.78 6.46
90 91 1.526225 GGGATAGTTTCCTGCCGGC 60.526 63.158 22.73 22.73 44.75 6.13
91 92 1.148498 GGGGATAGTTTCCTGCCGG 59.852 63.158 0.00 0.00 44.75 6.13
92 93 1.148498 GGGGGATAGTTTCCTGCCG 59.852 63.158 0.00 0.00 44.75 5.69
93 94 0.927029 AAGGGGGATAGTTTCCTGCC 59.073 55.000 0.00 0.00 44.75 4.85
94 95 3.945640 TTAAGGGGGATAGTTTCCTGC 57.054 47.619 0.00 0.00 44.75 4.85
115 116 4.717280 TCACAATTGGGTGGTTAGGTTTTT 59.283 37.500 7.75 0.00 39.27 1.94
116 117 4.100344 GTCACAATTGGGTGGTTAGGTTTT 59.900 41.667 7.75 0.00 39.27 2.43
117 118 3.639561 GTCACAATTGGGTGGTTAGGTTT 59.360 43.478 7.75 0.00 39.27 3.27
118 119 3.227614 GTCACAATTGGGTGGTTAGGTT 58.772 45.455 7.75 0.00 39.27 3.50
119 120 2.175931 TGTCACAATTGGGTGGTTAGGT 59.824 45.455 7.75 0.00 39.27 3.08
120 121 2.819608 CTGTCACAATTGGGTGGTTAGG 59.180 50.000 7.75 0.00 39.27 2.69
121 122 3.486383 ACTGTCACAATTGGGTGGTTAG 58.514 45.455 7.75 3.19 39.27 2.34
122 123 3.586470 ACTGTCACAATTGGGTGGTTA 57.414 42.857 7.75 0.00 39.27 2.85
123 124 2.452600 ACTGTCACAATTGGGTGGTT 57.547 45.000 7.75 0.00 39.27 3.67
124 125 2.452600 AACTGTCACAATTGGGTGGT 57.547 45.000 7.75 2.59 39.27 4.16
125 126 3.817709 AAAACTGTCACAATTGGGTGG 57.182 42.857 7.75 1.96 39.27 4.61
126 127 3.796178 CGAAAAACTGTCACAATTGGGTG 59.204 43.478 7.75 0.00 40.16 4.61
127 128 3.736740 GCGAAAAACTGTCACAATTGGGT 60.737 43.478 7.75 0.00 0.00 4.51
128 129 2.794350 GCGAAAAACTGTCACAATTGGG 59.206 45.455 10.83 5.72 0.00 4.12
129 130 3.705604 AGCGAAAAACTGTCACAATTGG 58.294 40.909 10.83 0.00 0.00 3.16
130 131 5.914635 ACATAGCGAAAAACTGTCACAATTG 59.085 36.000 3.24 3.24 0.00 2.32
131 132 6.072112 ACATAGCGAAAAACTGTCACAATT 57.928 33.333 0.00 0.00 0.00 2.32
132 133 5.689383 ACATAGCGAAAAACTGTCACAAT 57.311 34.783 0.00 0.00 0.00 2.71
133 134 5.756347 AGTACATAGCGAAAAACTGTCACAA 59.244 36.000 0.00 0.00 0.00 3.33
134 135 5.294356 AGTACATAGCGAAAAACTGTCACA 58.706 37.500 0.00 0.00 0.00 3.58
135 136 5.163982 GGAGTACATAGCGAAAAACTGTCAC 60.164 44.000 0.00 0.00 0.00 3.67
136 137 4.927425 GGAGTACATAGCGAAAAACTGTCA 59.073 41.667 0.00 0.00 0.00 3.58
137 138 5.169295 AGGAGTACATAGCGAAAAACTGTC 58.831 41.667 0.00 0.00 0.00 3.51
138 139 5.148651 AGGAGTACATAGCGAAAAACTGT 57.851 39.130 0.00 0.00 0.00 3.55
139 140 4.567159 GGAGGAGTACATAGCGAAAAACTG 59.433 45.833 0.00 0.00 0.00 3.16
140 141 4.222145 TGGAGGAGTACATAGCGAAAAACT 59.778 41.667 0.00 0.00 0.00 2.66
141 142 4.501071 TGGAGGAGTACATAGCGAAAAAC 58.499 43.478 0.00 0.00 0.00 2.43
142 143 4.811969 TGGAGGAGTACATAGCGAAAAA 57.188 40.909 0.00 0.00 0.00 1.94
143 144 4.649674 AGATGGAGGAGTACATAGCGAAAA 59.350 41.667 0.00 0.00 0.00 2.29
144 145 4.215908 AGATGGAGGAGTACATAGCGAAA 58.784 43.478 0.00 0.00 0.00 3.46
145 146 3.833732 AGATGGAGGAGTACATAGCGAA 58.166 45.455 0.00 0.00 0.00 4.70
146 147 3.510531 AGATGGAGGAGTACATAGCGA 57.489 47.619 0.00 0.00 0.00 4.93
147 148 3.570125 TGAAGATGGAGGAGTACATAGCG 59.430 47.826 0.00 0.00 0.00 4.26
148 149 5.244851 TGATGAAGATGGAGGAGTACATAGC 59.755 44.000 0.00 0.00 0.00 2.97
149 150 6.493115 ACTGATGAAGATGGAGGAGTACATAG 59.507 42.308 0.00 0.00 0.00 2.23
150 151 6.266330 CACTGATGAAGATGGAGGAGTACATA 59.734 42.308 0.00 0.00 0.00 2.29
151 152 5.070180 CACTGATGAAGATGGAGGAGTACAT 59.930 44.000 0.00 0.00 0.00 2.29
152 153 4.403752 CACTGATGAAGATGGAGGAGTACA 59.596 45.833 0.00 0.00 0.00 2.90
153 154 4.646945 TCACTGATGAAGATGGAGGAGTAC 59.353 45.833 0.00 0.00 0.00 2.73
154 155 4.871822 TCACTGATGAAGATGGAGGAGTA 58.128 43.478 0.00 0.00 0.00 2.59
155 156 3.717576 TCACTGATGAAGATGGAGGAGT 58.282 45.455 0.00 0.00 0.00 3.85
156 157 4.750021 TTCACTGATGAAGATGGAGGAG 57.250 45.455 0.00 0.00 40.01 3.69
157 158 5.397221 GGATTTCACTGATGAAGATGGAGGA 60.397 44.000 0.00 0.00 45.54 3.71
158 159 4.820716 GGATTTCACTGATGAAGATGGAGG 59.179 45.833 0.00 0.00 45.54 4.30
159 160 5.434408 TGGATTTCACTGATGAAGATGGAG 58.566 41.667 0.00 0.00 45.54 3.86
160 161 5.434408 CTGGATTTCACTGATGAAGATGGA 58.566 41.667 0.00 0.00 45.54 3.41
161 162 4.036498 GCTGGATTTCACTGATGAAGATGG 59.964 45.833 0.00 0.00 45.54 3.51
162 163 4.638865 TGCTGGATTTCACTGATGAAGATG 59.361 41.667 0.00 0.00 45.54 2.90
163 164 4.851843 TGCTGGATTTCACTGATGAAGAT 58.148 39.130 0.00 0.00 45.54 2.40
164 165 4.290711 TGCTGGATTTCACTGATGAAGA 57.709 40.909 0.00 0.00 45.54 2.87
165 166 4.670992 CGTTGCTGGATTTCACTGATGAAG 60.671 45.833 0.00 0.00 45.54 3.02
166 167 3.189080 CGTTGCTGGATTTCACTGATGAA 59.811 43.478 0.00 0.00 43.28 2.57
167 168 2.743664 CGTTGCTGGATTTCACTGATGA 59.256 45.455 0.00 0.00 0.00 2.92
168 169 2.485426 ACGTTGCTGGATTTCACTGATG 59.515 45.455 0.00 0.00 0.00 3.07
169 170 2.783135 ACGTTGCTGGATTTCACTGAT 58.217 42.857 0.00 0.00 0.00 2.90
170 171 2.254546 ACGTTGCTGGATTTCACTGA 57.745 45.000 0.00 0.00 0.00 3.41
171 172 2.159627 GGTACGTTGCTGGATTTCACTG 59.840 50.000 0.00 0.00 0.00 3.66
172 173 2.423577 GGTACGTTGCTGGATTTCACT 58.576 47.619 0.00 0.00 0.00 3.41
173 174 2.894307 GGTACGTTGCTGGATTTCAC 57.106 50.000 0.00 0.00 0.00 3.18
187 188 8.664883 TTTCTTGACGAAAAAGCATCGGTACG 62.665 42.308 0.00 0.00 46.06 3.67
188 189 3.430895 TCTTGACGAAAAAGCATCGGTAC 59.569 43.478 0.00 0.00 44.32 3.34
189 190 3.655486 TCTTGACGAAAAAGCATCGGTA 58.345 40.909 0.00 0.00 44.32 4.02
190 191 2.489971 TCTTGACGAAAAAGCATCGGT 58.510 42.857 0.00 0.00 44.32 4.69
191 192 3.536158 TTCTTGACGAAAAAGCATCGG 57.464 42.857 0.00 0.00 44.32 4.18
204 205 2.488153 CCCATCCCGTCTTTTTCTTGAC 59.512 50.000 0.00 0.00 0.00 3.18
205 206 2.107552 ACCCATCCCGTCTTTTTCTTGA 59.892 45.455 0.00 0.00 0.00 3.02
206 207 2.488153 GACCCATCCCGTCTTTTTCTTG 59.512 50.000 0.00 0.00 0.00 3.02
207 208 2.554564 GGACCCATCCCGTCTTTTTCTT 60.555 50.000 0.00 0.00 39.39 2.52
208 209 1.004394 GGACCCATCCCGTCTTTTTCT 59.996 52.381 0.00 0.00 39.39 2.52
209 210 1.271707 TGGACCCATCCCGTCTTTTTC 60.272 52.381 0.00 0.00 45.59 2.29
210 211 0.774908 TGGACCCATCCCGTCTTTTT 59.225 50.000 0.00 0.00 45.59 1.94
211 212 0.328258 CTGGACCCATCCCGTCTTTT 59.672 55.000 0.00 0.00 45.59 2.27
212 213 0.546747 TCTGGACCCATCCCGTCTTT 60.547 55.000 0.00 0.00 45.59 2.52
213 214 0.326618 ATCTGGACCCATCCCGTCTT 60.327 55.000 0.00 0.00 45.59 3.01
214 215 1.050988 CATCTGGACCCATCCCGTCT 61.051 60.000 0.00 0.00 45.59 4.18
215 216 1.048724 TCATCTGGACCCATCCCGTC 61.049 60.000 0.00 0.00 45.59 4.79
216 217 1.002921 TCATCTGGACCCATCCCGT 59.997 57.895 0.00 0.00 45.59 5.28
217 218 1.337384 TGTCATCTGGACCCATCCCG 61.337 60.000 0.00 0.00 46.38 5.14
218 219 1.143813 ATGTCATCTGGACCCATCCC 58.856 55.000 0.00 0.00 46.38 3.85
219 220 3.843027 AGATATGTCATCTGGACCCATCC 59.157 47.826 0.00 0.00 46.38 3.51
220 221 5.481824 TGTAGATATGTCATCTGGACCCATC 59.518 44.000 0.00 0.00 46.38 3.51
221 222 5.406163 TGTAGATATGTCATCTGGACCCAT 58.594 41.667 0.00 0.00 46.38 4.00
222 223 4.814967 TGTAGATATGTCATCTGGACCCA 58.185 43.478 0.00 0.00 46.38 4.51
223 224 6.014242 TCAATGTAGATATGTCATCTGGACCC 60.014 42.308 0.00 0.00 46.38 4.46
224 225 6.997655 TCAATGTAGATATGTCATCTGGACC 58.002 40.000 0.00 0.00 46.38 4.46
236 237 9.770097 CCACAACTGACTATTCAATGTAGATAT 57.230 33.333 2.20 0.00 32.64 1.63
237 238 7.710907 GCCACAACTGACTATTCAATGTAGATA 59.289 37.037 2.20 0.00 32.64 1.98
238 239 6.540189 GCCACAACTGACTATTCAATGTAGAT 59.460 38.462 2.20 0.00 32.64 1.98
239 240 5.874810 GCCACAACTGACTATTCAATGTAGA 59.125 40.000 2.20 0.00 32.64 2.59
240 241 5.220472 CGCCACAACTGACTATTCAATGTAG 60.220 44.000 2.20 0.00 32.64 2.74
241 242 4.629634 CGCCACAACTGACTATTCAATGTA 59.370 41.667 2.20 0.00 32.64 2.29
242 243 3.436704 CGCCACAACTGACTATTCAATGT 59.563 43.478 0.00 0.00 33.97 2.71
243 244 3.181507 CCGCCACAACTGACTATTCAATG 60.182 47.826 0.00 0.00 0.00 2.82
244 245 3.009723 CCGCCACAACTGACTATTCAAT 58.990 45.455 0.00 0.00 0.00 2.57
245 246 2.422597 CCGCCACAACTGACTATTCAA 58.577 47.619 0.00 0.00 0.00 2.69
246 247 1.943968 GCCGCCACAACTGACTATTCA 60.944 52.381 0.00 0.00 0.00 2.57
247 248 0.727398 GCCGCCACAACTGACTATTC 59.273 55.000 0.00 0.00 0.00 1.75
248 249 0.036164 TGCCGCCACAACTGACTATT 59.964 50.000 0.00 0.00 0.00 1.73
249 250 0.673644 GTGCCGCCACAACTGACTAT 60.674 55.000 0.00 0.00 41.67 2.12
250 251 1.301401 GTGCCGCCACAACTGACTA 60.301 57.895 0.00 0.00 41.67 2.59
251 252 2.591715 GTGCCGCCACAACTGACT 60.592 61.111 0.00 0.00 41.67 3.41
259 260 0.100503 GGTTAATCATGTGCCGCCAC 59.899 55.000 0.00 0.00 42.40 5.01
260 261 1.372838 CGGTTAATCATGTGCCGCCA 61.373 55.000 0.00 0.00 35.90 5.69
261 262 1.355210 CGGTTAATCATGTGCCGCC 59.645 57.895 0.00 0.00 35.90 6.13
262 263 0.027586 GACGGTTAATCATGTGCCGC 59.972 55.000 12.96 0.00 45.53 6.53
263 264 1.651987 AGACGGTTAATCATGTGCCG 58.348 50.000 11.98 11.98 46.83 5.69
264 265 3.936453 TGTAAGACGGTTAATCATGTGCC 59.064 43.478 0.00 0.00 0.00 5.01
265 266 5.734855 ATGTAAGACGGTTAATCATGTGC 57.265 39.130 0.00 0.00 0.00 4.57
266 267 7.302350 TGAATGTAAGACGGTTAATCATGTG 57.698 36.000 0.00 0.00 0.00 3.21
267 268 7.915293 TTGAATGTAAGACGGTTAATCATGT 57.085 32.000 0.00 0.00 0.00 3.21
268 269 9.787532 ATTTTGAATGTAAGACGGTTAATCATG 57.212 29.630 0.00 0.00 0.00 3.07
275 276 9.620660 GTCAAATATTTTGAATGTAAGACGGTT 57.379 29.630 0.00 0.00 0.00 4.44
276 277 7.960738 CGTCAAATATTTTGAATGTAAGACGGT 59.039 33.333 17.38 0.00 39.91 4.83
277 278 8.172484 TCGTCAAATATTTTGAATGTAAGACGG 58.828 33.333 21.52 10.65 42.70 4.79
278 279 8.985694 GTCGTCAAATATTTTGAATGTAAGACG 58.014 33.333 18.37 18.37 43.50 4.18
279 280 9.820229 TGTCGTCAAATATTTTGAATGTAAGAC 57.180 29.630 0.00 0.00 0.00 3.01
284 285 8.914654 CACAATGTCGTCAAATATTTTGAATGT 58.085 29.630 0.00 2.00 0.00 2.71
285 286 8.914654 ACACAATGTCGTCAAATATTTTGAATG 58.085 29.630 0.00 1.75 0.00 2.67
286 287 8.914654 CACACAATGTCGTCAAATATTTTGAAT 58.085 29.630 0.00 0.00 0.00 2.57
287 288 8.131731 TCACACAATGTCGTCAAATATTTTGAA 58.868 29.630 0.00 0.00 0.00 2.69
288 289 7.643579 TCACACAATGTCGTCAAATATTTTGA 58.356 30.769 0.00 0.00 0.00 2.69
289 290 7.850268 TCACACAATGTCGTCAAATATTTTG 57.150 32.000 0.00 0.00 0.00 2.44
290 291 8.296000 TGATCACACAATGTCGTCAAATATTTT 58.704 29.630 0.00 0.00 0.00 1.82
291 292 7.815641 TGATCACACAATGTCGTCAAATATTT 58.184 30.769 0.00 0.00 0.00 1.40
292 293 7.376435 TGATCACACAATGTCGTCAAATATT 57.624 32.000 0.00 0.00 0.00 1.28
293 294 6.983474 TGATCACACAATGTCGTCAAATAT 57.017 33.333 0.00 0.00 0.00 1.28
294 295 6.793492 TTGATCACACAATGTCGTCAAATA 57.207 33.333 0.00 0.00 31.79 1.40
295 296 5.687770 TTGATCACACAATGTCGTCAAAT 57.312 34.783 0.00 0.00 31.79 2.32
296 297 5.491635 TTTGATCACACAATGTCGTCAAA 57.508 34.783 0.00 11.40 37.90 2.69
297 298 5.491635 TTTTGATCACACAATGTCGTCAA 57.508 34.783 0.00 2.88 32.43 3.18
298 299 4.554526 GCTTTTGATCACACAATGTCGTCA 60.555 41.667 0.00 0.00 0.00 4.35
299 300 3.908382 GCTTTTGATCACACAATGTCGTC 59.092 43.478 0.00 0.00 0.00 4.20
300 301 3.565482 AGCTTTTGATCACACAATGTCGT 59.435 39.130 0.00 0.00 0.00 4.34
301 302 4.083643 AGAGCTTTTGATCACACAATGTCG 60.084 41.667 0.00 0.00 37.30 4.35
302 303 5.152097 CAGAGCTTTTGATCACACAATGTC 58.848 41.667 0.00 0.00 37.30 3.06
303 304 4.022589 CCAGAGCTTTTGATCACACAATGT 60.023 41.667 0.00 0.00 37.30 2.71
304 305 4.216902 TCCAGAGCTTTTGATCACACAATG 59.783 41.667 0.00 0.00 37.30 2.82
305 306 4.217118 GTCCAGAGCTTTTGATCACACAAT 59.783 41.667 0.00 0.00 37.30 2.71
306 307 3.565482 GTCCAGAGCTTTTGATCACACAA 59.435 43.478 0.00 0.00 37.30 3.33
307 308 3.141398 GTCCAGAGCTTTTGATCACACA 58.859 45.455 0.00 0.00 37.30 3.72
308 309 3.141398 TGTCCAGAGCTTTTGATCACAC 58.859 45.455 0.00 0.00 37.30 3.82
309 310 3.490439 TGTCCAGAGCTTTTGATCACA 57.510 42.857 0.00 0.00 37.30 3.58
310 311 3.565482 TGTTGTCCAGAGCTTTTGATCAC 59.435 43.478 0.00 0.00 37.30 3.06
311 312 3.819368 TGTTGTCCAGAGCTTTTGATCA 58.181 40.909 0.00 0.00 37.30 2.92
312 313 6.500684 TTATGTTGTCCAGAGCTTTTGATC 57.499 37.500 0.00 0.00 34.56 2.92
313 314 6.899393 TTTATGTTGTCCAGAGCTTTTGAT 57.101 33.333 0.00 0.00 0.00 2.57
314 315 6.096141 TGTTTTATGTTGTCCAGAGCTTTTGA 59.904 34.615 0.00 0.00 0.00 2.69
315 316 6.272318 TGTTTTATGTTGTCCAGAGCTTTTG 58.728 36.000 0.00 0.00 0.00 2.44
316 317 6.463995 TGTTTTATGTTGTCCAGAGCTTTT 57.536 33.333 0.00 0.00 0.00 2.27
317 318 6.321181 TCTTGTTTTATGTTGTCCAGAGCTTT 59.679 34.615 0.00 0.00 0.00 3.51
318 319 5.827797 TCTTGTTTTATGTTGTCCAGAGCTT 59.172 36.000 0.00 0.00 0.00 3.74
319 320 5.376625 TCTTGTTTTATGTTGTCCAGAGCT 58.623 37.500 0.00 0.00 0.00 4.09
320 321 5.335191 CCTCTTGTTTTATGTTGTCCAGAGC 60.335 44.000 0.00 0.00 0.00 4.09
321 322 5.182001 CCCTCTTGTTTTATGTTGTCCAGAG 59.818 44.000 0.00 0.00 0.00 3.35
322 323 5.070001 CCCTCTTGTTTTATGTTGTCCAGA 58.930 41.667 0.00 0.00 0.00 3.86
323 324 4.827284 ACCCTCTTGTTTTATGTTGTCCAG 59.173 41.667 0.00 0.00 0.00 3.86
324 325 4.798882 ACCCTCTTGTTTTATGTTGTCCA 58.201 39.130 0.00 0.00 0.00 4.02
325 326 4.217767 GGACCCTCTTGTTTTATGTTGTCC 59.782 45.833 0.00 0.00 32.64 4.02
326 327 5.048713 CAGGACCCTCTTGTTTTATGTTGTC 60.049 44.000 0.00 0.00 0.00 3.18
327 328 4.827284 CAGGACCCTCTTGTTTTATGTTGT 59.173 41.667 0.00 0.00 0.00 3.32
328 329 5.048713 GTCAGGACCCTCTTGTTTTATGTTG 60.049 44.000 0.00 0.00 0.00 3.33
329 330 5.070685 GTCAGGACCCTCTTGTTTTATGTT 58.929 41.667 0.00 0.00 0.00 2.71
330 331 4.506802 GGTCAGGACCCTCTTGTTTTATGT 60.507 45.833 7.24 0.00 45.68 2.29
331 332 4.010349 GGTCAGGACCCTCTTGTTTTATG 58.990 47.826 7.24 0.00 45.68 1.90
332 333 4.302559 GGTCAGGACCCTCTTGTTTTAT 57.697 45.455 7.24 0.00 45.68 1.40
333 334 3.782656 GGTCAGGACCCTCTTGTTTTA 57.217 47.619 7.24 0.00 45.68 1.52
334 335 2.658807 GGTCAGGACCCTCTTGTTTT 57.341 50.000 7.24 0.00 45.68 2.43
347 348 0.804989 GCTTTGTCATTCCGGTCAGG 59.195 55.000 0.00 0.00 42.97 3.86
348 349 1.522668 TGCTTTGTCATTCCGGTCAG 58.477 50.000 0.00 0.00 0.00 3.51
349 350 2.198827 ATGCTTTGTCATTCCGGTCA 57.801 45.000 0.00 0.00 0.00 4.02
350 351 3.689649 ACTTATGCTTTGTCATTCCGGTC 59.310 43.478 0.00 0.00 0.00 4.79
351 352 3.686016 ACTTATGCTTTGTCATTCCGGT 58.314 40.909 0.00 0.00 0.00 5.28
352 353 4.701956 AACTTATGCTTTGTCATTCCGG 57.298 40.909 0.00 0.00 0.00 5.14
353 354 6.662414 TCTAACTTATGCTTTGTCATTCCG 57.338 37.500 0.00 0.00 0.00 4.30
354 355 6.969473 GCTTCTAACTTATGCTTTGTCATTCC 59.031 38.462 0.00 0.00 0.00 3.01
355 356 7.756558 AGCTTCTAACTTATGCTTTGTCATTC 58.243 34.615 0.00 0.00 0.00 2.67
356 357 7.693969 AGCTTCTAACTTATGCTTTGTCATT 57.306 32.000 0.00 0.00 0.00 2.57
357 358 7.693969 AAGCTTCTAACTTATGCTTTGTCAT 57.306 32.000 0.00 0.00 40.51 3.06
358 359 8.792830 ATAAGCTTCTAACTTATGCTTTGTCA 57.207 30.769 0.00 0.00 42.81 3.58
369 370 9.482627 GTGCAGTCATATATAAGCTTCTAACTT 57.517 33.333 0.00 0.00 0.00 2.66
370 371 8.091449 GGTGCAGTCATATATAAGCTTCTAACT 58.909 37.037 0.00 0.00 0.00 2.24
371 372 7.872993 TGGTGCAGTCATATATAAGCTTCTAAC 59.127 37.037 0.00 0.00 0.00 2.34
372 373 7.962441 TGGTGCAGTCATATATAAGCTTCTAA 58.038 34.615 0.00 0.00 0.00 2.10
373 374 7.539034 TGGTGCAGTCATATATAAGCTTCTA 57.461 36.000 0.00 0.00 0.00 2.10
374 375 6.425210 TGGTGCAGTCATATATAAGCTTCT 57.575 37.500 0.00 0.00 0.00 2.85
375 376 6.708054 AGTTGGTGCAGTCATATATAAGCTTC 59.292 38.462 0.00 0.00 0.00 3.86
376 377 6.595682 AGTTGGTGCAGTCATATATAAGCTT 58.404 36.000 3.48 3.48 0.00 3.74
377 378 6.179906 AGTTGGTGCAGTCATATATAAGCT 57.820 37.500 0.00 0.00 0.00 3.74
378 379 6.867662 AAGTTGGTGCAGTCATATATAAGC 57.132 37.500 0.00 0.00 0.00 3.09
382 383 9.632638 AAGAATAAAGTTGGTGCAGTCATATAT 57.367 29.630 0.00 0.00 0.00 0.86
384 385 7.944729 AAGAATAAAGTTGGTGCAGTCATAT 57.055 32.000 0.00 0.00 0.00 1.78
385 386 8.856153 TTAAGAATAAAGTTGGTGCAGTCATA 57.144 30.769 0.00 0.00 0.00 2.15
386 387 7.759489 TTAAGAATAAAGTTGGTGCAGTCAT 57.241 32.000 0.00 0.00 0.00 3.06
387 388 7.575414 TTTAAGAATAAAGTTGGTGCAGTCA 57.425 32.000 0.00 0.00 0.00 3.41
388 389 8.296713 TGATTTAAGAATAAAGTTGGTGCAGTC 58.703 33.333 0.00 0.00 34.62 3.51
389 390 8.177119 TGATTTAAGAATAAAGTTGGTGCAGT 57.823 30.769 0.00 0.00 34.62 4.40
390 391 9.474920 TTTGATTTAAGAATAAAGTTGGTGCAG 57.525 29.630 0.00 0.00 34.62 4.41
391 392 9.474920 CTTTGATTTAAGAATAAAGTTGGTGCA 57.525 29.630 0.00 0.00 34.62 4.57
392 393 8.435430 GCTTTGATTTAAGAATAAAGTTGGTGC 58.565 33.333 0.00 0.00 34.62 5.01
393 394 9.474920 TGCTTTGATTTAAGAATAAAGTTGGTG 57.525 29.630 0.00 0.00 34.62 4.17
394 395 9.696917 CTGCTTTGATTTAAGAATAAAGTTGGT 57.303 29.630 0.00 0.00 34.62 3.67
395 396 8.650714 GCTGCTTTGATTTAAGAATAAAGTTGG 58.349 33.333 0.00 0.00 34.62 3.77
396 397 9.195411 TGCTGCTTTGATTTAAGAATAAAGTTG 57.805 29.630 0.00 0.00 34.62 3.16
397 398 9.933723 ATGCTGCTTTGATTTAAGAATAAAGTT 57.066 25.926 0.00 0.00 34.62 2.66
398 399 9.362539 CATGCTGCTTTGATTTAAGAATAAAGT 57.637 29.630 0.00 0.00 34.62 2.66
399 400 8.325997 GCATGCTGCTTTGATTTAAGAATAAAG 58.674 33.333 11.37 0.00 40.96 1.85
400 401 8.188531 GCATGCTGCTTTGATTTAAGAATAAA 57.811 30.769 11.37 0.00 40.96 1.40
401 402 7.760131 GCATGCTGCTTTGATTTAAGAATAA 57.240 32.000 11.37 0.00 40.96 1.40
421 422 3.430895 CAGCCAAAAGTTAAAGCAGCATG 59.569 43.478 0.00 0.00 40.87 4.06
422 423 3.555586 CCAGCCAAAAGTTAAAGCAGCAT 60.556 43.478 0.00 0.00 0.00 3.79
423 424 2.224018 CCAGCCAAAAGTTAAAGCAGCA 60.224 45.455 0.00 0.00 0.00 4.41
424 425 2.407090 CCAGCCAAAAGTTAAAGCAGC 58.593 47.619 0.00 0.00 0.00 5.25
425 426 2.407090 GCCAGCCAAAAGTTAAAGCAG 58.593 47.619 0.00 0.00 0.00 4.24
426 427 1.069978 GGCCAGCCAAAAGTTAAAGCA 59.930 47.619 3.12 0.00 35.81 3.91
427 428 1.344438 AGGCCAGCCAAAAGTTAAAGC 59.656 47.619 12.03 0.00 38.92 3.51
428 429 3.751479 AAGGCCAGCCAAAAGTTAAAG 57.249 42.857 12.03 0.00 38.92 1.85
429 430 3.802866 CAAAGGCCAGCCAAAAGTTAAA 58.197 40.909 12.03 0.00 38.92 1.52
430 431 2.484594 GCAAAGGCCAGCCAAAAGTTAA 60.485 45.455 12.03 0.00 38.92 2.01
431 432 1.069978 GCAAAGGCCAGCCAAAAGTTA 59.930 47.619 12.03 0.00 38.92 2.24
432 433 0.179048 GCAAAGGCCAGCCAAAAGTT 60.179 50.000 12.03 0.00 38.92 2.66
433 434 1.447217 GCAAAGGCCAGCCAAAAGT 59.553 52.632 12.03 0.00 38.92 2.66
434 435 4.366603 GCAAAGGCCAGCCAAAAG 57.633 55.556 12.03 0.00 38.92 2.27
450 451 3.671702 GCTCTTACATTCACTGCAAAGGC 60.672 47.826 0.00 0.00 41.68 4.35
451 452 3.425359 CGCTCTTACATTCACTGCAAAGG 60.425 47.826 0.00 0.00 0.00 3.11
452 453 3.740590 CGCTCTTACATTCACTGCAAAG 58.259 45.455 0.00 0.00 0.00 2.77
453 454 2.095768 GCGCTCTTACATTCACTGCAAA 60.096 45.455 0.00 0.00 0.00 3.68
454 455 1.464608 GCGCTCTTACATTCACTGCAA 59.535 47.619 0.00 0.00 0.00 4.08
455 456 1.078709 GCGCTCTTACATTCACTGCA 58.921 50.000 0.00 0.00 0.00 4.41
456 457 1.078709 TGCGCTCTTACATTCACTGC 58.921 50.000 9.73 0.00 0.00 4.40
457 458 2.931969 TGATGCGCTCTTACATTCACTG 59.068 45.455 9.73 0.00 0.00 3.66
458 459 3.251479 TGATGCGCTCTTACATTCACT 57.749 42.857 9.73 0.00 0.00 3.41
459 460 4.272018 AGATTGATGCGCTCTTACATTCAC 59.728 41.667 9.73 0.00 0.00 3.18
460 461 4.445453 AGATTGATGCGCTCTTACATTCA 58.555 39.130 9.73 0.00 0.00 2.57
461 462 6.530913 TTAGATTGATGCGCTCTTACATTC 57.469 37.500 9.73 7.60 0.00 2.67
462 463 6.933521 AGATTAGATTGATGCGCTCTTACATT 59.066 34.615 9.73 0.00 0.00 2.71
463 464 6.462500 AGATTAGATTGATGCGCTCTTACAT 58.538 36.000 9.73 0.00 0.00 2.29
464 465 5.847304 AGATTAGATTGATGCGCTCTTACA 58.153 37.500 9.73 0.00 0.00 2.41
465 466 6.777526 AAGATTAGATTGATGCGCTCTTAC 57.222 37.500 9.73 0.00 0.00 2.34
466 467 6.763135 ACAAAGATTAGATTGATGCGCTCTTA 59.237 34.615 9.73 0.00 0.00 2.10
467 468 5.587844 ACAAAGATTAGATTGATGCGCTCTT 59.412 36.000 9.73 1.78 0.00 2.85
468 469 5.121811 ACAAAGATTAGATTGATGCGCTCT 58.878 37.500 9.73 4.98 0.00 4.09
469 470 5.415415 ACAAAGATTAGATTGATGCGCTC 57.585 39.130 9.73 4.27 0.00 5.03
470 471 4.274459 GGACAAAGATTAGATTGATGCGCT 59.726 41.667 9.73 0.00 0.00 5.92
471 472 4.035558 TGGACAAAGATTAGATTGATGCGC 59.964 41.667 0.00 0.00 0.00 6.09
472 473 5.277683 CCTGGACAAAGATTAGATTGATGCG 60.278 44.000 0.00 0.00 0.00 4.73
473 474 5.824624 TCCTGGACAAAGATTAGATTGATGC 59.175 40.000 0.00 0.00 0.00 3.91
474 475 7.278135 TCTCCTGGACAAAGATTAGATTGATG 58.722 38.462 0.00 0.00 0.00 3.07
475 476 7.443302 TCTCCTGGACAAAGATTAGATTGAT 57.557 36.000 0.00 0.00 0.00 2.57
476 477 6.874278 TCTCCTGGACAAAGATTAGATTGA 57.126 37.500 0.00 0.00 0.00 2.57
477 478 7.052873 ACATCTCCTGGACAAAGATTAGATTG 58.947 38.462 0.00 0.00 0.00 2.67
478 479 7.205515 ACATCTCCTGGACAAAGATTAGATT 57.794 36.000 0.00 0.00 0.00 2.40
479 480 6.821616 ACATCTCCTGGACAAAGATTAGAT 57.178 37.500 0.00 0.00 0.00 1.98
480 481 6.667848 TGTACATCTCCTGGACAAAGATTAGA 59.332 38.462 0.00 0.00 46.02 2.10
481 482 6.878317 TGTACATCTCCTGGACAAAGATTAG 58.122 40.000 0.00 0.00 46.02 1.73
482 483 6.867519 TGTACATCTCCTGGACAAAGATTA 57.132 37.500 0.00 0.00 46.02 1.75
483 484 5.762179 TGTACATCTCCTGGACAAAGATT 57.238 39.130 0.00 0.00 46.02 2.40
490 491 4.003648 CCAAACTTGTACATCTCCTGGAC 58.996 47.826 0.00 0.00 39.39 4.02
491 492 3.907474 TCCAAACTTGTACATCTCCTGGA 59.093 43.478 0.00 3.36 0.00 3.86
492 493 4.286297 TCCAAACTTGTACATCTCCTGG 57.714 45.455 0.00 0.86 0.00 4.45
493 494 4.637534 CCATCCAAACTTGTACATCTCCTG 59.362 45.833 0.00 0.00 0.00 3.86
494 495 4.848357 CCATCCAAACTTGTACATCTCCT 58.152 43.478 0.00 0.00 0.00 3.69
495 496 3.378427 GCCATCCAAACTTGTACATCTCC 59.622 47.826 0.00 0.00 0.00 3.71
496 497 3.378427 GGCCATCCAAACTTGTACATCTC 59.622 47.826 0.00 0.00 0.00 2.75
497 498 3.356290 GGCCATCCAAACTTGTACATCT 58.644 45.455 0.00 0.00 0.00 2.90
498 499 2.097466 CGGCCATCCAAACTTGTACATC 59.903 50.000 2.24 0.00 0.00 3.06
499 500 2.091541 CGGCCATCCAAACTTGTACAT 58.908 47.619 2.24 0.00 0.00 2.29
500 501 1.202830 ACGGCCATCCAAACTTGTACA 60.203 47.619 2.24 0.00 0.00 2.90
501 502 1.530323 ACGGCCATCCAAACTTGTAC 58.470 50.000 2.24 0.00 0.00 2.90
502 503 3.275143 CATACGGCCATCCAAACTTGTA 58.725 45.455 2.24 0.00 0.00 2.41
503 504 2.091541 CATACGGCCATCCAAACTTGT 58.908 47.619 2.24 0.00 0.00 3.16
504 505 1.202290 GCATACGGCCATCCAAACTTG 60.202 52.381 2.24 0.00 36.11 3.16
505 506 1.102978 GCATACGGCCATCCAAACTT 58.897 50.000 2.24 0.00 36.11 2.66
506 507 0.034574 TGCATACGGCCATCCAAACT 60.035 50.000 2.24 0.00 43.89 2.66
507 508 1.001378 GATGCATACGGCCATCCAAAC 60.001 52.381 2.24 0.00 43.89 2.93
508 509 1.317613 GATGCATACGGCCATCCAAA 58.682 50.000 2.24 0.00 43.89 3.28
509 510 0.884259 CGATGCATACGGCCATCCAA 60.884 55.000 2.24 0.00 43.89 3.53
510 511 1.301637 CGATGCATACGGCCATCCA 60.302 57.895 2.24 0.00 43.89 3.41
511 512 0.884704 AACGATGCATACGGCCATCC 60.885 55.000 18.34 0.00 43.89 3.51
512 513 0.944386 AAACGATGCATACGGCCATC 59.056 50.000 18.34 0.00 43.89 3.51
513 514 1.065401 CAAAACGATGCATACGGCCAT 59.935 47.619 18.34 0.00 43.89 4.40
514 515 0.449786 CAAAACGATGCATACGGCCA 59.550 50.000 18.34 0.00 43.89 5.36
515 516 0.730265 TCAAAACGATGCATACGGCC 59.270 50.000 18.34 0.00 43.89 6.13
516 517 2.375110 CATCAAAACGATGCATACGGC 58.625 47.619 18.34 0.00 44.95 5.68
525 526 2.002586 CGGTCTCTGCATCAAAACGAT 58.997 47.619 0.00 0.00 33.27 3.73
526 527 1.000394 TCGGTCTCTGCATCAAAACGA 60.000 47.619 0.00 0.00 0.00 3.85
527 528 1.391485 CTCGGTCTCTGCATCAAAACG 59.609 52.381 0.00 0.00 0.00 3.60
528 529 1.734465 CCTCGGTCTCTGCATCAAAAC 59.266 52.381 0.00 0.00 0.00 2.43
529 530 1.623311 TCCTCGGTCTCTGCATCAAAA 59.377 47.619 0.00 0.00 0.00 2.44
530 531 1.266178 TCCTCGGTCTCTGCATCAAA 58.734 50.000 0.00 0.00 0.00 2.69
531 532 1.489481 ATCCTCGGTCTCTGCATCAA 58.511 50.000 0.00 0.00 0.00 2.57
532 533 2.362397 GTTATCCTCGGTCTCTGCATCA 59.638 50.000 0.00 0.00 0.00 3.07
533 534 2.288518 GGTTATCCTCGGTCTCTGCATC 60.289 54.545 0.00 0.00 0.00 3.91
534 535 1.689273 GGTTATCCTCGGTCTCTGCAT 59.311 52.381 0.00 0.00 0.00 3.96
535 536 1.112113 GGTTATCCTCGGTCTCTGCA 58.888 55.000 0.00 0.00 0.00 4.41
536 537 1.404843 AGGTTATCCTCGGTCTCTGC 58.595 55.000 0.00 0.00 40.58 4.26
566 567 5.187687 TCCAAACTTGTACGTCTCCTTTTT 58.812 37.500 0.00 0.00 0.00 1.94
567 568 4.773013 TCCAAACTTGTACGTCTCCTTTT 58.227 39.130 0.00 0.00 0.00 2.27
568 569 4.377897 CTCCAAACTTGTACGTCTCCTTT 58.622 43.478 0.00 0.00 0.00 3.11
569 570 3.244112 CCTCCAAACTTGTACGTCTCCTT 60.244 47.826 0.00 0.00 0.00 3.36
570 571 2.299297 CCTCCAAACTTGTACGTCTCCT 59.701 50.000 0.00 0.00 0.00 3.69
571 572 2.298163 TCCTCCAAACTTGTACGTCTCC 59.702 50.000 0.00 0.00 0.00 3.71
572 573 3.655276 TCCTCCAAACTTGTACGTCTC 57.345 47.619 0.00 0.00 0.00 3.36
573 574 4.618920 ATTCCTCCAAACTTGTACGTCT 57.381 40.909 0.00 0.00 0.00 4.18
574 575 6.980051 AATATTCCTCCAAACTTGTACGTC 57.020 37.500 0.00 0.00 0.00 4.34
575 576 8.851541 TTAAATATTCCTCCAAACTTGTACGT 57.148 30.769 0.00 0.00 0.00 3.57
576 577 9.769093 CTTTAAATATTCCTCCAAACTTGTACG 57.231 33.333 0.00 0.00 0.00 3.67
579 580 8.803235 GGTCTTTAAATATTCCTCCAAACTTGT 58.197 33.333 0.00 0.00 0.00 3.16
580 581 8.251026 GGGTCTTTAAATATTCCTCCAAACTTG 58.749 37.037 0.00 0.00 0.00 3.16
581 582 7.399191 GGGGTCTTTAAATATTCCTCCAAACTT 59.601 37.037 0.00 0.00 0.00 2.66
582 583 6.895756 GGGGTCTTTAAATATTCCTCCAAACT 59.104 38.462 0.00 0.00 0.00 2.66
583 584 6.183360 CGGGGTCTTTAAATATTCCTCCAAAC 60.183 42.308 0.00 0.00 0.00 2.93
584 585 5.889289 CGGGGTCTTTAAATATTCCTCCAAA 59.111 40.000 0.00 0.00 0.00 3.28
585 586 5.192121 TCGGGGTCTTTAAATATTCCTCCAA 59.808 40.000 0.00 0.00 0.00 3.53
586 587 4.722781 TCGGGGTCTTTAAATATTCCTCCA 59.277 41.667 0.00 0.00 0.00 3.86
587 588 5.071384 TCTCGGGGTCTTTAAATATTCCTCC 59.929 44.000 0.00 0.00 0.00 4.30
588 589 6.041751 TCTCTCGGGGTCTTTAAATATTCCTC 59.958 42.308 0.00 0.00 0.00 3.71
589 590 5.903589 TCTCTCGGGGTCTTTAAATATTCCT 59.096 40.000 0.00 0.00 0.00 3.36
590 591 6.170846 TCTCTCGGGGTCTTTAAATATTCC 57.829 41.667 0.00 0.00 0.00 3.01
591 592 6.147985 GCATCTCTCGGGGTCTTTAAATATTC 59.852 42.308 0.00 0.00 0.00 1.75
592 593 5.998363 GCATCTCTCGGGGTCTTTAAATATT 59.002 40.000 0.00 0.00 0.00 1.28
593 594 5.308237 AGCATCTCTCGGGGTCTTTAAATAT 59.692 40.000 0.00 0.00 0.00 1.28
594 595 4.654262 AGCATCTCTCGGGGTCTTTAAATA 59.346 41.667 0.00 0.00 0.00 1.40
595 596 3.456277 AGCATCTCTCGGGGTCTTTAAAT 59.544 43.478 0.00 0.00 0.00 1.40
596 597 2.838202 AGCATCTCTCGGGGTCTTTAAA 59.162 45.455 0.00 0.00 0.00 1.52
597 598 2.168521 CAGCATCTCTCGGGGTCTTTAA 59.831 50.000 0.00 0.00 0.00 1.52
598 599 1.757118 CAGCATCTCTCGGGGTCTTTA 59.243 52.381 0.00 0.00 0.00 1.85
599 600 0.539051 CAGCATCTCTCGGGGTCTTT 59.461 55.000 0.00 0.00 0.00 2.52
600 601 1.965754 GCAGCATCTCTCGGGGTCTT 61.966 60.000 0.00 0.00 0.00 3.01
601 602 2.430610 GCAGCATCTCTCGGGGTCT 61.431 63.158 0.00 0.00 0.00 3.85
602 603 2.107953 GCAGCATCTCTCGGGGTC 59.892 66.667 0.00 0.00 0.00 4.46
603 604 3.842923 CGCAGCATCTCTCGGGGT 61.843 66.667 0.00 0.00 0.00 4.95
604 605 4.598894 CCGCAGCATCTCTCGGGG 62.599 72.222 0.00 0.00 38.35 5.73
605 606 2.578163 TTTCCGCAGCATCTCTCGGG 62.578 60.000 0.00 0.00 41.98 5.14
606 607 1.150567 CTTTCCGCAGCATCTCTCGG 61.151 60.000 0.00 0.00 42.96 4.63
607 608 0.179127 TCTTTCCGCAGCATCTCTCG 60.179 55.000 0.00 0.00 0.00 4.04
608 609 1.932511 CTTCTTTCCGCAGCATCTCTC 59.067 52.381 0.00 0.00 0.00 3.20
609 610 1.552337 TCTTCTTTCCGCAGCATCTCT 59.448 47.619 0.00 0.00 0.00 3.10
610 611 1.932511 CTCTTCTTTCCGCAGCATCTC 59.067 52.381 0.00 0.00 0.00 2.75
611 612 1.552337 TCTCTTCTTTCCGCAGCATCT 59.448 47.619 0.00 0.00 0.00 2.90
612 613 2.015736 TCTCTTCTTTCCGCAGCATC 57.984 50.000 0.00 0.00 0.00 3.91
613 614 2.354259 CTTCTCTTCTTTCCGCAGCAT 58.646 47.619 0.00 0.00 0.00 3.79
614 615 1.800805 CTTCTCTTCTTTCCGCAGCA 58.199 50.000 0.00 0.00 0.00 4.41
615 616 0.445829 GCTTCTCTTCTTTCCGCAGC 59.554 55.000 0.00 0.00 0.00 5.25
616 617 1.082690 GGCTTCTCTTCTTTCCGCAG 58.917 55.000 0.00 0.00 0.00 5.18
617 618 0.396435 TGGCTTCTCTTCTTTCCGCA 59.604 50.000 0.00 0.00 0.00 5.69
618 619 1.399791 CATGGCTTCTCTTCTTTCCGC 59.600 52.381 0.00 0.00 0.00 5.54
619 620 2.012673 CCATGGCTTCTCTTCTTTCCG 58.987 52.381 0.00 0.00 0.00 4.30
620 621 3.013219 GACCATGGCTTCTCTTCTTTCC 58.987 50.000 13.04 0.00 0.00 3.13
621 622 3.679389 TGACCATGGCTTCTCTTCTTTC 58.321 45.455 13.04 0.00 0.00 2.62
622 623 3.795688 TGACCATGGCTTCTCTTCTTT 57.204 42.857 13.04 0.00 0.00 2.52
623 624 3.795688 TTGACCATGGCTTCTCTTCTT 57.204 42.857 13.04 0.00 0.00 2.52
624 625 3.522750 AGATTGACCATGGCTTCTCTTCT 59.477 43.478 13.04 6.05 0.00 2.85
625 626 3.626670 CAGATTGACCATGGCTTCTCTTC 59.373 47.826 13.04 0.00 0.00 2.87
626 627 3.009916 ACAGATTGACCATGGCTTCTCTT 59.990 43.478 13.04 0.00 0.00 2.85
627 628 2.575279 ACAGATTGACCATGGCTTCTCT 59.425 45.455 13.04 6.66 0.00 3.10
628 629 2.996631 ACAGATTGACCATGGCTTCTC 58.003 47.619 13.04 1.84 0.00 2.87
629 630 3.446442 AACAGATTGACCATGGCTTCT 57.554 42.857 13.04 6.08 0.00 2.85
630 631 3.256631 ACAAACAGATTGACCATGGCTTC 59.743 43.478 13.04 3.11 41.85 3.86
631 632 3.233507 ACAAACAGATTGACCATGGCTT 58.766 40.909 13.04 0.00 41.85 4.35
632 633 2.821969 GACAAACAGATTGACCATGGCT 59.178 45.455 13.04 0.00 41.85 4.75
633 634 3.221964 GACAAACAGATTGACCATGGC 57.778 47.619 13.04 5.35 41.85 4.40
639 640 5.514274 TCCTTTTGGACAAACAGATTGAC 57.486 39.130 0.00 0.00 45.19 3.18
653 654 3.077359 AGAAGAAGCGTCATCCTTTTGG 58.923 45.455 1.61 0.00 42.21 3.28
654 655 4.756084 AAGAAGAAGCGTCATCCTTTTG 57.244 40.909 1.61 0.00 0.00 2.44
655 656 4.022849 CCAAAGAAGAAGCGTCATCCTTTT 60.023 41.667 1.61 0.00 0.00 2.27
656 657 3.503748 CCAAAGAAGAAGCGTCATCCTTT 59.496 43.478 1.61 5.44 0.00 3.11
657 658 3.077359 CCAAAGAAGAAGCGTCATCCTT 58.923 45.455 1.61 0.00 0.00 3.36
658 659 2.303022 TCCAAAGAAGAAGCGTCATCCT 59.697 45.455 1.61 0.00 0.00 3.24
659 660 2.699954 TCCAAAGAAGAAGCGTCATCC 58.300 47.619 1.61 0.00 0.00 3.51
671 672 3.961480 TCGATGCTCTCTTCCAAAGAA 57.039 42.857 0.00 0.00 37.02 2.52
672 673 3.181471 GGATCGATGCTCTCTTCCAAAGA 60.181 47.826 9.99 0.00 35.87 2.52
673 674 3.129871 GGATCGATGCTCTCTTCCAAAG 58.870 50.000 9.99 0.00 0.00 2.77
674 675 2.768527 AGGATCGATGCTCTCTTCCAAA 59.231 45.455 14.37 0.00 0.00 3.28
675 676 2.392662 AGGATCGATGCTCTCTTCCAA 58.607 47.619 14.37 0.00 0.00 3.53
676 677 2.079170 AGGATCGATGCTCTCTTCCA 57.921 50.000 14.37 0.00 0.00 3.53
677 678 2.102252 ACAAGGATCGATGCTCTCTTCC 59.898 50.000 20.43 4.50 0.00 3.46
678 679 3.380142 GACAAGGATCGATGCTCTCTTC 58.620 50.000 20.43 10.02 0.00 2.87
679 680 2.223688 CGACAAGGATCGATGCTCTCTT 60.224 50.000 20.43 1.01 45.13 2.85
680 681 1.336440 CGACAAGGATCGATGCTCTCT 59.664 52.381 20.43 1.41 45.13 3.10
681 682 1.066303 ACGACAAGGATCGATGCTCTC 59.934 52.381 20.43 15.50 45.13 3.20
682 683 1.107114 ACGACAAGGATCGATGCTCT 58.893 50.000 20.43 8.30 45.13 4.09
683 684 1.203928 CACGACAAGGATCGATGCTC 58.796 55.000 20.43 7.22 45.13 4.26
684 685 0.807667 GCACGACAAGGATCGATGCT 60.808 55.000 14.37 14.37 45.13 3.79
685 686 1.638467 GCACGACAAGGATCGATGC 59.362 57.895 9.16 9.16 45.13 3.91
686 687 0.460109 TGGCACGACAAGGATCGATG 60.460 55.000 0.54 0.00 45.13 3.84
687 688 0.249120 TTGGCACGACAAGGATCGAT 59.751 50.000 0.00 0.00 45.13 3.59
688 689 0.389817 CTTGGCACGACAAGGATCGA 60.390 55.000 4.61 0.00 45.13 3.59
694 695 0.813610 TGACACCTTGGCACGACAAG 60.814 55.000 5.60 5.60 45.71 3.16
695 696 0.179032 ATGACACCTTGGCACGACAA 60.179 50.000 0.00 0.00 38.83 3.18
696 697 0.602638 GATGACACCTTGGCACGACA 60.603 55.000 0.00 0.00 38.83 4.35
697 698 0.320771 AGATGACACCTTGGCACGAC 60.321 55.000 0.00 0.00 38.83 4.34
698 699 0.320683 CAGATGACACCTTGGCACGA 60.321 55.000 0.00 0.00 38.83 4.35
699 700 1.300971 CCAGATGACACCTTGGCACG 61.301 60.000 0.00 0.00 38.83 5.34
700 701 0.250901 ACCAGATGACACCTTGGCAC 60.251 55.000 0.00 0.00 38.83 5.01
701 702 0.250858 CACCAGATGACACCTTGGCA 60.251 55.000 2.48 0.00 41.29 4.92
702 703 0.250901 ACACCAGATGACACCTTGGC 60.251 55.000 2.48 0.00 0.00 4.52
703 704 1.611673 GGACACCAGATGACACCTTGG 60.612 57.143 1.27 1.27 0.00 3.61
704 705 1.072173 TGGACACCAGATGACACCTTG 59.928 52.381 0.00 0.00 0.00 3.61
705 706 1.072331 GTGGACACCAGATGACACCTT 59.928 52.381 0.00 0.00 35.26 3.50
706 707 0.687354 GTGGACACCAGATGACACCT 59.313 55.000 0.00 0.00 35.26 4.00
707 708 0.396435 TGTGGACACCAGATGACACC 59.604 55.000 0.00 0.00 38.26 4.16
708 709 1.873591 GTTGTGGACACCAGATGACAC 59.126 52.381 0.00 0.00 38.97 3.67
709 710 1.202758 GGTTGTGGACACCAGATGACA 60.203 52.381 0.00 0.00 32.34 3.58
710 711 1.202758 TGGTTGTGGACACCAGATGAC 60.203 52.381 0.00 0.00 32.34 3.06
711 712 1.135960 TGGTTGTGGACACCAGATGA 58.864 50.000 0.00 0.00 32.34 2.92
712 713 1.814394 CATGGTTGTGGACACCAGATG 59.186 52.381 0.00 0.00 36.92 2.90
713 714 1.425066 ACATGGTTGTGGACACCAGAT 59.575 47.619 0.00 0.00 36.92 2.90
714 715 0.843309 ACATGGTTGTGGACACCAGA 59.157 50.000 0.00 0.00 36.92 3.86
715 716 1.691196 AACATGGTTGTGGACACCAG 58.309 50.000 0.00 0.00 36.92 4.00
716 717 2.151502 AAACATGGTTGTGGACACCA 57.848 45.000 0.00 0.00 35.83 4.17
717 718 2.167487 ACAAAACATGGTTGTGGACACC 59.833 45.455 14.26 0.00 37.80 4.16
718 719 3.518634 ACAAAACATGGTTGTGGACAC 57.481 42.857 14.26 0.00 37.80 3.67
724 725 2.096248 ACCGACACAAAACATGGTTGT 58.904 42.857 10.36 10.36 39.79 3.32
725 726 2.098280 TGACCGACACAAAACATGGTTG 59.902 45.455 0.00 3.10 0.00 3.77
726 727 2.370349 TGACCGACACAAAACATGGTT 58.630 42.857 0.00 0.00 0.00 3.67
727 728 2.045561 TGACCGACACAAAACATGGT 57.954 45.000 0.00 0.00 0.00 3.55
728 729 2.293122 ACATGACCGACACAAAACATGG 59.707 45.455 0.00 0.00 39.20 3.66
729 730 3.243035 ACACATGACCGACACAAAACATG 60.243 43.478 0.00 0.00 40.24 3.21
730 731 2.948979 ACACATGACCGACACAAAACAT 59.051 40.909 0.00 0.00 0.00 2.71
731 732 2.096657 CACACATGACCGACACAAAACA 59.903 45.455 0.00 0.00 0.00 2.83
732 733 2.096819 ACACACATGACCGACACAAAAC 59.903 45.455 0.00 0.00 0.00 2.43
733 734 2.360844 ACACACATGACCGACACAAAA 58.639 42.857 0.00 0.00 0.00 2.44
734 735 2.031258 ACACACATGACCGACACAAA 57.969 45.000 0.00 0.00 0.00 2.83
735 736 2.101750 ACTACACACATGACCGACACAA 59.898 45.455 0.00 0.00 0.00 3.33
736 737 1.684450 ACTACACACATGACCGACACA 59.316 47.619 0.00 0.00 0.00 3.72
737 738 2.433868 ACTACACACATGACCGACAC 57.566 50.000 0.00 0.00 0.00 3.67
738 739 4.794278 AATACTACACACATGACCGACA 57.206 40.909 0.00 0.00 0.00 4.35
757 758 9.350951 TGCCGCCGCTATCTATATATATATAAT 57.649 33.333 12.48 11.04 35.36 1.28
758 759 8.618677 GTGCCGCCGCTATCTATATATATATAA 58.381 37.037 12.48 5.80 35.36 0.98
759 760 7.771826 TGTGCCGCCGCTATCTATATATATATA 59.228 37.037 11.21 11.21 35.36 0.86
760 761 6.602009 TGTGCCGCCGCTATCTATATATATAT 59.398 38.462 10.10 10.10 35.36 0.86
761 762 5.941647 TGTGCCGCCGCTATCTATATATATA 59.058 40.000 2.49 2.49 35.36 0.86
762 763 4.765339 TGTGCCGCCGCTATCTATATATAT 59.235 41.667 0.00 0.00 35.36 0.86
763 764 4.023450 GTGTGCCGCCGCTATCTATATATA 60.023 45.833 0.00 0.00 35.36 0.86
764 765 2.956333 TGTGCCGCCGCTATCTATATAT 59.044 45.455 0.00 0.00 35.36 0.86
765 766 2.098607 GTGTGCCGCCGCTATCTATATA 59.901 50.000 0.00 0.00 35.36 0.86
766 767 1.135083 GTGTGCCGCCGCTATCTATAT 60.135 52.381 0.00 0.00 35.36 0.86
767 768 0.242825 GTGTGCCGCCGCTATCTATA 59.757 55.000 0.00 0.00 35.36 1.31
768 769 1.006102 GTGTGCCGCCGCTATCTAT 60.006 57.895 0.00 0.00 35.36 1.98
769 770 2.415843 GTGTGCCGCCGCTATCTA 59.584 61.111 0.00 0.00 35.36 1.98
770 771 3.770040 TGTGTGCCGCCGCTATCT 61.770 61.111 0.00 0.00 35.36 1.98
771 772 3.564027 GTGTGTGCCGCCGCTATC 61.564 66.667 0.00 0.00 35.36 2.08
772 773 4.386951 TGTGTGTGCCGCCGCTAT 62.387 61.111 0.00 0.00 35.36 2.97
777 778 4.250431 GTGTGTGTGTGTGCCGCC 62.250 66.667 0.00 0.00 0.00 6.13
778 779 3.504273 TGTGTGTGTGTGTGCCGC 61.504 61.111 0.00 0.00 0.00 6.53
779 780 2.394563 TGTGTGTGTGTGTGTGCCG 61.395 57.895 0.00 0.00 0.00 5.69
780 781 1.136565 GTGTGTGTGTGTGTGTGCC 59.863 57.895 0.00 0.00 0.00 5.01
781 782 0.096976 GAGTGTGTGTGTGTGTGTGC 59.903 55.000 0.00 0.00 0.00 4.57
782 783 1.128507 GTGAGTGTGTGTGTGTGTGTG 59.871 52.381 0.00 0.00 0.00 3.82
783 784 1.270571 TGTGAGTGTGTGTGTGTGTGT 60.271 47.619 0.00 0.00 0.00 3.72
784 785 1.128507 GTGTGAGTGTGTGTGTGTGTG 59.871 52.381 0.00 0.00 0.00 3.82
785 786 1.270571 TGTGTGAGTGTGTGTGTGTGT 60.271 47.619 0.00 0.00 0.00 3.72
786 787 1.128507 GTGTGTGAGTGTGTGTGTGTG 59.871 52.381 0.00 0.00 0.00 3.82
787 788 1.270571 TGTGTGTGAGTGTGTGTGTGT 60.271 47.619 0.00 0.00 0.00 3.72
788 789 1.128507 GTGTGTGTGAGTGTGTGTGTG 59.871 52.381 0.00 0.00 0.00 3.82
789 790 1.270571 TGTGTGTGTGAGTGTGTGTGT 60.271 47.619 0.00 0.00 0.00 3.72
790 791 1.128507 GTGTGTGTGTGAGTGTGTGTG 59.871 52.381 0.00 0.00 0.00 3.82
791 792 1.270571 TGTGTGTGTGTGAGTGTGTGT 60.271 47.619 0.00 0.00 0.00 3.72
792 793 1.128507 GTGTGTGTGTGTGAGTGTGTG 59.871 52.381 0.00 0.00 0.00 3.82
793 794 1.270571 TGTGTGTGTGTGTGAGTGTGT 60.271 47.619 0.00 0.00 0.00 3.72
794 795 1.128507 GTGTGTGTGTGTGTGAGTGTG 59.871 52.381 0.00 0.00 0.00 3.82
795 796 1.438651 GTGTGTGTGTGTGTGAGTGT 58.561 50.000 0.00 0.00 0.00 3.55
796 797 0.369931 CGTGTGTGTGTGTGTGAGTG 59.630 55.000 0.00 0.00 0.00 3.51
797 798 1.358725 GCGTGTGTGTGTGTGTGAGT 61.359 55.000 0.00 0.00 0.00 3.41
798 799 1.348250 GCGTGTGTGTGTGTGTGAG 59.652 57.895 0.00 0.00 0.00 3.51
799 800 1.374758 TGCGTGTGTGTGTGTGTGA 60.375 52.632 0.00 0.00 0.00 3.58
800 801 1.225991 GTGCGTGTGTGTGTGTGTG 60.226 57.895 0.00 0.00 0.00 3.82
801 802 1.669437 TGTGCGTGTGTGTGTGTGT 60.669 52.632 0.00 0.00 0.00 3.72
802 803 1.225991 GTGTGCGTGTGTGTGTGTG 60.226 57.895 0.00 0.00 0.00 3.82
803 804 1.669437 TGTGTGCGTGTGTGTGTGT 60.669 52.632 0.00 0.00 0.00 3.72
804 805 1.225991 GTGTGTGCGTGTGTGTGTG 60.226 57.895 0.00 0.00 0.00 3.82
805 806 1.669437 TGTGTGTGCGTGTGTGTGT 60.669 52.632 0.00 0.00 0.00 3.72
806 807 1.225991 GTGTGTGTGCGTGTGTGTG 60.226 57.895 0.00 0.00 0.00 3.82
807 808 1.669437 TGTGTGTGTGCGTGTGTGT 60.669 52.632 0.00 0.00 0.00 3.72
808 809 1.225991 GTGTGTGTGTGCGTGTGTG 60.226 57.895 0.00 0.00 0.00 3.82
809 810 1.669437 TGTGTGTGTGTGCGTGTGT 60.669 52.632 0.00 0.00 0.00 3.72
810 811 1.225991 GTGTGTGTGTGTGCGTGTG 60.226 57.895 0.00 0.00 0.00 3.82
811 812 1.669437 TGTGTGTGTGTGTGCGTGT 60.669 52.632 0.00 0.00 0.00 4.49
812 813 1.225991 GTGTGTGTGTGTGTGCGTG 60.226 57.895 0.00 0.00 0.00 5.34
813 814 1.669437 TGTGTGTGTGTGTGTGCGT 60.669 52.632 0.00 0.00 0.00 5.24
814 815 1.225991 GTGTGTGTGTGTGTGTGCG 60.226 57.895 0.00 0.00 0.00 5.34
815 816 1.062002 GTAGTGTGTGTGTGTGTGTGC 59.938 52.381 0.00 0.00 0.00 4.57
816 817 2.616960 AGTAGTGTGTGTGTGTGTGTG 58.383 47.619 0.00 0.00 0.00 3.82
817 818 3.732774 CGTAGTAGTGTGTGTGTGTGTGT 60.733 47.826 0.00 0.00 0.00 3.72
818 819 2.787129 CGTAGTAGTGTGTGTGTGTGTG 59.213 50.000 0.00 0.00 0.00 3.82
819 820 2.797087 GCGTAGTAGTGTGTGTGTGTGT 60.797 50.000 0.00 0.00 0.00 3.72
820 821 1.784856 GCGTAGTAGTGTGTGTGTGTG 59.215 52.381 0.00 0.00 0.00 3.82
821 822 1.269413 GGCGTAGTAGTGTGTGTGTGT 60.269 52.381 0.00 0.00 0.00 3.72
822 823 1.000607 AGGCGTAGTAGTGTGTGTGTG 60.001 52.381 0.00 0.00 0.00 3.82
823 824 1.000607 CAGGCGTAGTAGTGTGTGTGT 60.001 52.381 0.00 0.00 0.00 3.72
824 825 1.698165 CAGGCGTAGTAGTGTGTGTG 58.302 55.000 0.00 0.00 0.00 3.82
825 826 0.038526 GCAGGCGTAGTAGTGTGTGT 60.039 55.000 0.00 0.00 0.00 3.72
826 827 0.736325 GGCAGGCGTAGTAGTGTGTG 60.736 60.000 0.00 0.00 0.00 3.82
827 828 0.898789 AGGCAGGCGTAGTAGTGTGT 60.899 55.000 0.00 0.00 0.00 3.72
828 829 0.458543 CAGGCAGGCGTAGTAGTGTG 60.459 60.000 0.00 0.00 0.00 3.82
829 830 1.890894 CAGGCAGGCGTAGTAGTGT 59.109 57.895 0.00 0.00 0.00 3.55
830 831 1.519455 GCAGGCAGGCGTAGTAGTG 60.519 63.158 0.00 0.00 0.00 2.74
831 832 1.982395 TGCAGGCAGGCGTAGTAGT 60.982 57.895 0.00 0.00 36.28 2.73
832 833 1.519455 GTGCAGGCAGGCGTAGTAG 60.519 63.158 0.00 0.00 36.28 2.57
833 834 2.577059 GTGCAGGCAGGCGTAGTA 59.423 61.111 0.00 0.00 36.28 1.82
834 835 4.394712 GGTGCAGGCAGGCGTAGT 62.395 66.667 0.00 0.00 36.28 2.73
839 840 3.643595 TATGTGGGTGCAGGCAGGC 62.644 63.158 0.00 0.00 0.00 4.85
840 841 1.452651 CTATGTGGGTGCAGGCAGG 60.453 63.158 0.00 0.00 0.00 4.85
841 842 1.452651 CCTATGTGGGTGCAGGCAG 60.453 63.158 0.00 0.00 0.00 4.85
842 843 2.676608 CCTATGTGGGTGCAGGCA 59.323 61.111 0.00 0.00 0.00 4.75
851 852 1.533711 CTTGGCCTCCCCTATGTGG 59.466 63.158 3.32 0.00 0.00 4.17
852 853 1.533711 CCTTGGCCTCCCCTATGTG 59.466 63.158 3.32 0.00 0.00 3.21
853 854 1.697754 CCCTTGGCCTCCCCTATGT 60.698 63.158 3.32 0.00 0.00 2.29
854 855 2.464403 CCCCTTGGCCTCCCCTATG 61.464 68.421 3.32 0.00 0.00 2.23
855 856 2.038330 CCCCTTGGCCTCCCCTAT 60.038 66.667 3.32 0.00 0.00 2.57
856 857 3.297579 TCCCCTTGGCCTCCCCTA 61.298 66.667 3.32 0.00 0.00 3.53
857 858 4.767892 CTCCCCTTGGCCTCCCCT 62.768 72.222 3.32 0.00 0.00 4.79
858 859 4.760220 TCTCCCCTTGGCCTCCCC 62.760 72.222 3.32 0.00 0.00 4.81
859 860 3.093172 CTCTCCCCTTGGCCTCCC 61.093 72.222 3.32 0.00 0.00 4.30
860 861 3.093172 CCTCTCCCCTTGGCCTCC 61.093 72.222 3.32 0.00 0.00 4.30
861 862 3.093172 CCCTCTCCCCTTGGCCTC 61.093 72.222 3.32 0.00 0.00 4.70
878 879 3.541713 CTACCTCCTCTGCCCGGC 61.542 72.222 1.04 1.04 0.00 6.13
879 880 3.541713 GCTACCTCCTCTGCCCGG 61.542 72.222 0.00 0.00 0.00 5.73
880 881 3.541713 GGCTACCTCCTCTGCCCG 61.542 72.222 0.00 0.00 39.49 6.13
881 882 1.768077 ATGGCTACCTCCTCTGCCC 60.768 63.158 0.00 0.00 44.32 5.36
882 883 1.341156 ACATGGCTACCTCCTCTGCC 61.341 60.000 0.00 0.00 45.10 4.85
883 884 1.069358 GTACATGGCTACCTCCTCTGC 59.931 57.143 0.00 0.00 0.00 4.26
884 885 2.388735 TGTACATGGCTACCTCCTCTG 58.611 52.381 0.00 0.00 0.00 3.35
885 886 2.766828 GTTGTACATGGCTACCTCCTCT 59.233 50.000 0.00 0.00 0.00 3.69
886 887 2.766828 AGTTGTACATGGCTACCTCCTC 59.233 50.000 0.00 0.00 0.00 3.71
887 888 2.766828 GAGTTGTACATGGCTACCTCCT 59.233 50.000 0.00 0.00 0.00 3.69
888 889 2.158943 GGAGTTGTACATGGCTACCTCC 60.159 54.545 0.00 2.50 0.00 4.30
889 890 2.481449 CGGAGTTGTACATGGCTACCTC 60.481 54.545 0.00 0.00 0.00 3.85
890 891 1.480954 CGGAGTTGTACATGGCTACCT 59.519 52.381 0.00 0.00 0.00 3.08
891 892 1.472728 CCGGAGTTGTACATGGCTACC 60.473 57.143 0.00 0.02 0.00 3.18
892 893 1.935933 CCGGAGTTGTACATGGCTAC 58.064 55.000 0.00 0.00 0.00 3.58
893 894 0.177141 GCCGGAGTTGTACATGGCTA 59.823 55.000 5.05 0.00 39.38 3.93
894 895 1.078426 GCCGGAGTTGTACATGGCT 60.078 57.895 5.05 5.81 39.38 4.75
895 896 2.461110 CGCCGGAGTTGTACATGGC 61.461 63.158 5.05 5.03 39.10 4.40
896 897 1.813753 CCGCCGGAGTTGTACATGG 60.814 63.158 5.05 0.00 0.00 3.66
897 898 2.461110 GCCGCCGGAGTTGTACATG 61.461 63.158 7.68 0.00 0.00 3.21
898 899 2.125269 GCCGCCGGAGTTGTACAT 60.125 61.111 7.68 0.00 0.00 2.29
899 900 4.728102 CGCCGCCGGAGTTGTACA 62.728 66.667 7.68 0.00 0.00 2.90
951 952 1.376037 GTACTCTGGGCTGGTGCAC 60.376 63.158 8.80 8.80 44.33 4.57
952 953 1.414866 TTGTACTCTGGGCTGGTGCA 61.415 55.000 0.00 0.00 41.91 4.57
953 954 0.250727 TTTGTACTCTGGGCTGGTGC 60.251 55.000 0.00 0.00 38.76 5.01
954 955 1.347707 TCTTTGTACTCTGGGCTGGTG 59.652 52.381 0.00 0.00 0.00 4.17
955 956 1.348036 GTCTTTGTACTCTGGGCTGGT 59.652 52.381 0.00 0.00 0.00 4.00
956 957 1.673033 CGTCTTTGTACTCTGGGCTGG 60.673 57.143 0.00 0.00 0.00 4.85
957 958 1.000955 ACGTCTTTGTACTCTGGGCTG 59.999 52.381 0.00 0.00 0.00 4.85
958 959 1.272769 GACGTCTTTGTACTCTGGGCT 59.727 52.381 8.70 0.00 0.00 5.19
959 960 1.000506 TGACGTCTTTGTACTCTGGGC 59.999 52.381 17.92 0.00 0.00 5.36
960 961 3.254060 CATGACGTCTTTGTACTCTGGG 58.746 50.000 17.92 0.00 0.00 4.45
961 962 2.668457 GCATGACGTCTTTGTACTCTGG 59.332 50.000 17.92 0.00 0.00 3.86
962 963 3.121944 GTGCATGACGTCTTTGTACTCTG 59.878 47.826 22.84 5.36 0.00 3.35
963 964 3.318017 GTGCATGACGTCTTTGTACTCT 58.682 45.455 22.84 0.00 0.00 3.24
964 965 2.090658 CGTGCATGACGTCTTTGTACTC 59.909 50.000 25.18 10.79 43.50 2.59
965 966 2.058798 CGTGCATGACGTCTTTGTACT 58.941 47.619 25.18 1.94 43.50 2.73
966 967 2.487406 CGTGCATGACGTCTTTGTAC 57.513 50.000 17.92 20.09 43.50 2.90
976 977 1.552226 CAATCATTGGCGTGCATGAC 58.448 50.000 10.93 7.69 32.19 3.06
977 978 0.456628 CCAATCATTGGCGTGCATGA 59.543 50.000 10.93 0.00 45.17 3.07
978 979 2.966324 CCAATCATTGGCGTGCATG 58.034 52.632 2.63 0.09 45.17 4.06
986 987 2.100252 GTGACCATGAGCCAATCATTGG 59.900 50.000 12.63 12.63 46.97 3.16
987 988 2.100252 GGTGACCATGAGCCAATCATTG 59.900 50.000 0.00 0.00 46.97 2.82
988 989 2.291735 TGGTGACCATGAGCCAATCATT 60.292 45.455 0.00 0.00 46.97 2.57
990 991 0.697658 TGGTGACCATGAGCCAATCA 59.302 50.000 0.00 0.00 43.70 2.57
991 992 1.098050 GTGGTGACCATGAGCCAATC 58.902 55.000 7.94 0.00 35.28 2.67
992 993 0.323725 GGTGGTGACCATGAGCCAAT 60.324 55.000 7.94 0.00 42.59 3.16
993 994 1.074775 GGTGGTGACCATGAGCCAA 59.925 57.895 7.94 0.00 42.59 4.52
994 995 2.756400 GGTGGTGACCATGAGCCA 59.244 61.111 7.94 0.00 42.59 4.75
1018 1019 0.031721 AAGACAAGGACCGTCACGAC 59.968 55.000 0.00 0.00 35.77 4.34
1021 1022 1.226746 CCAAAGACAAGGACCGTCAC 58.773 55.000 0.00 0.00 35.77 3.67
1026 1027 0.955919 CGAGCCCAAAGACAAGGACC 60.956 60.000 0.00 0.00 0.00 4.46
1027 1028 0.250338 ACGAGCCCAAAGACAAGGAC 60.250 55.000 0.00 0.00 0.00 3.85
1032 1033 1.300620 CACGACGAGCCCAAAGACA 60.301 57.895 0.00 0.00 0.00 3.41
1034 1035 2.357034 GCACGACGAGCCCAAAGA 60.357 61.111 5.94 0.00 0.00 2.52
1036 1037 2.357034 GAGCACGACGAGCCCAAA 60.357 61.111 13.77 0.00 0.00 3.28
1037 1038 3.303135 AGAGCACGACGAGCCCAA 61.303 61.111 13.77 0.00 0.00 4.12
1038 1039 4.056125 CAGAGCACGACGAGCCCA 62.056 66.667 13.77 0.00 0.00 5.36
1040 1041 3.997064 ATGCAGAGCACGACGAGCC 62.997 63.158 13.77 5.73 43.04 4.70
1041 1042 2.507992 ATGCAGAGCACGACGAGC 60.508 61.111 9.38 9.38 43.04 5.03
1045 1046 1.134075 CAAGCATGCAGAGCACGAC 59.866 57.895 21.98 0.00 43.04 4.34
1048 1049 2.181021 GCCAAGCATGCAGAGCAC 59.819 61.111 21.98 0.00 43.04 4.40
1050 1051 4.189188 CGGCCAAGCATGCAGAGC 62.189 66.667 21.98 18.02 0.00 4.09
1084 1085 3.537874 GGCGATGGAGTACCCGCT 61.538 66.667 8.78 0.00 43.04 5.52
1103 1104 2.125552 CCTGGAAGATGACGCGCA 60.126 61.111 5.73 5.73 34.07 6.09
1104 1105 3.567797 GCCTGGAAGATGACGCGC 61.568 66.667 5.73 0.00 34.07 6.86
1108 1109 1.674962 GAAGCATGCCTGGAAGATGAC 59.325 52.381 15.66 0.00 34.07 3.06
1111 1112 1.760192 GTGAAGCATGCCTGGAAGAT 58.240 50.000 15.66 0.00 34.07 2.40
1129 1130 0.618968 ATGAAGGGGAGGAAGAGCGT 60.619 55.000 0.00 0.00 0.00 5.07
1161 1162 0.250901 GCTTGCTCTTGGTCTGGGAA 60.251 55.000 0.00 0.00 0.00 3.97
1168 1169 2.032681 GTCGGGCTTGCTCTTGGT 59.967 61.111 0.00 0.00 0.00 3.67
1204 1208 5.650570 ATCCAGAGGATGACGATCTCCGT 62.651 52.174 0.00 0.00 44.23 4.69
1216 1220 1.047596 ACGAGCAGCATCCAGAGGAT 61.048 55.000 0.00 0.00 44.21 3.24
1275 1279 2.359230 GTGAAGGCTTCAGCGGCT 60.359 61.111 29.22 0.00 41.01 5.52
1281 1285 4.697756 CCGCGGGTGAAGGCTTCA 62.698 66.667 25.38 25.38 37.33 3.02
1300 1304 1.070758 CAACAGGCTATAGCACCCGAT 59.929 52.381 25.53 4.31 44.36 4.18
1305 1309 2.484947 GGGGTACAACAGGCTATAGCAC 60.485 54.545 25.53 14.85 44.36 4.40
1306 1310 1.766496 GGGGTACAACAGGCTATAGCA 59.234 52.381 25.53 0.57 44.36 3.49
1315 1319 1.210478 CTCCTCCATGGGGTACAACAG 59.790 57.143 11.67 0.00 36.20 3.16
1317 1321 0.546598 CCTCCTCCATGGGGTACAAC 59.453 60.000 11.67 0.00 33.29 3.32
1320 1324 1.345715 CCACCTCCTCCATGGGGTAC 61.346 65.000 11.67 0.00 37.30 3.34
1321 1325 1.004230 CCACCTCCTCCATGGGGTA 59.996 63.158 11.67 0.00 37.30 3.69
1324 1328 3.001514 CACCACCTCCTCCATGGG 58.998 66.667 13.02 2.26 37.86 4.00
1327 1331 4.101448 GCGCACCACCTCCTCCAT 62.101 66.667 0.30 0.00 0.00 3.41
1329 1333 4.101448 ATGCGCACCACCTCCTCC 62.101 66.667 14.90 0.00 0.00 4.30
1380 1384 0.896923 GTTTGATGCCCAAGCCATGA 59.103 50.000 0.00 0.00 38.69 3.07
1389 1393 1.923356 TGAAGAAGGGTTTGATGCCC 58.077 50.000 0.00 0.00 46.43 5.36
1393 1397 5.193325 AGAGGATGATGAAGAAGGGTTTGAT 59.807 40.000 0.00 0.00 0.00 2.57
1398 1402 2.776536 CCAGAGGATGATGAAGAAGGGT 59.223 50.000 0.00 0.00 0.00 4.34
1449 1453 2.124570 ACATGGATGCAGACGGCC 60.125 61.111 0.00 0.00 43.89 6.13
1453 1457 1.026182 TTGGCGACATGGATGCAGAC 61.026 55.000 0.00 0.00 42.32 3.51
1464 1468 0.319555 CGAAGGAGTCTTTGGCGACA 60.320 55.000 0.00 0.00 36.38 4.35
1465 1469 0.038526 TCGAAGGAGTCTTTGGCGAC 60.039 55.000 0.00 0.00 35.56 5.19
1473 1477 2.047443 GGCGAGGTCGAAGGAGTCT 61.047 63.158 2.94 0.00 43.02 3.24
1474 1478 1.874345 TTGGCGAGGTCGAAGGAGTC 61.874 60.000 2.94 0.00 43.02 3.36
1475 1479 1.878656 CTTGGCGAGGTCGAAGGAGT 61.879 60.000 2.94 0.00 43.02 3.85
1540 1544 2.604174 CGTTGGACAGTTGTCGGCC 61.604 63.158 6.21 0.00 45.65 6.13
1549 1553 1.129326 GTGTCGTCTTCGTTGGACAG 58.871 55.000 0.00 0.00 39.82 3.51
1556 1560 1.066918 GGGTGTGTGTCGTCTTCGT 59.933 57.895 0.00 0.00 38.33 3.85
1560 1564 2.819550 GGTGGGTGTGTGTCGTCT 59.180 61.111 0.00 0.00 0.00 4.18
1624 1631 1.746991 CCTTTCTCTTGAGCCGGCC 60.747 63.158 26.15 15.80 0.00 6.13
1668 1675 1.760613 ACGTTCTTCACTTCTGGGTCA 59.239 47.619 0.00 0.00 0.00 4.02
1673 1680 1.264288 GGCCAACGTTCTTCACTTCTG 59.736 52.381 0.00 0.00 0.00 3.02
1687 1694 1.372087 CCGCAGATCTCAAGGCCAAC 61.372 60.000 5.01 0.00 0.00 3.77
1702 1709 2.047274 CTCCCTTTCTTCGCCGCA 60.047 61.111 0.00 0.00 0.00 5.69
1703 1710 1.375523 TTCTCCCTTTCTTCGCCGC 60.376 57.895 0.00 0.00 0.00 6.53
1704 1711 0.320421 TGTTCTCCCTTTCTTCGCCG 60.320 55.000 0.00 0.00 0.00 6.46
1706 1713 2.814336 ACAATGTTCTCCCTTTCTTCGC 59.186 45.455 0.00 0.00 0.00 4.70
1708 1715 3.759086 GGGACAATGTTCTCCCTTTCTTC 59.241 47.826 1.71 0.00 42.84 2.87
1710 1717 2.041755 GGGGACAATGTTCTCCCTTTCT 59.958 50.000 8.32 0.00 45.22 2.52
1711 1718 2.447443 GGGGACAATGTTCTCCCTTTC 58.553 52.381 8.32 0.00 45.22 2.62
1715 1722 0.326927 TTCGGGGACAATGTTCTCCC 59.673 55.000 9.37 9.37 45.17 4.30
1717 1724 1.278127 TCCTTCGGGGACAATGTTCTC 59.722 52.381 0.00 0.00 39.58 2.87
1731 1738 1.571919 CATTTAGACCGCCTCCTTCG 58.428 55.000 0.00 0.00 0.00 3.79
1732 1739 1.954927 CCATTTAGACCGCCTCCTTC 58.045 55.000 0.00 0.00 0.00 3.46
1733 1740 0.107165 GCCATTTAGACCGCCTCCTT 60.107 55.000 0.00 0.00 0.00 3.36
1734 1741 1.527370 GCCATTTAGACCGCCTCCT 59.473 57.895 0.00 0.00 0.00 3.69
1735 1742 1.887707 CGCCATTTAGACCGCCTCC 60.888 63.158 0.00 0.00 0.00 4.30
1736 1743 1.143183 TCGCCATTTAGACCGCCTC 59.857 57.895 0.00 0.00 0.00 4.70
1742 1749 3.445857 GTCACTAGGTCGCCATTTAGAC 58.554 50.000 0.00 0.00 36.70 2.59
1745 1752 2.181125 TGGTCACTAGGTCGCCATTTA 58.819 47.619 0.00 0.00 0.00 1.40
1748 1755 0.249398 GTTGGTCACTAGGTCGCCAT 59.751 55.000 0.00 0.00 0.00 4.40
1749 1756 1.116536 TGTTGGTCACTAGGTCGCCA 61.117 55.000 0.00 0.00 0.00 5.69
1751 1758 1.270147 ACTTGTTGGTCACTAGGTCGC 60.270 52.381 0.00 0.00 32.89 5.19
1757 1764 2.313317 ACTCGGACTTGTTGGTCACTA 58.687 47.619 0.00 0.00 37.91 2.74
1792 1799 1.001406 CTCGGAGAAGCCCCATATGTC 59.999 57.143 0.00 0.00 34.09 3.06
1804 1811 1.478510 GATGGCTTCTGTCTCGGAGAA 59.521 52.381 9.72 0.00 34.09 2.87
1806 1813 1.110442 AGATGGCTTCTGTCTCGGAG 58.890 55.000 1.57 0.00 31.79 4.63
1807 1814 1.478510 GAAGATGGCTTCTGTCTCGGA 59.521 52.381 3.39 0.00 45.62 4.55
1818 1825 3.258372 TCTTGTCGTACTTGAAGATGGCT 59.742 43.478 0.00 0.00 0.00 4.75
1819 1826 3.585862 TCTTGTCGTACTTGAAGATGGC 58.414 45.455 0.00 0.00 0.00 4.40
1834 1841 5.412904 CCAACTTCCATTTCCTACTCTTGTC 59.587 44.000 0.00 0.00 0.00 3.18
1837 1844 5.548056 TCTCCAACTTCCATTTCCTACTCTT 59.452 40.000 0.00 0.00 0.00 2.85
1842 1849 5.576563 TGTTCTCCAACTTCCATTTCCTA 57.423 39.130 0.00 0.00 33.17 2.94
1848 1855 4.154942 AGCAAATGTTCTCCAACTTCCAT 58.845 39.130 0.00 0.00 33.17 3.41
1849 1856 3.565307 AGCAAATGTTCTCCAACTTCCA 58.435 40.909 0.00 0.00 33.17 3.53
1850 1857 4.550422 GAAGCAAATGTTCTCCAACTTCC 58.450 43.478 0.00 0.00 33.17 3.46
1851 1858 4.222114 CGAAGCAAATGTTCTCCAACTTC 58.778 43.478 0.00 0.00 33.17 3.01
1870 1877 2.094757 TTGAAGAGTGCGAGGGCGAA 62.095 55.000 0.00 0.00 44.10 4.70
1893 1900 0.173708 GCTCCATCTTTCGTCGGAGT 59.826 55.000 6.20 0.00 45.71 3.85
1915 1922 0.325933 TTGACCTCTGCCATGTGGAG 59.674 55.000 2.55 0.00 37.39 3.86
1931 1938 2.243957 CGCGCTTGTGTGGTCTTGA 61.244 57.895 5.56 0.00 0.00 3.02
1932 1939 2.249309 CGCGCTTGTGTGGTCTTG 59.751 61.111 5.56 0.00 0.00 3.02
1976 1983 2.190578 CTTCATCCCCCGTGAGCC 59.809 66.667 0.00 0.00 0.00 4.70
1989 1996 2.355363 CGGGCGTCGAACACTTCA 60.355 61.111 0.00 0.00 42.43 3.02
2006 2013 2.510064 TACCACATGGAACGCCCGAC 62.510 60.000 4.53 0.00 38.94 4.79
2028 2041 1.759445 TCCATGAACCTGAGCTCTAGC 59.241 52.381 16.19 0.00 42.49 3.42
2044 2057 8.907829 ATGATATCTTGGTAGTACTCATCCAT 57.092 34.615 0.00 0.00 0.00 3.41
2061 2074 1.188219 ACGCCAGCGGGATGATATCT 61.188 55.000 17.33 0.00 44.69 1.98
2063 2076 0.603707 CAACGCCAGCGGGATGATAT 60.604 55.000 17.33 0.00 44.69 1.63
2064 2077 1.227527 CAACGCCAGCGGGATGATA 60.228 57.895 17.33 0.00 44.69 2.15
2079 2092 1.153269 GAGCTCTGGCCTAGGCAAC 60.153 63.158 34.09 18.87 44.11 4.17
2091 2104 1.063183 AGTTGGCCAGAAAGAGCTCT 58.937 50.000 11.45 11.45 0.00 4.09
2118 2131 1.779569 ACACGACAAAGACGATGGAC 58.220 50.000 0.00 0.00 34.70 4.02
2130 2143 0.599060 TGACGCCATAGAACACGACA 59.401 50.000 0.00 0.00 0.00 4.35
2131 2144 0.989890 GTGACGCCATAGAACACGAC 59.010 55.000 0.00 0.00 0.00 4.34
2134 2147 1.726791 CACAGTGACGCCATAGAACAC 59.273 52.381 0.00 0.00 0.00 3.32
2139 2152 0.443869 GCAACACAGTGACGCCATAG 59.556 55.000 7.81 0.00 0.00 2.23
2142 2155 1.887242 GAGCAACACAGTGACGCCA 60.887 57.895 7.81 0.00 0.00 5.69
2143 2156 2.939022 GAGCAACACAGTGACGCC 59.061 61.111 7.81 0.36 0.00 5.68
2146 2159 0.577269 GTGACGAGCAACACAGTGAC 59.423 55.000 7.81 0.00 37.05 3.67
2151 2164 4.319249 CTCGTGACGAGCAACACA 57.681 55.556 22.72 0.00 46.75 3.72
2166 2179 3.639538 GATGATGATGTTGGCATTGCTC 58.360 45.455 8.82 0.00 35.07 4.26
2167 2180 2.034179 CGATGATGATGTTGGCATTGCT 59.966 45.455 8.82 0.00 35.07 3.91
2174 2187 3.058016 GCCCAATACGATGATGATGTTGG 60.058 47.826 0.00 0.00 35.55 3.77
2182 2195 0.681733 AGCGAGCCCAATACGATGAT 59.318 50.000 0.00 0.00 0.00 2.45
2186 2199 0.459585 GAACAGCGAGCCCAATACGA 60.460 55.000 0.00 0.00 0.00 3.43
2187 2200 0.739462 TGAACAGCGAGCCCAATACG 60.739 55.000 0.00 0.00 0.00 3.06
2190 2203 0.962356 CCTTGAACAGCGAGCCCAAT 60.962 55.000 0.00 0.00 0.00 3.16
2199 2212 1.372087 CGATGAGCCCCTTGAACAGC 61.372 60.000 0.00 0.00 0.00 4.40
2202 2215 0.744771 GACCGATGAGCCCCTTGAAC 60.745 60.000 0.00 0.00 0.00 3.18
2206 2219 1.694696 GAATAGACCGATGAGCCCCTT 59.305 52.381 0.00 0.00 0.00 3.95
2207 2220 1.343069 GAATAGACCGATGAGCCCCT 58.657 55.000 0.00 0.00 0.00 4.79
2241 2254 0.740737 GCAGAAAGCACTTGTGGTGT 59.259 50.000 6.22 0.41 46.86 4.16
2256 2269 2.431683 GAGGCCACTTGGTGCAGA 59.568 61.111 5.01 0.00 37.57 4.26
2259 2272 2.116125 AAGGAGGCCACTTGGTGC 59.884 61.111 5.01 0.00 37.57 5.01
2277 2290 2.312436 GGTACGCACGGTGACAACC 61.312 63.158 13.29 10.95 43.76 3.77
2280 2293 2.018727 AAGTGGTACGCACGGTGACA 62.019 55.000 13.29 0.00 44.14 3.58
2282 2295 0.179078 AAAAGTGGTACGCACGGTGA 60.179 50.000 13.29 0.00 44.14 4.02
2285 2298 0.233848 GTCAAAAGTGGTACGCACGG 59.766 55.000 8.30 2.40 44.14 4.94
2286 2299 0.931702 TGTCAAAAGTGGTACGCACG 59.068 50.000 8.30 0.00 44.14 5.34
2289 2302 3.435327 TGATGATGTCAAAAGTGGTACGC 59.565 43.478 0.00 0.00 34.13 4.42
2290 2303 5.351189 TGATGATGATGTCAAAAGTGGTACG 59.649 40.000 0.00 0.00 40.97 3.67
2292 2305 5.647658 GGTGATGATGATGTCAAAAGTGGTA 59.352 40.000 0.00 0.00 40.97 3.25
2293 2306 4.460382 GGTGATGATGATGTCAAAAGTGGT 59.540 41.667 0.00 0.00 40.97 4.16
2296 2309 5.882557 GGTAGGTGATGATGATGTCAAAAGT 59.117 40.000 0.00 0.00 40.97 2.66
2298 2311 6.065976 AGGTAGGTGATGATGATGTCAAAA 57.934 37.500 0.00 0.00 40.97 2.44
2300 2313 4.101585 GGAGGTAGGTGATGATGATGTCAA 59.898 45.833 0.00 0.00 40.97 3.18
2301 2314 3.643320 GGAGGTAGGTGATGATGATGTCA 59.357 47.826 0.00 0.00 42.06 3.58
2305 2318 4.204792 TGAGGAGGTAGGTGATGATGAT 57.795 45.455 0.00 0.00 0.00 2.45
2318 2331 3.474570 GGGCGAGCATGAGGAGGT 61.475 66.667 0.00 0.00 0.00 3.85
2332 2345 3.151022 CTGGACGAGGAGGAGGGC 61.151 72.222 0.00 0.00 0.00 5.19
2341 2354 4.639135 TCAACTGATATGTCTGGACGAG 57.361 45.455 0.00 0.00 0.00 4.18
2342 2355 4.038042 GGATCAACTGATATGTCTGGACGA 59.962 45.833 0.00 0.00 34.37 4.20
2347 2360 6.925718 ACGTAATGGATCAACTGATATGTCTG 59.074 38.462 0.00 0.00 34.37 3.51
2356 2369 5.461407 CAGAGATCACGTAATGGATCAACTG 59.539 44.000 14.03 15.94 41.84 3.16
2361 2374 5.218885 CAGTCAGAGATCACGTAATGGATC 58.781 45.833 5.66 5.66 40.13 3.36
2362 2375 4.038522 CCAGTCAGAGATCACGTAATGGAT 59.961 45.833 7.98 0.00 0.00 3.41
2364 2377 3.131223 ACCAGTCAGAGATCACGTAATGG 59.869 47.826 10.86 10.86 0.00 3.16
2367 2380 4.523173 AGAAACCAGTCAGAGATCACGTAA 59.477 41.667 0.00 0.00 0.00 3.18
2374 2387 4.464597 GGACACTAGAAACCAGTCAGAGAT 59.535 45.833 0.00 0.00 0.00 2.75
2388 2401 3.834813 AGTTGCAGATCAAGGACACTAGA 59.165 43.478 0.00 0.00 34.91 2.43
2389 2402 4.199432 AGTTGCAGATCAAGGACACTAG 57.801 45.455 0.00 0.00 34.91 2.57
2391 2404 3.615110 CGTAGTTGCAGATCAAGGACACT 60.615 47.826 0.00 0.00 34.91 3.55
2421 2434 4.039488 TGGAACAATCTCTGCATGCTTTTT 59.961 37.500 20.33 3.44 31.92 1.94
2423 2436 3.057033 GTGGAACAATCTCTGCATGCTTT 60.057 43.478 20.33 2.12 44.16 3.51
2426 2439 1.133790 GGTGGAACAATCTCTGCATGC 59.866 52.381 11.82 11.82 44.16 4.06
2427 2440 2.439409 TGGTGGAACAATCTCTGCATG 58.561 47.619 0.00 0.00 44.16 4.06
2428 2441 2.885135 TGGTGGAACAATCTCTGCAT 57.115 45.000 0.00 0.00 44.16 3.96
2430 2443 3.209410 CCTATGGTGGAACAATCTCTGC 58.791 50.000 0.00 0.00 44.16 4.26
2434 2447 3.737559 TTGCCTATGGTGGAACAATCT 57.262 42.857 0.00 0.00 44.16 2.40
2436 2449 4.352009 TGATTTGCCTATGGTGGAACAAT 58.648 39.130 0.00 0.00 44.16 2.71
2437 2450 3.772387 TGATTTGCCTATGGTGGAACAA 58.228 40.909 0.00 0.00 44.16 2.83
2438 2451 3.448093 TGATTTGCCTATGGTGGAACA 57.552 42.857 0.00 0.00 39.98 3.18
2441 2454 3.949586 TGATGATTTGCCTATGGTGGA 57.050 42.857 0.00 0.00 0.00 4.02
2442 2455 4.209538 TCTTGATGATTTGCCTATGGTGG 58.790 43.478 0.00 0.00 0.00 4.61
2446 2459 7.689446 AGATGATCTTGATGATTTGCCTATG 57.311 36.000 0.00 0.00 35.14 2.23
2464 2477 0.035152 TGCTTCGCCCACAAGATGAT 60.035 50.000 0.00 0.00 0.00 2.45
2465 2478 0.955428 GTGCTTCGCCCACAAGATGA 60.955 55.000 0.00 0.00 33.50 2.92
2468 2481 2.281484 GGTGCTTCGCCCACAAGA 60.281 61.111 0.00 0.00 34.94 3.02
2470 2483 4.555709 ACGGTGCTTCGCCCACAA 62.556 61.111 0.00 0.00 34.94 3.33
2472 2485 3.284449 AAACGGTGCTTCGCCCAC 61.284 61.111 0.00 0.00 0.00 4.61
2487 2500 3.430453 GACCTTGATGATGGGGAACAAA 58.570 45.455 0.00 0.00 0.00 2.83
2489 2502 1.284785 GGACCTTGATGATGGGGAACA 59.715 52.381 0.00 0.00 0.00 3.18
2491 2504 1.284785 GTGGACCTTGATGATGGGGAA 59.715 52.381 0.00 0.00 0.00 3.97
2492 2505 0.918983 GTGGACCTTGATGATGGGGA 59.081 55.000 0.00 0.00 0.00 4.81
2497 2510 1.211457 GAGCTGGTGGACCTTGATGAT 59.789 52.381 0.00 0.00 36.82 2.45
2515 2528 4.855388 CGGATTGAGCTTCAAAATGTTGAG 59.145 41.667 0.00 0.00 44.49 3.02
2519 2532 2.821969 AGCGGATTGAGCTTCAAAATGT 59.178 40.909 0.00 0.00 43.24 2.71
2533 2546 1.098050 GAATGCAGGTGAAGCGGATT 58.902 50.000 0.00 0.00 33.85 3.01
2535 2548 0.391661 GAGAATGCAGGTGAAGCGGA 60.392 55.000 0.00 0.00 33.85 5.54
2537 2550 1.699656 CCGAGAATGCAGGTGAAGCG 61.700 60.000 0.00 0.00 33.85 4.68
2541 2554 3.805928 ACCCGAGAATGCAGGTGA 58.194 55.556 0.00 0.00 0.00 4.02
2542 2555 3.895025 CACCCGAGAATGCAGGTG 58.105 61.111 6.20 6.20 43.50 4.00
2546 2559 0.392863 CATCCACACCCGAGAATGCA 60.393 55.000 0.00 0.00 0.00 3.96
2552 2565 0.531532 GATGAGCATCCACACCCGAG 60.532 60.000 0.00 0.00 31.76 4.63
2553 2566 0.977627 AGATGAGCATCCACACCCGA 60.978 55.000 6.84 0.00 38.58 5.14
2569 2582 2.093235 GCCTGTTGAGCAAGGTAGAGAT 60.093 50.000 0.00 0.00 0.00 2.75
2574 2587 0.320421 GACGCCTGTTGAGCAAGGTA 60.320 55.000 0.00 0.00 0.00 3.08
2575 2588 1.598130 GACGCCTGTTGAGCAAGGT 60.598 57.895 0.00 0.00 0.00 3.50
2576 2589 1.294659 GAGACGCCTGTTGAGCAAGG 61.295 60.000 0.00 0.00 0.00 3.61
2578 2591 1.664649 CGAGACGCCTGTTGAGCAA 60.665 57.895 0.00 0.00 0.00 3.91
2586 2599 3.966026 GAACCCGACGAGACGCCTG 62.966 68.421 0.00 0.00 0.00 4.85
2592 2605 1.077930 ATCCGAGAACCCGACGAGA 60.078 57.895 0.00 0.00 0.00 4.04
2602 2615 0.179111 GTGACGATGGCATCCGAGAA 60.179 55.000 21.20 0.75 0.00 2.87
2605 2618 1.685355 ATGGTGACGATGGCATCCGA 61.685 55.000 21.20 5.35 0.00 4.55
2607 2620 0.664761 CAATGGTGACGATGGCATCC 59.335 55.000 21.20 8.49 0.00 3.51
2624 2637 3.433343 ACAATGGCCAGATTGACATCAA 58.567 40.909 22.93 0.00 40.51 2.57
2628 2641 2.583024 TGACAATGGCCAGATTGACA 57.417 45.000 22.93 19.71 36.22 3.58
2629 2642 2.165030 CCTTGACAATGGCCAGATTGAC 59.835 50.000 22.93 17.60 36.89 3.18
2634 2647 1.067295 AGACCTTGACAATGGCCAGA 58.933 50.000 13.05 0.00 0.00 3.86
2659