Multiple sequence alignment - TraesCS6B01G004500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G004500 chr6B 100.000 2972 0 0 1 2972 3521570 3518599 0.000000e+00 5489
1 TraesCS6B01G004500 chr6B 93.706 2256 131 6 664 2915 423112797 423110549 0.000000e+00 3369
2 TraesCS6B01G004500 chr6A 98.923 2972 30 2 1 2972 406828 403859 0.000000e+00 5310
3 TraesCS6B01G004500 chr4A 95.194 2726 113 10 250 2972 542252853 542250143 0.000000e+00 4292
4 TraesCS6B01G004500 chr4A 94.489 2758 130 14 214 2969 439295643 439298380 0.000000e+00 4231
5 TraesCS6B01G004500 chr6D 93.189 2540 146 15 433 2969 137227837 137230352 0.000000e+00 3707
6 TraesCS6B01G004500 chr3B 90.397 2718 196 39 271 2972 79244575 79241907 0.000000e+00 3513
7 TraesCS6B01G004500 chr3B 90.222 2618 202 36 364 2972 751583733 751581161 0.000000e+00 3367
8 TraesCS6B01G004500 chr3B 85.476 420 42 10 242 657 751583750 751583346 1.270000e-113 420
9 TraesCS6B01G004500 chr3B 84.186 430 52 11 229 653 79244517 79244099 1.280000e-108 403
10 TraesCS6B01G004500 chr3B 95.510 245 11 0 1 245 751475190 751475434 2.780000e-105 392
11 TraesCS6B01G004500 chr3B 84.746 354 39 8 303 653 462249734 462250075 1.020000e-89 340
12 TraesCS6B01G004500 chr7B 92.830 2329 136 12 650 2972 164834235 164831932 0.000000e+00 3347
13 TraesCS6B01G004500 chr7B 83.910 665 63 21 4 657 164834746 164834115 1.970000e-166 595
14 TraesCS6B01G004500 chr3A 93.796 2192 127 8 781 2969 299404678 299406863 0.000000e+00 3286
15 TraesCS6B01G004500 chr3A 93.704 2192 129 8 781 2969 299358376 299360561 0.000000e+00 3275
16 TraesCS6B01G004500 chr1B 92.304 2326 150 18 650 2969 86407467 86409769 0.000000e+00 3277
17 TraesCS6B01G004500 chr1B 89.091 660 54 8 1 657 44034874 44035518 0.000000e+00 804
18 TraesCS6B01G004500 chr1B 83.857 669 64 21 1 658 86406953 86407588 5.480000e-167 597
19 TraesCS6B01G004500 chr5B 90.353 2094 143 31 329 2414 700809144 700807102 0.000000e+00 2693
20 TraesCS6B01G004500 chr5B 87.713 529 54 7 4 526 700809269 700808746 9.110000e-170 606
21 TraesCS6B01G004500 chr5D 93.976 498 21 1 4 501 166263721 166263233 0.000000e+00 745
22 TraesCS6B01G004500 chrUn 83.279 616 55 26 1 595 351698712 351699300 9.440000e-145 523
23 TraesCS6B01G004500 chr5A 82.545 613 58 27 4 595 673907006 673906422 7.400000e-136 494
24 TraesCS6B01G004500 chr3D 87.133 443 35 11 306 748 412183979 412183559 1.600000e-132 483


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G004500 chr6B 3518599 3521570 2971 True 5489.0 5489 100.0000 1 2972 1 chr6B.!!$R1 2971
1 TraesCS6B01G004500 chr6B 423110549 423112797 2248 True 3369.0 3369 93.7060 664 2915 1 chr6B.!!$R2 2251
2 TraesCS6B01G004500 chr6A 403859 406828 2969 True 5310.0 5310 98.9230 1 2972 1 chr6A.!!$R1 2971
3 TraesCS6B01G004500 chr4A 542250143 542252853 2710 True 4292.0 4292 95.1940 250 2972 1 chr4A.!!$R1 2722
4 TraesCS6B01G004500 chr4A 439295643 439298380 2737 False 4231.0 4231 94.4890 214 2969 1 chr4A.!!$F1 2755
5 TraesCS6B01G004500 chr6D 137227837 137230352 2515 False 3707.0 3707 93.1890 433 2969 1 chr6D.!!$F1 2536
6 TraesCS6B01G004500 chr3B 79241907 79244575 2668 True 1958.0 3513 87.2915 229 2972 2 chr3B.!!$R1 2743
7 TraesCS6B01G004500 chr3B 751581161 751583750 2589 True 1893.5 3367 87.8490 242 2972 2 chr3B.!!$R2 2730
8 TraesCS6B01G004500 chr7B 164831932 164834746 2814 True 1971.0 3347 88.3700 4 2972 2 chr7B.!!$R1 2968
9 TraesCS6B01G004500 chr3A 299404678 299406863 2185 False 3286.0 3286 93.7960 781 2969 1 chr3A.!!$F2 2188
10 TraesCS6B01G004500 chr3A 299358376 299360561 2185 False 3275.0 3275 93.7040 781 2969 1 chr3A.!!$F1 2188
11 TraesCS6B01G004500 chr1B 86406953 86409769 2816 False 1937.0 3277 88.0805 1 2969 2 chr1B.!!$F2 2968
12 TraesCS6B01G004500 chr1B 44034874 44035518 644 False 804.0 804 89.0910 1 657 1 chr1B.!!$F1 656
13 TraesCS6B01G004500 chr5B 700807102 700809269 2167 True 1649.5 2693 89.0330 4 2414 2 chr5B.!!$R1 2410
14 TraesCS6B01G004500 chrUn 351698712 351699300 588 False 523.0 523 83.2790 1 595 1 chrUn.!!$F1 594
15 TraesCS6B01G004500 chr5A 673906422 673907006 584 True 494.0 494 82.5450 4 595 1 chr5A.!!$R1 591

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
699 858 3.780294 TCCATATGTGGGCTTAGTCTGTT 59.22 43.478 8.84 0.0 46.06 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2422 2732 0.832135 AACTCTCCTTGGTCCGAGCA 60.832 55.0 0.0 0.0 0.0 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
439 553 7.742151 TGTGTGTCGAAAATATGATTTCTCTG 58.258 34.615 0.00 0.0 37.20 3.35
699 858 3.780294 TCCATATGTGGGCTTAGTCTGTT 59.220 43.478 8.84 0.0 46.06 3.16
1894 2203 1.995542 AGATCTCTTTGGCCCCTTCAA 59.004 47.619 0.00 0.0 0.00 2.69
1971 2280 7.337942 GCTTCCTCCTATGAGAAAAGAATTTGA 59.662 37.037 11.57 0.0 41.42 2.69
1995 2304 0.682292 TGCATTATATCGCGGGGTGA 59.318 50.000 6.13 0.0 0.00 4.02
2260 2570 0.846693 GGGTATGCTTCCATGGAGGT 59.153 55.000 23.56 8.8 39.02 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 1.654105 GCGTGCATGTCTACTGTACAC 59.346 52.381 7.93 0.0 0.0 2.90
699 858 0.107993 ATCGTCTCCACGGTCGTCTA 60.108 55.000 0.00 0.0 46.7 2.59
1194 1502 6.263168 CAGGTTTAGAATAAGGTGCTAATGGG 59.737 42.308 0.00 0.0 0.0 4.00
1666 1975 5.930837 TGAAAAGTCACACTCCCATTTTT 57.069 34.783 0.00 0.0 0.0 1.94
1971 2280 1.608025 CCCGCGATATAATGCACTGGT 60.608 52.381 8.23 0.0 0.0 4.00
1995 2304 6.552008 TGGTTTTCTCAGATAAAGACCCATT 58.448 36.000 8.70 0.0 0.0 3.16
2260 2570 5.349061 AGATCATCAACATCAGTAGCACA 57.651 39.130 0.00 0.0 0.0 4.57
2422 2732 0.832135 AACTCTCCTTGGTCCGAGCA 60.832 55.000 0.00 0.0 0.0 4.26


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.