Multiple sequence alignment - TraesCS6B01G003300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6B01G003300 chr6B 100.000 5028 0 0 1 5028 2468750 2463723 0.000000e+00 9286.0
1 TraesCS6B01G003300 chr6B 73.358 548 120 18 2614 3142 662502050 662501510 4.000000e-41 180.0
2 TraesCS6B01G003300 chr6B 93.333 75 5 0 3234 3308 2465451 2465377 1.480000e-20 111.0
3 TraesCS6B01G003300 chr6B 93.333 75 5 0 3300 3374 2465517 2465443 1.480000e-20 111.0
4 TraesCS6B01G003300 chr6B 93.333 60 4 0 651 710 43433457 43433516 6.930000e-14 89.8
5 TraesCS6B01G003300 chr6B 93.333 60 4 0 651 710 43472087 43472146 6.930000e-14 89.8
6 TraesCS6B01G003300 chrUn 88.394 1189 99 23 1056 2229 255186683 255187847 0.000000e+00 1395.0
7 TraesCS6B01G003300 chrUn 88.550 1179 98 21 1065 2229 274819495 274818340 0.000000e+00 1395.0
8 TraesCS6B01G003300 chrUn 93.374 815 50 2 2364 3177 255188051 255188862 0.000000e+00 1203.0
9 TraesCS6B01G003300 chrUn 93.374 815 50 2 2364 3177 274818136 274817325 0.000000e+00 1203.0
10 TraesCS6B01G003300 chrUn 82.385 1107 117 40 3539 4593 255188952 255190032 0.000000e+00 893.0
11 TraesCS6B01G003300 chrUn 82.428 1104 116 39 3542 4593 274817232 274816155 0.000000e+00 893.0
12 TraesCS6B01G003300 chr5B 83.296 886 127 12 2341 3211 528125706 528124827 0.000000e+00 797.0
13 TraesCS6B01G003300 chr5B 83.607 244 28 7 3425 3656 528124580 528124337 8.480000e-53 219.0
14 TraesCS6B01G003300 chr5B 83.425 181 28 2 3670 3849 528124260 528124081 3.110000e-37 167.0
15 TraesCS6B01G003300 chr5D 83.737 867 114 19 2364 3211 434929215 434928357 0.000000e+00 795.0
16 TraesCS6B01G003300 chr5D 84.472 161 23 2 3670 3829 434927784 434927625 1.870000e-34 158.0
17 TraesCS6B01G003300 chr6D 88.129 497 52 7 1 493 348286006 348286499 7.250000e-163 584.0
18 TraesCS6B01G003300 chr4D 88.072 503 47 12 1 493 89936115 89935616 7.250000e-163 584.0
19 TraesCS6B01G003300 chr4D 87.726 497 55 6 1 493 312734532 312735026 4.370000e-160 575.0
20 TraesCS6B01G003300 chr4D 87.525 497 55 7 1 493 432403196 432402703 7.310000e-158 568.0
21 TraesCS6B01G003300 chr3D 87.976 499 50 10 1 493 132572094 132571600 9.380000e-162 580.0
22 TraesCS6B01G003300 chr3D 87.652 494 57 4 3 493 421579330 421579822 5.650000e-159 571.0
23 TraesCS6B01G003300 chr1A 87.751 498 54 7 1 493 132409574 132410069 4.370000e-160 575.0
24 TraesCS6B01G003300 chr4A 87.575 499 53 9 2 493 164612143 164611647 2.030000e-158 569.0
25 TraesCS6B01G003300 chr7D 87.525 497 55 7 1 493 401187156 401186663 7.310000e-158 568.0
26 TraesCS6B01G003300 chr7D 76.478 812 144 26 2374 3144 179995259 179996064 1.010000e-106 398.0
27 TraesCS6B01G003300 chr7B 76.724 812 142 26 2374 3144 145797413 145798218 4.690000e-110 409.0
28 TraesCS6B01G003300 chr5A 73.926 675 127 25 1382 2024 548926074 548925417 5.060000e-55 226.0
29 TraesCS6B01G003300 chr5A 81.538 260 31 3 3414 3656 548892712 548892453 1.100000e-46 198.0
30 TraesCS6B01G003300 chr5A 85.340 191 24 4 3670 3858 548792586 548792398 1.430000e-45 195.0
31 TraesCS6B01G003300 chr5A 81.132 265 28 6 3414 3656 548792927 548792663 5.140000e-45 193.0
32 TraesCS6B01G003300 chr5A 84.817 191 25 4 3670 3858 548892376 548892188 6.650000e-44 189.0
33 TraesCS6B01G003300 chr2A 75.000 368 63 19 2813 3158 16832127 16832487 5.250000e-30 143.0
34 TraesCS6B01G003300 chr2A 77.255 255 44 11 2911 3158 16821641 16821888 2.440000e-28 137.0
35 TraesCS6B01G003300 chr2D 76.793 237 47 8 2911 3143 14746833 14747065 5.280000e-25 126.0
36 TraesCS6B01G003300 chr7A 89.535 86 6 2 639 722 729319276 729319192 6.880000e-19 106.0
37 TraesCS6B01G003300 chr2B 88.235 85 6 3 639 721 753010213 753010295 1.150000e-16 99.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6B01G003300 chr6B 2463723 2468750 5027 True 3169.333333 9286 95.555333 1 5028 3 chr6B.!!$R2 5027
1 TraesCS6B01G003300 chrUn 255186683 255190032 3349 False 1163.666667 1395 88.051000 1056 4593 3 chrUn.!!$F1 3537
2 TraesCS6B01G003300 chrUn 274816155 274819495 3340 True 1163.666667 1395 88.117333 1065 4593 3 chrUn.!!$R1 3528
3 TraesCS6B01G003300 chr5B 528124081 528125706 1625 True 394.333333 797 83.442667 2341 3849 3 chr5B.!!$R1 1508
4 TraesCS6B01G003300 chr5D 434927625 434929215 1590 True 476.500000 795 84.104500 2364 3829 2 chr5D.!!$R1 1465
5 TraesCS6B01G003300 chr7D 179995259 179996064 805 False 398.000000 398 76.478000 2374 3144 1 chr7D.!!$F1 770
6 TraesCS6B01G003300 chr7B 145797413 145798218 805 False 409.000000 409 76.724000 2374 3144 1 chr7B.!!$F1 770
7 TraesCS6B01G003300 chr5A 548925417 548926074 657 True 226.000000 226 73.926000 1382 2024 1 chr5A.!!$R1 642


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
704 705 0.032678 CCGGCTAGCTTGATCACGAT 59.967 55.0 15.72 0.00 0.00 3.73 F
1552 1558 0.109086 CGACCATGACGAGCTCAGTT 60.109 55.0 15.40 0.00 30.20 3.16 F
2236 2285 0.105709 TGCTGGACCGATCCTATCCA 60.106 55.0 0.00 6.97 46.43 3.41 F
3075 3245 0.109458 CACTCTACTTGTGCGCGGTA 60.109 55.0 8.83 0.00 0.00 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2235 2284 0.095589 TATTACCGCGCGTTTTGCTG 59.904 50.0 29.95 13.89 43.27 4.41 R
3270 3440 0.029300 GCGCTGTTGTTTCTTGCTCA 59.971 50.0 0.00 0.00 0.00 4.26 R
3336 3506 0.029300 GCGCTGTTGTTTCTTGCTCA 59.971 50.0 0.00 0.00 0.00 4.26 R
4858 5228 0.037605 ACTAGTGTAACGCAGCACCC 60.038 55.0 0.00 0.00 45.86 4.61 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 51 1.512694 CGGAGGGCAAAAATGCTCC 59.487 57.895 0.00 0.00 35.49 4.70
51 52 1.250154 CGGAGGGCAAAAATGCTCCA 61.250 55.000 0.00 0.00 35.49 3.86
52 53 0.533951 GGAGGGCAAAAATGCTCCAG 59.466 55.000 0.00 0.00 35.49 3.86
53 54 0.108472 GAGGGCAAAAATGCTCCAGC 60.108 55.000 0.00 0.00 35.49 4.85
54 55 1.078918 GGGCAAAAATGCTCCAGCC 60.079 57.895 0.40 0.00 41.18 4.85
55 56 1.078918 GGCAAAAATGCTCCAGCCC 60.079 57.895 0.40 0.00 41.18 5.19
56 57 1.672898 GCAAAAATGCTCCAGCCCA 59.327 52.632 0.00 0.00 41.18 5.36
57 58 0.251073 GCAAAAATGCTCCAGCCCAT 59.749 50.000 0.00 0.00 41.18 4.00
58 59 2.010043 GCAAAAATGCTCCAGCCCATG 61.010 52.381 0.00 0.00 41.18 3.66
59 60 1.276989 CAAAAATGCTCCAGCCCATGT 59.723 47.619 0.00 0.00 41.18 3.21
60 61 1.648116 AAAATGCTCCAGCCCATGTT 58.352 45.000 0.00 0.00 41.18 2.71
61 62 2.530460 AAATGCTCCAGCCCATGTTA 57.470 45.000 0.00 0.00 41.18 2.41
62 63 1.767759 AATGCTCCAGCCCATGTTAC 58.232 50.000 0.00 0.00 41.18 2.50
63 64 0.464373 ATGCTCCAGCCCATGTTACG 60.464 55.000 0.00 0.00 41.18 3.18
64 65 2.472909 GCTCCAGCCCATGTTACGC 61.473 63.158 0.00 0.00 34.31 4.42
65 66 1.819632 CTCCAGCCCATGTTACGCC 60.820 63.158 0.00 0.00 0.00 5.68
66 67 2.257409 CTCCAGCCCATGTTACGCCT 62.257 60.000 0.00 0.00 0.00 5.52
67 68 1.378514 CCAGCCCATGTTACGCCTT 60.379 57.895 0.00 0.00 0.00 4.35
68 69 1.656818 CCAGCCCATGTTACGCCTTG 61.657 60.000 0.00 0.00 0.00 3.61
69 70 0.676466 CAGCCCATGTTACGCCTTGA 60.676 55.000 0.00 0.00 0.00 3.02
70 71 0.392998 AGCCCATGTTACGCCTTGAG 60.393 55.000 0.00 0.00 0.00 3.02
71 72 0.392461 GCCCATGTTACGCCTTGAGA 60.392 55.000 0.00 0.00 0.00 3.27
72 73 1.369625 CCCATGTTACGCCTTGAGAC 58.630 55.000 0.00 0.00 0.00 3.36
73 74 0.999406 CCATGTTACGCCTTGAGACG 59.001 55.000 0.00 0.00 0.00 4.18
74 75 0.999406 CATGTTACGCCTTGAGACGG 59.001 55.000 0.00 0.00 0.00 4.79
75 76 0.739813 ATGTTACGCCTTGAGACGGC 60.740 55.000 0.00 0.00 44.11 5.68
93 94 4.403976 GGCGCTCCGTCTCTAAAG 57.596 61.111 7.64 0.00 0.00 1.85
94 95 1.511768 GGCGCTCCGTCTCTAAAGT 59.488 57.895 7.64 0.00 0.00 2.66
95 96 0.525882 GGCGCTCCGTCTCTAAAGTC 60.526 60.000 7.64 0.00 0.00 3.01
96 97 0.452585 GCGCTCCGTCTCTAAAGTCT 59.547 55.000 0.00 0.00 0.00 3.24
97 98 1.532298 GCGCTCCGTCTCTAAAGTCTC 60.532 57.143 0.00 0.00 0.00 3.36
98 99 1.064357 CGCTCCGTCTCTAAAGTCTCC 59.936 57.143 0.00 0.00 0.00 3.71
99 100 2.371306 GCTCCGTCTCTAAAGTCTCCT 58.629 52.381 0.00 0.00 0.00 3.69
100 101 2.356695 GCTCCGTCTCTAAAGTCTCCTC 59.643 54.545 0.00 0.00 0.00 3.71
101 102 2.946990 CTCCGTCTCTAAAGTCTCCTCC 59.053 54.545 0.00 0.00 0.00 4.30
102 103 2.577105 TCCGTCTCTAAAGTCTCCTCCT 59.423 50.000 0.00 0.00 0.00 3.69
103 104 3.010361 TCCGTCTCTAAAGTCTCCTCCTT 59.990 47.826 0.00 0.00 0.00 3.36
104 105 4.226846 TCCGTCTCTAAAGTCTCCTCCTTA 59.773 45.833 0.00 0.00 0.00 2.69
105 106 4.948621 CCGTCTCTAAAGTCTCCTCCTTAA 59.051 45.833 0.00 0.00 0.00 1.85
106 107 5.595133 CCGTCTCTAAAGTCTCCTCCTTAAT 59.405 44.000 0.00 0.00 0.00 1.40
107 108 6.771749 CCGTCTCTAAAGTCTCCTCCTTAATA 59.228 42.308 0.00 0.00 0.00 0.98
108 109 7.284944 CCGTCTCTAAAGTCTCCTCCTTAATAA 59.715 40.741 0.00 0.00 0.00 1.40
109 110 8.852135 CGTCTCTAAAGTCTCCTCCTTAATAAT 58.148 37.037 0.00 0.00 0.00 1.28
118 119 9.280456 AGTCTCCTCCTTAATAATTTTAGGTCA 57.720 33.333 0.00 0.00 34.06 4.02
119 120 9.901172 GTCTCCTCCTTAATAATTTTAGGTCAA 57.099 33.333 0.00 0.00 34.06 3.18
139 140 9.838339 AGGTCAAAATGACTTATATACCAGAAG 57.162 33.333 10.06 0.00 46.19 2.85
140 141 9.832445 GGTCAAAATGACTTATATACCAGAAGA 57.168 33.333 10.06 0.00 46.19 2.87
142 143 9.529325 TCAAAATGACTTATATACCAGAAGACG 57.471 33.333 0.00 0.00 0.00 4.18
143 144 8.765219 CAAAATGACTTATATACCAGAAGACGG 58.235 37.037 0.00 0.00 0.00 4.79
144 145 6.591750 ATGACTTATATACCAGAAGACGGG 57.408 41.667 0.00 0.00 37.39 5.28
145 146 4.280174 TGACTTATATACCAGAAGACGGGC 59.720 45.833 0.00 0.00 34.79 6.13
146 147 4.220724 ACTTATATACCAGAAGACGGGCA 58.779 43.478 0.00 0.00 34.79 5.36
147 148 4.038883 ACTTATATACCAGAAGACGGGCAC 59.961 45.833 0.00 0.00 34.79 5.01
148 149 2.154567 TATACCAGAAGACGGGCACT 57.845 50.000 0.00 0.00 34.79 4.40
149 150 0.537188 ATACCAGAAGACGGGCACTG 59.463 55.000 1.88 1.88 42.99 3.66
150 151 2.046892 CCAGAAGACGGGCACTGG 60.047 66.667 11.55 11.55 42.71 4.00
151 152 2.743718 CAGAAGACGGGCACTGGT 59.256 61.111 1.04 0.00 40.47 4.00
152 153 1.669115 CAGAAGACGGGCACTGGTG 60.669 63.158 0.00 0.00 40.47 4.17
153 154 2.358737 GAAGACGGGCACTGGTGG 60.359 66.667 2.84 0.00 40.47 4.61
154 155 3.168528 AAGACGGGCACTGGTGGT 61.169 61.111 2.84 0.00 40.47 4.16
162 163 4.704833 CACTGGTGGTGGGCCGAG 62.705 72.222 0.00 0.00 41.90 4.63
229 230 3.128375 GGTTGTGCCCACTTGGTG 58.872 61.111 0.00 0.00 36.04 4.17
238 239 3.260100 CACTTGGTGGGCCCCTCT 61.260 66.667 22.27 0.00 0.00 3.69
239 240 3.260100 ACTTGGTGGGCCCCTCTG 61.260 66.667 22.27 8.38 0.00 3.35
240 241 4.052518 CTTGGTGGGCCCCTCTGG 62.053 72.222 22.27 2.67 37.09 3.86
241 242 4.938756 TTGGTGGGCCCCTCTGGT 62.939 66.667 22.27 0.00 36.04 4.00
242 243 3.508786 TTGGTGGGCCCCTCTGGTA 62.509 63.158 22.27 0.00 36.04 3.25
243 244 3.408853 GGTGGGCCCCTCTGGTAC 61.409 72.222 22.27 8.70 36.04 3.34
244 245 2.285442 GTGGGCCCCTCTGGTACT 60.285 66.667 22.27 0.00 36.04 2.73
245 246 1.923909 GTGGGCCCCTCTGGTACTT 60.924 63.158 22.27 0.00 36.04 2.24
246 247 0.619543 GTGGGCCCCTCTGGTACTTA 60.620 60.000 22.27 0.00 36.04 2.24
247 248 0.345502 TGGGCCCCTCTGGTACTTAT 59.654 55.000 22.27 0.00 36.04 1.73
248 249 1.274767 TGGGCCCCTCTGGTACTTATT 60.275 52.381 22.27 0.00 36.04 1.40
249 250 1.850998 GGGCCCCTCTGGTACTTATTT 59.149 52.381 12.23 0.00 36.04 1.40
250 251 2.422945 GGGCCCCTCTGGTACTTATTTG 60.423 54.545 12.23 0.00 36.04 2.32
251 252 2.298610 GCCCCTCTGGTACTTATTTGC 58.701 52.381 0.00 0.00 36.04 3.68
252 253 2.092375 GCCCCTCTGGTACTTATTTGCT 60.092 50.000 0.00 0.00 36.04 3.91
253 254 3.624959 GCCCCTCTGGTACTTATTTGCTT 60.625 47.826 0.00 0.00 36.04 3.91
254 255 4.200092 CCCCTCTGGTACTTATTTGCTTC 58.800 47.826 0.00 0.00 0.00 3.86
255 256 4.324254 CCCCTCTGGTACTTATTTGCTTCA 60.324 45.833 0.00 0.00 0.00 3.02
256 257 5.253330 CCCTCTGGTACTTATTTGCTTCAA 58.747 41.667 0.00 0.00 0.00 2.69
257 258 5.888161 CCCTCTGGTACTTATTTGCTTCAAT 59.112 40.000 0.00 0.00 0.00 2.57
258 259 7.054124 CCCTCTGGTACTTATTTGCTTCAATA 58.946 38.462 0.00 0.00 0.00 1.90
259 260 7.556275 CCCTCTGGTACTTATTTGCTTCAATAA 59.444 37.037 0.00 0.00 0.00 1.40
260 261 9.125026 CCTCTGGTACTTATTTGCTTCAATAAT 57.875 33.333 0.00 0.00 0.00 1.28
263 264 9.736023 CTGGTACTTATTTGCTTCAATAATTCC 57.264 33.333 0.00 0.00 0.00 3.01
264 265 9.474313 TGGTACTTATTTGCTTCAATAATTCCT 57.526 29.630 0.00 0.00 0.00 3.36
300 301 5.629079 AAAATCCTCCGTGAAGTTTCATC 57.371 39.130 0.00 0.00 39.73 2.92
301 302 4.559862 AATCCTCCGTGAAGTTTCATCT 57.440 40.909 0.00 0.00 39.73 2.90
302 303 3.594603 TCCTCCGTGAAGTTTCATCTC 57.405 47.619 0.00 0.00 39.73 2.75
303 304 2.897326 TCCTCCGTGAAGTTTCATCTCA 59.103 45.455 0.00 0.00 39.73 3.27
304 305 3.515502 TCCTCCGTGAAGTTTCATCTCAT 59.484 43.478 0.00 0.00 39.73 2.90
305 306 4.020218 TCCTCCGTGAAGTTTCATCTCATT 60.020 41.667 0.00 0.00 39.73 2.57
306 307 4.697352 CCTCCGTGAAGTTTCATCTCATTT 59.303 41.667 0.00 0.00 39.73 2.32
307 308 5.163814 CCTCCGTGAAGTTTCATCTCATTTC 60.164 44.000 0.00 0.00 39.73 2.17
308 309 5.304778 TCCGTGAAGTTTCATCTCATTTCA 58.695 37.500 0.00 0.00 39.73 2.69
309 310 5.762711 TCCGTGAAGTTTCATCTCATTTCAA 59.237 36.000 0.00 0.00 39.73 2.69
310 311 6.073058 TCCGTGAAGTTTCATCTCATTTCAAG 60.073 38.462 0.00 0.00 39.73 3.02
311 312 6.293626 CCGTGAAGTTTCATCTCATTTCAAGT 60.294 38.462 0.00 0.00 39.73 3.16
312 313 7.134815 CGTGAAGTTTCATCTCATTTCAAGTT 58.865 34.615 0.00 0.00 39.73 2.66
313 314 7.112565 CGTGAAGTTTCATCTCATTTCAAGTTG 59.887 37.037 0.00 0.00 39.73 3.16
314 315 7.917505 GTGAAGTTTCATCTCATTTCAAGTTGT 59.082 33.333 2.11 0.00 39.73 3.32
315 316 7.916977 TGAAGTTTCATCTCATTTCAAGTTGTG 59.083 33.333 2.11 0.00 31.01 3.33
316 317 6.211515 AGTTTCATCTCATTTCAAGTTGTGC 58.788 36.000 2.11 0.00 0.00 4.57
317 318 4.408993 TCATCTCATTTCAAGTTGTGCG 57.591 40.909 2.11 0.00 0.00 5.34
318 319 3.189080 TCATCTCATTTCAAGTTGTGCGG 59.811 43.478 2.11 0.00 0.00 5.69
319 320 2.844946 TCTCATTTCAAGTTGTGCGGA 58.155 42.857 2.11 0.00 0.00 5.54
320 321 3.210227 TCTCATTTCAAGTTGTGCGGAA 58.790 40.909 2.11 0.00 0.00 4.30
321 322 3.820467 TCTCATTTCAAGTTGTGCGGAAT 59.180 39.130 2.11 0.00 0.00 3.01
322 323 5.000591 TCTCATTTCAAGTTGTGCGGAATA 58.999 37.500 2.11 0.00 0.00 1.75
323 324 5.122239 TCTCATTTCAAGTTGTGCGGAATAG 59.878 40.000 2.11 0.00 0.00 1.73
324 325 4.155826 TCATTTCAAGTTGTGCGGAATAGG 59.844 41.667 2.11 0.00 0.00 2.57
325 326 2.851263 TCAAGTTGTGCGGAATAGGT 57.149 45.000 2.11 0.00 0.00 3.08
326 327 3.965379 TCAAGTTGTGCGGAATAGGTA 57.035 42.857 2.11 0.00 0.00 3.08
327 328 3.857052 TCAAGTTGTGCGGAATAGGTAG 58.143 45.455 2.11 0.00 0.00 3.18
328 329 3.259876 TCAAGTTGTGCGGAATAGGTAGT 59.740 43.478 2.11 0.00 0.00 2.73
329 330 3.521947 AGTTGTGCGGAATAGGTAGTC 57.478 47.619 0.00 0.00 0.00 2.59
330 331 3.097614 AGTTGTGCGGAATAGGTAGTCT 58.902 45.455 0.00 0.00 0.00 3.24
331 332 3.119101 AGTTGTGCGGAATAGGTAGTCTG 60.119 47.826 0.00 0.00 0.00 3.51
332 333 1.754803 TGTGCGGAATAGGTAGTCTGG 59.245 52.381 0.00 0.00 0.00 3.86
333 334 1.068741 GTGCGGAATAGGTAGTCTGGG 59.931 57.143 0.00 0.00 0.00 4.45
334 335 1.342674 TGCGGAATAGGTAGTCTGGGT 60.343 52.381 0.00 0.00 0.00 4.51
335 336 1.761198 GCGGAATAGGTAGTCTGGGTT 59.239 52.381 0.00 0.00 0.00 4.11
336 337 2.483188 GCGGAATAGGTAGTCTGGGTTG 60.483 54.545 0.00 0.00 0.00 3.77
337 338 2.483188 CGGAATAGGTAGTCTGGGTTGC 60.483 54.545 0.00 0.00 0.00 4.17
338 339 2.772515 GGAATAGGTAGTCTGGGTTGCT 59.227 50.000 0.00 0.00 0.00 3.91
339 340 3.200165 GGAATAGGTAGTCTGGGTTGCTT 59.800 47.826 0.00 0.00 0.00 3.91
340 341 4.324331 GGAATAGGTAGTCTGGGTTGCTTT 60.324 45.833 0.00 0.00 0.00 3.51
341 342 4.929146 ATAGGTAGTCTGGGTTGCTTTT 57.071 40.909 0.00 0.00 0.00 2.27
342 343 3.595190 AGGTAGTCTGGGTTGCTTTTT 57.405 42.857 0.00 0.00 0.00 1.94
343 344 4.717279 AGGTAGTCTGGGTTGCTTTTTA 57.283 40.909 0.00 0.00 0.00 1.52
344 345 5.056553 AGGTAGTCTGGGTTGCTTTTTAA 57.943 39.130 0.00 0.00 0.00 1.52
345 346 5.070685 AGGTAGTCTGGGTTGCTTTTTAAG 58.929 41.667 0.00 0.00 0.00 1.85
346 347 4.217767 GGTAGTCTGGGTTGCTTTTTAAGG 59.782 45.833 0.00 0.00 0.00 2.69
347 348 3.910989 AGTCTGGGTTGCTTTTTAAGGT 58.089 40.909 0.00 0.00 0.00 3.50
348 349 4.286707 AGTCTGGGTTGCTTTTTAAGGTT 58.713 39.130 0.00 0.00 0.00 3.50
349 350 4.341235 AGTCTGGGTTGCTTTTTAAGGTTC 59.659 41.667 0.00 0.00 0.00 3.62
350 351 4.098807 GTCTGGGTTGCTTTTTAAGGTTCA 59.901 41.667 0.00 0.00 0.00 3.18
351 352 4.712337 TCTGGGTTGCTTTTTAAGGTTCAA 59.288 37.500 0.00 0.00 0.00 2.69
352 353 5.187967 TCTGGGTTGCTTTTTAAGGTTCAAA 59.812 36.000 0.00 0.00 0.00 2.69
353 354 5.805728 TGGGTTGCTTTTTAAGGTTCAAAA 58.194 33.333 0.00 0.00 0.00 2.44
354 355 6.418946 TGGGTTGCTTTTTAAGGTTCAAAAT 58.581 32.000 0.00 0.00 0.00 1.82
355 356 6.887002 TGGGTTGCTTTTTAAGGTTCAAAATT 59.113 30.769 0.00 0.00 0.00 1.82
356 357 7.394641 TGGGTTGCTTTTTAAGGTTCAAAATTT 59.605 29.630 0.00 0.00 0.00 1.82
357 358 7.913297 GGGTTGCTTTTTAAGGTTCAAAATTTC 59.087 33.333 0.00 0.00 0.00 2.17
358 359 8.454894 GGTTGCTTTTTAAGGTTCAAAATTTCA 58.545 29.630 0.00 0.00 0.00 2.69
359 360 9.489393 GTTGCTTTTTAAGGTTCAAAATTTCAG 57.511 29.630 0.00 0.00 0.00 3.02
360 361 7.693020 TGCTTTTTAAGGTTCAAAATTTCAGC 58.307 30.769 0.00 0.00 30.82 4.26
361 362 7.552330 TGCTTTTTAAGGTTCAAAATTTCAGCT 59.448 29.630 0.00 0.00 31.20 4.24
362 363 7.852454 GCTTTTTAAGGTTCAAAATTTCAGCTG 59.148 33.333 7.63 7.63 29.01 4.24
363 364 6.843069 TTTAAGGTTCAAAATTTCAGCTGC 57.157 33.333 9.47 0.00 0.00 5.25
364 365 3.391506 AGGTTCAAAATTTCAGCTGCC 57.608 42.857 9.47 0.00 0.00 4.85
365 366 2.061028 GGTTCAAAATTTCAGCTGCCG 58.939 47.619 9.47 0.00 0.00 5.69
366 367 2.061028 GTTCAAAATTTCAGCTGCCGG 58.939 47.619 9.47 0.00 0.00 6.13
367 368 1.327303 TCAAAATTTCAGCTGCCGGT 58.673 45.000 9.47 0.00 0.00 5.28
368 369 2.509569 TCAAAATTTCAGCTGCCGGTA 58.490 42.857 9.47 0.00 0.00 4.02
369 370 3.088532 TCAAAATTTCAGCTGCCGGTAT 58.911 40.909 9.47 0.00 0.00 2.73
370 371 3.509575 TCAAAATTTCAGCTGCCGGTATT 59.490 39.130 9.47 1.09 0.00 1.89
371 372 3.782889 AAATTTCAGCTGCCGGTATTC 57.217 42.857 9.47 0.00 0.00 1.75
372 373 2.717639 ATTTCAGCTGCCGGTATTCT 57.282 45.000 9.47 0.00 0.00 2.40
373 374 2.024176 TTTCAGCTGCCGGTATTCTC 57.976 50.000 9.47 0.00 0.00 2.87
374 375 0.178068 TTCAGCTGCCGGTATTCTCC 59.822 55.000 9.47 0.00 0.00 3.71
375 376 1.227674 CAGCTGCCGGTATTCTCCC 60.228 63.158 0.00 0.00 0.00 4.30
376 377 1.383248 AGCTGCCGGTATTCTCCCT 60.383 57.895 1.90 0.00 0.00 4.20
377 378 1.069935 GCTGCCGGTATTCTCCCTC 59.930 63.158 1.90 0.00 0.00 4.30
378 379 1.403687 GCTGCCGGTATTCTCCCTCT 61.404 60.000 1.90 0.00 0.00 3.69
379 380 1.123928 CTGCCGGTATTCTCCCTCTT 58.876 55.000 1.90 0.00 0.00 2.85
380 381 0.830648 TGCCGGTATTCTCCCTCTTG 59.169 55.000 1.90 0.00 0.00 3.02
381 382 1.120530 GCCGGTATTCTCCCTCTTGA 58.879 55.000 1.90 0.00 0.00 3.02
382 383 1.694696 GCCGGTATTCTCCCTCTTGAT 59.305 52.381 1.90 0.00 0.00 2.57
383 384 2.548920 GCCGGTATTCTCCCTCTTGATG 60.549 54.545 1.90 0.00 0.00 3.07
384 385 2.700897 CCGGTATTCTCCCTCTTGATGT 59.299 50.000 0.00 0.00 0.00 3.06
385 386 3.895656 CCGGTATTCTCCCTCTTGATGTA 59.104 47.826 0.00 0.00 0.00 2.29
386 387 4.344102 CCGGTATTCTCCCTCTTGATGTAA 59.656 45.833 0.00 0.00 0.00 2.41
387 388 5.163343 CCGGTATTCTCCCTCTTGATGTAAA 60.163 44.000 0.00 0.00 0.00 2.01
388 389 5.753921 CGGTATTCTCCCTCTTGATGTAAAC 59.246 44.000 0.00 0.00 0.00 2.01
389 390 6.056236 GGTATTCTCCCTCTTGATGTAAACC 58.944 44.000 0.00 0.00 0.00 3.27
390 391 6.126739 GGTATTCTCCCTCTTGATGTAAACCT 60.127 42.308 0.00 0.00 0.00 3.50
391 392 5.843019 TTCTCCCTCTTGATGTAAACCTT 57.157 39.130 0.00 0.00 0.00 3.50
392 393 5.165961 TCTCCCTCTTGATGTAAACCTTG 57.834 43.478 0.00 0.00 0.00 3.61
393 394 3.686016 TCCCTCTTGATGTAAACCTTGC 58.314 45.455 0.00 0.00 0.00 4.01
394 395 3.073798 TCCCTCTTGATGTAAACCTTGCA 59.926 43.478 0.00 0.00 0.00 4.08
395 396 4.019174 CCCTCTTGATGTAAACCTTGCAT 58.981 43.478 0.00 0.00 38.74 3.96
396 397 5.045213 TCCCTCTTGATGTAAACCTTGCATA 60.045 40.000 0.00 0.00 36.07 3.14
397 398 5.829924 CCCTCTTGATGTAAACCTTGCATAT 59.170 40.000 0.00 0.00 36.07 1.78
398 399 6.322201 CCCTCTTGATGTAAACCTTGCATATT 59.678 38.462 0.00 0.00 36.07 1.28
399 400 7.502226 CCCTCTTGATGTAAACCTTGCATATTA 59.498 37.037 0.00 0.00 36.07 0.98
400 401 9.071276 CCTCTTGATGTAAACCTTGCATATTAT 57.929 33.333 0.00 0.00 36.07 1.28
401 402 9.888878 CTCTTGATGTAAACCTTGCATATTATG 57.111 33.333 0.00 0.00 36.07 1.90
402 403 9.625747 TCTTGATGTAAACCTTGCATATTATGA 57.374 29.630 7.87 0.00 36.07 2.15
403 404 9.888878 CTTGATGTAAACCTTGCATATTATGAG 57.111 33.333 7.87 0.00 36.07 2.90
404 405 9.625747 TTGATGTAAACCTTGCATATTATGAGA 57.374 29.630 7.87 0.00 36.07 3.27
405 406 9.276590 TGATGTAAACCTTGCATATTATGAGAG 57.723 33.333 7.87 4.26 36.07 3.20
406 407 9.494271 GATGTAAACCTTGCATATTATGAGAGA 57.506 33.333 7.87 0.00 36.07 3.10
407 408 9.851686 ATGTAAACCTTGCATATTATGAGAGAA 57.148 29.630 7.87 0.00 34.10 2.87
408 409 9.679661 TGTAAACCTTGCATATTATGAGAGAAA 57.320 29.630 7.87 0.00 0.00 2.52
411 412 7.814264 ACCTTGCATATTATGAGAGAAAAGG 57.186 36.000 7.87 10.77 37.16 3.11
412 413 7.349598 ACCTTGCATATTATGAGAGAAAAGGT 58.650 34.615 7.87 11.26 39.00 3.50
413 414 8.494433 ACCTTGCATATTATGAGAGAAAAGGTA 58.506 33.333 7.87 0.00 41.31 3.08
414 415 9.512588 CCTTGCATATTATGAGAGAAAAGGTAT 57.487 33.333 7.87 0.00 0.00 2.73
483 484 9.979578 AAATAACAGTAGAAAAACATGATGCAA 57.020 25.926 0.00 0.00 0.00 4.08
484 485 9.979578 AATAACAGTAGAAAAACATGATGCAAA 57.020 25.926 0.00 0.00 0.00 3.68
485 486 9.979578 ATAACAGTAGAAAAACATGATGCAAAA 57.020 25.926 0.00 0.00 0.00 2.44
486 487 8.891671 AACAGTAGAAAAACATGATGCAAAAT 57.108 26.923 0.00 0.00 0.00 1.82
487 488 8.301730 ACAGTAGAAAAACATGATGCAAAATG 57.698 30.769 0.00 9.74 0.00 2.32
488 489 7.385752 ACAGTAGAAAAACATGATGCAAAATGG 59.614 33.333 14.45 0.00 0.00 3.16
489 490 7.599621 CAGTAGAAAAACATGATGCAAAATGGA 59.400 33.333 14.45 0.00 0.00 3.41
490 491 6.790285 AGAAAAACATGATGCAAAATGGAC 57.210 33.333 14.45 3.78 0.00 4.02
491 492 5.406175 AGAAAAACATGATGCAAAATGGACG 59.594 36.000 14.45 0.00 0.00 4.79
492 493 3.940209 AACATGATGCAAAATGGACGT 57.060 38.095 14.45 0.00 0.00 4.34
493 494 3.220507 ACATGATGCAAAATGGACGTG 57.779 42.857 14.45 0.00 0.00 4.49
494 495 2.557924 ACATGATGCAAAATGGACGTGT 59.442 40.909 14.45 0.00 0.00 4.49
495 496 2.702898 TGATGCAAAATGGACGTGTG 57.297 45.000 0.00 0.00 0.00 3.82
496 497 1.952990 TGATGCAAAATGGACGTGTGT 59.047 42.857 0.00 0.00 0.00 3.72
497 498 2.031245 TGATGCAAAATGGACGTGTGTC 60.031 45.455 0.00 0.00 44.72 3.67
509 510 4.923264 GACGTGTGTCCTTATTTTCCTC 57.077 45.455 0.00 0.00 39.30 3.71
510 511 3.671716 ACGTGTGTCCTTATTTTCCTCC 58.328 45.455 0.00 0.00 0.00 4.30
511 512 3.326880 ACGTGTGTCCTTATTTTCCTCCT 59.673 43.478 0.00 0.00 0.00 3.69
512 513 4.202430 ACGTGTGTCCTTATTTTCCTCCTT 60.202 41.667 0.00 0.00 0.00 3.36
513 514 5.012354 ACGTGTGTCCTTATTTTCCTCCTTA 59.988 40.000 0.00 0.00 0.00 2.69
514 515 6.113411 CGTGTGTCCTTATTTTCCTCCTTAT 58.887 40.000 0.00 0.00 0.00 1.73
515 516 6.598064 CGTGTGTCCTTATTTTCCTCCTTATT 59.402 38.462 0.00 0.00 0.00 1.40
516 517 7.414098 CGTGTGTCCTTATTTTCCTCCTTATTG 60.414 40.741 0.00 0.00 0.00 1.90
517 518 7.610305 GTGTGTCCTTATTTTCCTCCTTATTGA 59.390 37.037 0.00 0.00 0.00 2.57
518 519 8.336235 TGTGTCCTTATTTTCCTCCTTATTGAT 58.664 33.333 0.00 0.00 0.00 2.57
519 520 9.190317 GTGTCCTTATTTTCCTCCTTATTGATT 57.810 33.333 0.00 0.00 0.00 2.57
520 521 9.768215 TGTCCTTATTTTCCTCCTTATTGATTT 57.232 29.630 0.00 0.00 0.00 2.17
529 530 9.762933 TTTCCTCCTTATTGATTTTCTGTTTTG 57.237 29.630 0.00 0.00 0.00 2.44
530 531 8.477419 TCCTCCTTATTGATTTTCTGTTTTGT 57.523 30.769 0.00 0.00 0.00 2.83
531 532 8.576442 TCCTCCTTATTGATTTTCTGTTTTGTC 58.424 33.333 0.00 0.00 0.00 3.18
532 533 7.814587 CCTCCTTATTGATTTTCTGTTTTGTCC 59.185 37.037 0.00 0.00 0.00 4.02
533 534 7.367285 TCCTTATTGATTTTCTGTTTTGTCCG 58.633 34.615 0.00 0.00 0.00 4.79
534 535 7.229707 TCCTTATTGATTTTCTGTTTTGTCCGA 59.770 33.333 0.00 0.00 0.00 4.55
535 536 7.538678 CCTTATTGATTTTCTGTTTTGTCCGAG 59.461 37.037 0.00 0.00 0.00 4.63
536 537 6.633500 ATTGATTTTCTGTTTTGTCCGAGA 57.367 33.333 0.00 0.00 0.00 4.04
537 538 6.633500 TTGATTTTCTGTTTTGTCCGAGAT 57.367 33.333 0.00 0.00 0.00 2.75
538 539 7.737972 TTGATTTTCTGTTTTGTCCGAGATA 57.262 32.000 0.00 0.00 0.00 1.98
539 540 7.129109 TGATTTTCTGTTTTGTCCGAGATAC 57.871 36.000 0.00 0.00 0.00 2.24
540 541 6.708502 TGATTTTCTGTTTTGTCCGAGATACA 59.291 34.615 0.00 0.00 0.00 2.29
541 542 6.928979 TTTTCTGTTTTGTCCGAGATACAA 57.071 33.333 0.00 0.00 35.12 2.41
542 543 6.928979 TTTCTGTTTTGTCCGAGATACAAA 57.071 33.333 0.00 0.00 43.23 2.83
559 560 2.647784 AAAAACACACGCAACGCTG 58.352 47.368 0.00 0.00 0.00 5.18
560 561 1.409982 AAAAACACACGCAACGCTGC 61.410 50.000 0.00 0.00 45.75 5.25
572 573 3.850272 GCAACGCTGCGTATATATATGC 58.150 45.455 29.18 26.04 39.99 3.14
581 582 4.973663 TGCGTATATATATGCATCGAACCG 59.026 41.667 28.13 10.49 46.91 4.44
582 583 5.209977 GCGTATATATATGCATCGAACCGA 58.790 41.667 25.54 0.00 43.14 4.69
583 584 5.115171 GCGTATATATATGCATCGAACCGAC 59.885 44.000 25.54 0.00 43.14 4.79
584 585 5.624081 CGTATATATATGCATCGAACCGACC 59.376 44.000 0.19 0.00 39.18 4.79
585 586 2.736144 TATATGCATCGAACCGACCC 57.264 50.000 0.19 0.00 39.18 4.46
586 587 0.756294 ATATGCATCGAACCGACCCA 59.244 50.000 0.19 0.00 39.18 4.51
587 588 0.537653 TATGCATCGAACCGACCCAA 59.462 50.000 0.19 0.00 39.18 4.12
588 589 1.024579 ATGCATCGAACCGACCCAAC 61.025 55.000 0.00 0.00 39.18 3.77
589 590 2.736682 GCATCGAACCGACCCAACG 61.737 63.158 0.00 0.00 39.18 4.10
590 591 1.080366 CATCGAACCGACCCAACGA 60.080 57.895 0.00 0.00 39.18 3.85
591 592 1.080298 ATCGAACCGACCCAACGAC 60.080 57.895 0.00 0.00 39.18 4.34
592 593 1.530013 ATCGAACCGACCCAACGACT 61.530 55.000 0.00 0.00 39.18 4.18
593 594 0.888736 TCGAACCGACCCAACGACTA 60.889 55.000 0.00 0.00 35.09 2.59
594 595 0.455633 CGAACCGACCCAACGACTAG 60.456 60.000 0.00 0.00 35.09 2.57
595 596 0.600057 GAACCGACCCAACGACTAGT 59.400 55.000 0.00 0.00 35.09 2.57
596 597 1.000171 GAACCGACCCAACGACTAGTT 60.000 52.381 0.00 0.00 45.45 2.24
597 598 1.043022 ACCGACCCAACGACTAGTTT 58.957 50.000 0.00 0.00 42.02 2.66
598 599 1.413812 ACCGACCCAACGACTAGTTTT 59.586 47.619 0.00 0.00 42.02 2.43
599 600 1.796459 CCGACCCAACGACTAGTTTTG 59.204 52.381 0.00 4.04 42.02 2.44
600 601 1.796459 CGACCCAACGACTAGTTTTGG 59.204 52.381 22.14 22.14 42.02 3.28
601 602 2.546373 CGACCCAACGACTAGTTTTGGA 60.546 50.000 27.31 0.00 42.17 3.53
602 603 2.804527 GACCCAACGACTAGTTTTGGAC 59.195 50.000 27.31 19.69 42.17 4.02
603 604 2.436911 ACCCAACGACTAGTTTTGGACT 59.563 45.455 27.31 15.26 42.17 3.85
604 605 3.064931 CCCAACGACTAGTTTTGGACTC 58.935 50.000 27.31 2.13 42.17 3.36
605 606 3.064931 CCAACGACTAGTTTTGGACTCC 58.935 50.000 23.71 0.00 42.17 3.85
606 607 3.493699 CCAACGACTAGTTTTGGACTCCA 60.494 47.826 23.71 0.00 42.17 3.86
607 608 4.124238 CAACGACTAGTTTTGGACTCCAA 58.876 43.478 6.39 6.39 42.02 3.53
608 609 4.618920 ACGACTAGTTTTGGACTCCAAT 57.381 40.909 11.47 0.00 43.55 3.16
609 610 4.566987 ACGACTAGTTTTGGACTCCAATC 58.433 43.478 11.47 8.10 43.55 2.67
610 611 3.933332 CGACTAGTTTTGGACTCCAATCC 59.067 47.826 11.47 5.39 43.55 3.01
611 612 4.322801 CGACTAGTTTTGGACTCCAATCCT 60.323 45.833 11.47 11.91 43.55 3.24
612 613 5.105473 CGACTAGTTTTGGACTCCAATCCTA 60.105 44.000 11.47 12.35 43.55 2.94
613 614 6.051179 ACTAGTTTTGGACTCCAATCCTAC 57.949 41.667 11.47 7.77 43.55 3.18
614 615 4.993705 AGTTTTGGACTCCAATCCTACA 57.006 40.909 11.47 0.00 43.55 2.74
615 616 5.520748 AGTTTTGGACTCCAATCCTACAT 57.479 39.130 11.47 0.00 43.55 2.29
616 617 5.256474 AGTTTTGGACTCCAATCCTACATG 58.744 41.667 11.47 0.00 43.55 3.21
617 618 3.931907 TTGGACTCCAATCCTACATGG 57.068 47.619 6.39 0.00 38.75 3.66
618 619 7.950045 AGTTTTGGACTCCAATCCTACATGGA 61.950 42.308 11.47 0.00 43.55 3.41
619 620 9.858384 AGTTTTGGACTCCAATCCTACATGGAC 62.858 44.444 11.47 0.00 43.55 4.02
630 631 5.050126 TCCTACATGGACTAGTACTCCAG 57.950 47.826 6.66 0.00 41.24 3.86
631 632 3.570550 CCTACATGGACTAGTACTCCAGC 59.429 52.174 6.66 0.00 41.24 4.85
632 633 3.101643 ACATGGACTAGTACTCCAGCA 57.898 47.619 6.66 0.00 41.24 4.41
633 634 2.761208 ACATGGACTAGTACTCCAGCAC 59.239 50.000 6.66 0.00 41.24 4.40
634 635 1.848652 TGGACTAGTACTCCAGCACC 58.151 55.000 6.66 0.82 32.52 5.01
635 636 1.358103 TGGACTAGTACTCCAGCACCT 59.642 52.381 6.66 0.00 32.52 4.00
636 637 2.579400 TGGACTAGTACTCCAGCACCTA 59.421 50.000 6.66 0.00 32.52 3.08
637 638 3.010920 TGGACTAGTACTCCAGCACCTAA 59.989 47.826 6.66 0.00 32.52 2.69
638 639 4.216708 GGACTAGTACTCCAGCACCTAAT 58.783 47.826 0.00 0.00 0.00 1.73
639 640 4.650131 GGACTAGTACTCCAGCACCTAATT 59.350 45.833 0.00 0.00 0.00 1.40
640 641 5.452077 GGACTAGTACTCCAGCACCTAATTG 60.452 48.000 0.00 0.00 0.00 2.32
641 642 3.268023 AGTACTCCAGCACCTAATTGC 57.732 47.619 0.00 0.00 43.34 3.56
642 643 2.571653 AGTACTCCAGCACCTAATTGCA 59.428 45.455 0.00 0.00 45.62 4.08
643 644 2.584835 ACTCCAGCACCTAATTGCAA 57.415 45.000 0.00 0.00 45.62 4.08
644 645 2.875296 ACTCCAGCACCTAATTGCAAA 58.125 42.857 1.71 0.00 45.62 3.68
645 646 2.821969 ACTCCAGCACCTAATTGCAAAG 59.178 45.455 1.71 0.00 45.62 2.77
646 647 1.545582 TCCAGCACCTAATTGCAAAGC 59.454 47.619 1.71 1.22 45.62 3.51
647 648 1.404583 CCAGCACCTAATTGCAAAGCC 60.405 52.381 1.71 0.00 45.62 4.35
648 649 0.527565 AGCACCTAATTGCAAAGCCG 59.472 50.000 1.71 0.00 45.62 5.52
649 650 0.458370 GCACCTAATTGCAAAGCCGG 60.458 55.000 1.71 0.00 42.49 6.13
650 651 0.887933 CACCTAATTGCAAAGCCGGT 59.112 50.000 1.71 5.22 0.00 5.28
651 652 1.135402 CACCTAATTGCAAAGCCGGTC 60.135 52.381 1.71 0.00 0.00 4.79
652 653 1.173043 CCTAATTGCAAAGCCGGTCA 58.827 50.000 1.71 0.00 0.00 4.02
653 654 1.135402 CCTAATTGCAAAGCCGGTCAC 60.135 52.381 1.71 0.00 0.00 3.67
654 655 0.885196 TAATTGCAAAGCCGGTCACC 59.115 50.000 1.71 0.00 0.00 4.02
655 656 1.815817 AATTGCAAAGCCGGTCACCC 61.816 55.000 1.71 0.00 0.00 4.61
656 657 4.966787 TGCAAAGCCGGTCACCCC 62.967 66.667 1.90 0.00 0.00 4.95
658 659 3.966543 CAAAGCCGGTCACCCCCT 61.967 66.667 1.90 0.00 0.00 4.79
659 660 2.204029 AAAGCCGGTCACCCCCTA 60.204 61.111 1.90 0.00 0.00 3.53
660 661 2.599757 AAAGCCGGTCACCCCCTAC 61.600 63.158 1.90 0.00 0.00 3.18
661 662 3.857521 AAGCCGGTCACCCCCTACA 62.858 63.158 1.90 0.00 0.00 2.74
662 663 3.087906 GCCGGTCACCCCCTACAT 61.088 66.667 1.90 0.00 0.00 2.29
663 664 3.103091 GCCGGTCACCCCCTACATC 62.103 68.421 1.90 0.00 0.00 3.06
664 665 1.382695 CCGGTCACCCCCTACATCT 60.383 63.158 0.00 0.00 0.00 2.90
665 666 1.400530 CCGGTCACCCCCTACATCTC 61.401 65.000 0.00 0.00 0.00 2.75
666 667 0.686441 CGGTCACCCCCTACATCTCA 60.686 60.000 0.00 0.00 0.00 3.27
667 668 1.580059 GGTCACCCCCTACATCTCAA 58.420 55.000 0.00 0.00 0.00 3.02
668 669 1.209747 GGTCACCCCCTACATCTCAAC 59.790 57.143 0.00 0.00 0.00 3.18
669 670 2.188817 GTCACCCCCTACATCTCAACT 58.811 52.381 0.00 0.00 0.00 3.16
670 671 2.572104 GTCACCCCCTACATCTCAACTT 59.428 50.000 0.00 0.00 0.00 2.66
671 672 3.773119 GTCACCCCCTACATCTCAACTTA 59.227 47.826 0.00 0.00 0.00 2.24
672 673 3.773119 TCACCCCCTACATCTCAACTTAC 59.227 47.826 0.00 0.00 0.00 2.34
673 674 3.113043 ACCCCCTACATCTCAACTTACC 58.887 50.000 0.00 0.00 0.00 2.85
674 675 3.246387 ACCCCCTACATCTCAACTTACCT 60.246 47.826 0.00 0.00 0.00 3.08
675 676 4.015918 ACCCCCTACATCTCAACTTACCTA 60.016 45.833 0.00 0.00 0.00 3.08
676 677 4.589374 CCCCCTACATCTCAACTTACCTAG 59.411 50.000 0.00 0.00 0.00 3.02
677 678 5.209659 CCCCTACATCTCAACTTACCTAGT 58.790 45.833 0.00 0.00 39.32 2.57
679 680 6.837568 CCCCTACATCTCAACTTACCTAGTTA 59.162 42.308 0.00 0.00 45.29 2.24
680 681 7.343833 CCCCTACATCTCAACTTACCTAGTTAA 59.656 40.741 0.00 0.00 45.29 2.01
681 682 8.925338 CCCTACATCTCAACTTACCTAGTTAAT 58.075 37.037 0.00 0.00 45.29 1.40
686 687 9.543783 CATCTCAACTTACCTAGTTAATTACCC 57.456 37.037 0.00 0.00 45.29 3.69
687 688 7.775120 TCTCAACTTACCTAGTTAATTACCCG 58.225 38.462 0.00 0.00 45.29 5.28
688 689 6.877236 TCAACTTACCTAGTTAATTACCCGG 58.123 40.000 0.00 0.00 45.29 5.73
689 690 5.282055 ACTTACCTAGTTAATTACCCGGC 57.718 43.478 0.00 0.00 31.29 6.13
690 691 4.964897 ACTTACCTAGTTAATTACCCGGCT 59.035 41.667 0.00 0.00 31.29 5.52
691 692 6.136155 ACTTACCTAGTTAATTACCCGGCTA 58.864 40.000 0.00 0.00 31.29 3.93
692 693 6.266330 ACTTACCTAGTTAATTACCCGGCTAG 59.734 42.308 0.00 0.00 31.29 3.42
693 694 3.323115 ACCTAGTTAATTACCCGGCTAGC 59.677 47.826 6.04 6.04 0.00 3.42
694 695 3.577415 CCTAGTTAATTACCCGGCTAGCT 59.423 47.826 15.72 0.00 0.00 3.32
695 696 4.040095 CCTAGTTAATTACCCGGCTAGCTT 59.960 45.833 15.72 1.27 0.00 3.74
696 697 3.805207 AGTTAATTACCCGGCTAGCTTG 58.195 45.455 15.72 7.61 0.00 4.01
697 698 3.453353 AGTTAATTACCCGGCTAGCTTGA 59.547 43.478 15.72 0.00 0.00 3.02
698 699 4.102681 AGTTAATTACCCGGCTAGCTTGAT 59.897 41.667 15.72 0.98 0.00 2.57
699 700 2.841442 ATTACCCGGCTAGCTTGATC 57.159 50.000 15.72 0.00 0.00 2.92
700 701 1.491668 TTACCCGGCTAGCTTGATCA 58.508 50.000 15.72 0.00 0.00 2.92
701 702 0.750850 TACCCGGCTAGCTTGATCAC 59.249 55.000 15.72 0.00 0.00 3.06
702 703 1.592669 CCCGGCTAGCTTGATCACG 60.593 63.158 15.72 7.49 0.00 4.35
703 704 1.437573 CCGGCTAGCTTGATCACGA 59.562 57.895 15.72 0.00 0.00 4.35
704 705 0.032678 CCGGCTAGCTTGATCACGAT 59.967 55.000 15.72 0.00 0.00 3.73
705 706 1.539065 CCGGCTAGCTTGATCACGATT 60.539 52.381 15.72 0.00 0.00 3.34
706 707 2.288213 CCGGCTAGCTTGATCACGATTA 60.288 50.000 15.72 0.00 0.00 1.75
707 708 2.726760 CGGCTAGCTTGATCACGATTAC 59.273 50.000 15.72 0.00 0.00 1.89
708 709 3.717707 GGCTAGCTTGATCACGATTACA 58.282 45.455 15.72 0.00 0.00 2.41
709 710 3.491267 GGCTAGCTTGATCACGATTACAC 59.509 47.826 15.72 0.00 0.00 2.90
710 711 4.112634 GCTAGCTTGATCACGATTACACA 58.887 43.478 7.70 0.00 0.00 3.72
711 712 4.747108 GCTAGCTTGATCACGATTACACAT 59.253 41.667 7.70 0.00 0.00 3.21
712 713 5.920840 GCTAGCTTGATCACGATTACACATA 59.079 40.000 7.70 0.00 0.00 2.29
713 714 6.420903 GCTAGCTTGATCACGATTACACATAA 59.579 38.462 7.70 0.00 0.00 1.90
714 715 6.834959 AGCTTGATCACGATTACACATAAG 57.165 37.500 2.89 0.00 0.00 1.73
715 716 5.235186 AGCTTGATCACGATTACACATAAGC 59.765 40.000 2.89 1.27 37.62 3.09
716 717 5.006649 GCTTGATCACGATTACACATAAGCA 59.993 40.000 2.89 0.00 37.38 3.91
717 718 6.456853 GCTTGATCACGATTACACATAAGCAA 60.457 38.462 2.89 0.00 37.38 3.91
718 719 6.976636 TGATCACGATTACACATAAGCAAA 57.023 33.333 0.00 0.00 0.00 3.68
719 720 6.771076 TGATCACGATTACACATAAGCAAAC 58.229 36.000 0.00 0.00 0.00 2.93
720 721 6.593770 TGATCACGATTACACATAAGCAAACT 59.406 34.615 0.00 0.00 0.00 2.66
721 722 7.762159 TGATCACGATTACACATAAGCAAACTA 59.238 33.333 0.00 0.00 0.00 2.24
722 723 7.892778 TCACGATTACACATAAGCAAACTAA 57.107 32.000 0.00 0.00 0.00 2.24
723 724 7.735500 TCACGATTACACATAAGCAAACTAAC 58.264 34.615 0.00 0.00 0.00 2.34
724 725 7.601130 TCACGATTACACATAAGCAAACTAACT 59.399 33.333 0.00 0.00 0.00 2.24
725 726 7.688167 CACGATTACACATAAGCAAACTAACTG 59.312 37.037 0.00 0.00 0.00 3.16
726 727 7.148474 ACGATTACACATAAGCAAACTAACTGG 60.148 37.037 0.00 0.00 0.00 4.00
727 728 4.766404 ACACATAAGCAAACTAACTGGC 57.234 40.909 0.00 0.00 0.00 4.85
728 729 4.141287 ACACATAAGCAAACTAACTGGCA 58.859 39.130 0.00 0.00 0.00 4.92
729 730 4.023193 ACACATAAGCAAACTAACTGGCAC 60.023 41.667 0.00 0.00 0.00 5.01
730 731 4.023279 CACATAAGCAAACTAACTGGCACA 60.023 41.667 0.00 0.00 0.00 4.57
731 732 4.023193 ACATAAGCAAACTAACTGGCACAC 60.023 41.667 0.00 0.00 0.00 3.82
732 733 0.944386 AGCAAACTAACTGGCACACG 59.056 50.000 0.00 0.00 0.00 4.49
733 734 0.941542 GCAAACTAACTGGCACACGA 59.058 50.000 0.00 0.00 0.00 4.35
734 735 1.535462 GCAAACTAACTGGCACACGAT 59.465 47.619 0.00 0.00 0.00 3.73
735 736 2.739913 GCAAACTAACTGGCACACGATA 59.260 45.455 0.00 0.00 0.00 2.92
736 737 3.424433 GCAAACTAACTGGCACACGATAC 60.424 47.826 0.00 0.00 0.00 2.24
737 738 2.273370 ACTAACTGGCACACGATACG 57.727 50.000 0.00 0.00 0.00 3.06
738 739 1.542915 ACTAACTGGCACACGATACGT 59.457 47.619 0.00 0.00 42.36 3.57
751 752 4.399004 ACGATACGTGACTCCTAGTACT 57.601 45.455 0.00 0.00 39.18 2.73
752 753 5.521906 ACGATACGTGACTCCTAGTACTA 57.478 43.478 0.00 1.89 39.18 1.82
753 754 5.285651 ACGATACGTGACTCCTAGTACTAC 58.714 45.833 0.00 0.00 39.18 2.73
754 755 5.068460 ACGATACGTGACTCCTAGTACTACT 59.932 44.000 0.00 0.00 39.18 2.57
755 756 6.263392 ACGATACGTGACTCCTAGTACTACTA 59.737 42.308 0.00 0.00 39.18 1.82
756 757 6.580791 CGATACGTGACTCCTAGTACTACTAC 59.419 46.154 0.00 0.00 0.00 2.73
757 758 5.667539 ACGTGACTCCTAGTACTACTACA 57.332 43.478 0.00 0.00 0.00 2.74
758 759 6.232581 ACGTGACTCCTAGTACTACTACAT 57.767 41.667 0.00 0.00 0.00 2.29
759 760 6.648192 ACGTGACTCCTAGTACTACTACATT 58.352 40.000 0.00 0.00 0.00 2.71
760 761 7.786030 ACGTGACTCCTAGTACTACTACATTA 58.214 38.462 0.00 0.00 0.00 1.90
761 762 8.260818 ACGTGACTCCTAGTACTACTACATTAA 58.739 37.037 0.00 0.00 0.00 1.40
762 763 9.270640 CGTGACTCCTAGTACTACTACATTAAT 57.729 37.037 0.00 0.00 0.00 1.40
773 774 9.460906 GTACTACTACATTAATTAGGACACTGC 57.539 37.037 3.35 0.00 0.00 4.40
774 775 8.307582 ACTACTACATTAATTAGGACACTGCT 57.692 34.615 8.54 0.00 0.00 4.24
775 776 9.417561 ACTACTACATTAATTAGGACACTGCTA 57.582 33.333 8.54 0.00 0.00 3.49
777 778 8.943909 ACTACATTAATTAGGACACTGCTAAC 57.056 34.615 8.54 0.00 33.14 2.34
778 779 6.903883 ACATTAATTAGGACACTGCTAACG 57.096 37.500 0.00 0.00 33.14 3.18
779 780 5.293569 ACATTAATTAGGACACTGCTAACGC 59.706 40.000 0.00 0.00 33.14 4.84
780 781 3.611766 AATTAGGACACTGCTAACGCT 57.388 42.857 0.00 0.00 33.14 5.07
781 782 4.730949 AATTAGGACACTGCTAACGCTA 57.269 40.909 0.00 0.00 33.14 4.26
782 783 3.777465 TTAGGACACTGCTAACGCTAG 57.223 47.619 0.00 0.00 36.97 3.42
793 794 4.260334 GCTAACGCTAGCTTTTACCAAG 57.740 45.455 12.11 4.20 46.12 3.61
794 795 3.683340 GCTAACGCTAGCTTTTACCAAGT 59.317 43.478 12.11 0.00 46.12 3.16
795 796 4.153655 GCTAACGCTAGCTTTTACCAAGTT 59.846 41.667 12.11 7.80 46.12 2.66
796 797 5.334646 GCTAACGCTAGCTTTTACCAAGTTT 60.335 40.000 12.11 0.00 46.12 2.66
797 798 6.128472 GCTAACGCTAGCTTTTACCAAGTTTA 60.128 38.462 12.11 0.00 46.12 2.01
798 799 6.622833 AACGCTAGCTTTTACCAAGTTTAA 57.377 33.333 13.93 0.00 0.00 1.52
799 800 6.622833 ACGCTAGCTTTTACCAAGTTTAAA 57.377 33.333 13.93 0.00 0.00 1.52
800 801 6.432936 ACGCTAGCTTTTACCAAGTTTAAAC 58.567 36.000 13.93 10.47 0.00 2.01
801 802 6.038492 ACGCTAGCTTTTACCAAGTTTAAACA 59.962 34.615 20.06 0.00 0.00 2.83
802 803 6.358822 CGCTAGCTTTTACCAAGTTTAAACAC 59.641 38.462 20.06 0.00 0.00 3.32
803 804 7.197703 GCTAGCTTTTACCAAGTTTAAACACA 58.802 34.615 20.06 0.00 0.00 3.72
804 805 7.703197 GCTAGCTTTTACCAAGTTTAAACACAA 59.297 33.333 20.06 4.03 0.00 3.33
805 806 7.821595 AGCTTTTACCAAGTTTAAACACAAC 57.178 32.000 20.06 0.00 0.00 3.32
806 807 7.608153 AGCTTTTACCAAGTTTAAACACAACT 58.392 30.769 20.06 0.00 35.94 3.16
807 808 8.092068 AGCTTTTACCAAGTTTAAACACAACTT 58.908 29.630 20.06 2.46 43.80 2.66
808 809 9.356433 GCTTTTACCAAGTTTAAACACAACTTA 57.644 29.630 20.06 1.53 41.58 2.24
823 824 9.609346 AAACACAACTTAATACTACTGACACTT 57.391 29.630 0.00 0.00 0.00 3.16
825 826 9.909644 ACACAACTTAATACTACTGACACTTAG 57.090 33.333 0.00 0.00 0.00 2.18
826 827 9.355215 CACAACTTAATACTACTGACACTTAGG 57.645 37.037 0.00 0.00 0.00 2.69
827 828 8.033626 ACAACTTAATACTACTGACACTTAGGC 58.966 37.037 0.00 0.00 0.00 3.93
828 829 7.713734 ACTTAATACTACTGACACTTAGGCA 57.286 36.000 0.00 0.00 0.00 4.75
829 830 8.307582 ACTTAATACTACTGACACTTAGGCAT 57.692 34.615 0.00 0.00 32.22 4.40
830 831 8.198109 ACTTAATACTACTGACACTTAGGCATG 58.802 37.037 0.00 0.00 32.22 4.06
831 832 6.546428 AATACTACTGACACTTAGGCATGT 57.454 37.500 0.00 0.00 32.22 3.21
832 833 4.891992 ACTACTGACACTTAGGCATGTT 57.108 40.909 0.00 0.00 32.22 2.71
833 834 5.228945 ACTACTGACACTTAGGCATGTTT 57.771 39.130 0.00 0.00 32.22 2.83
834 835 4.997395 ACTACTGACACTTAGGCATGTTTG 59.003 41.667 0.00 0.00 32.22 2.93
835 836 3.149196 ACTGACACTTAGGCATGTTTGG 58.851 45.455 0.00 0.00 32.22 3.28
836 837 3.181445 ACTGACACTTAGGCATGTTTGGA 60.181 43.478 0.00 0.00 32.22 3.53
837 838 4.012374 CTGACACTTAGGCATGTTTGGAT 58.988 43.478 0.00 0.00 32.22 3.41
838 839 4.406456 TGACACTTAGGCATGTTTGGATT 58.594 39.130 0.00 0.00 0.00 3.01
839 840 5.565509 TGACACTTAGGCATGTTTGGATTA 58.434 37.500 0.00 0.00 0.00 1.75
840 841 6.186957 TGACACTTAGGCATGTTTGGATTAT 58.813 36.000 0.00 0.00 0.00 1.28
841 842 6.318648 TGACACTTAGGCATGTTTGGATTATC 59.681 38.462 0.00 0.00 0.00 1.75
842 843 5.594317 ACACTTAGGCATGTTTGGATTATCC 59.406 40.000 3.91 3.91 36.96 2.59
843 844 5.593909 CACTTAGGCATGTTTGGATTATCCA 59.406 40.000 10.29 10.29 46.61 3.41
854 855 4.365514 TGGATTATCCAACACACACTGT 57.634 40.909 12.08 0.00 45.00 3.55
855 856 4.071423 TGGATTATCCAACACACACTGTG 58.929 43.478 12.08 7.68 47.00 3.66
867 868 5.545658 CACACACTGTGTAAACTTGTTCT 57.454 39.130 14.53 0.00 45.65 3.01
868 869 5.938322 CACACACTGTGTAAACTTGTTCTT 58.062 37.500 14.53 0.00 45.65 2.52
869 870 7.067532 CACACACTGTGTAAACTTGTTCTTA 57.932 36.000 14.53 0.00 45.65 2.10
870 871 7.693952 CACACACTGTGTAAACTTGTTCTTAT 58.306 34.615 14.53 0.00 45.65 1.73
871 872 8.181573 CACACACTGTGTAAACTTGTTCTTATT 58.818 33.333 14.53 0.00 45.65 1.40
872 873 8.395633 ACACACTGTGTAAACTTGTTCTTATTC 58.604 33.333 13.89 0.00 45.56 1.75
873 874 7.855904 CACACTGTGTAAACTTGTTCTTATTCC 59.144 37.037 13.89 0.00 0.00 3.01
874 875 7.773690 ACACTGTGTAAACTTGTTCTTATTCCT 59.226 33.333 12.53 0.00 0.00 3.36
875 876 8.621286 CACTGTGTAAACTTGTTCTTATTCCTT 58.379 33.333 0.00 0.00 0.00 3.36
876 877 9.185680 ACTGTGTAAACTTGTTCTTATTCCTTT 57.814 29.630 0.00 0.00 0.00 3.11
877 878 9.665264 CTGTGTAAACTTGTTCTTATTCCTTTC 57.335 33.333 0.00 0.00 0.00 2.62
878 879 8.626526 TGTGTAAACTTGTTCTTATTCCTTTCC 58.373 33.333 0.00 0.00 0.00 3.13
879 880 8.847196 GTGTAAACTTGTTCTTATTCCTTTCCT 58.153 33.333 0.00 0.00 0.00 3.36
880 881 9.416284 TGTAAACTTGTTCTTATTCCTTTCCTT 57.584 29.630 0.00 0.00 0.00 3.36
884 885 9.817809 AACTTGTTCTTATTCCTTTCCTTTTTC 57.182 29.630 0.00 0.00 0.00 2.29
885 886 8.421784 ACTTGTTCTTATTCCTTTCCTTTTTCC 58.578 33.333 0.00 0.00 0.00 3.13
886 887 8.547481 TTGTTCTTATTCCTTTCCTTTTTCCT 57.453 30.769 0.00 0.00 0.00 3.36
887 888 8.547481 TGTTCTTATTCCTTTCCTTTTTCCTT 57.453 30.769 0.00 0.00 0.00 3.36
888 889 9.649316 TGTTCTTATTCCTTTCCTTTTTCCTTA 57.351 29.630 0.00 0.00 0.00 2.69
891 892 9.309224 TCTTATTCCTTTCCTTTTTCCTTAAGG 57.691 33.333 15.98 15.98 42.89 2.69
899 900 6.463053 TCCTTTTTCCTTAAGGAGATTGGA 57.537 37.500 23.11 22.48 44.72 3.53
900 901 6.485171 TCCTTTTTCCTTAAGGAGATTGGAG 58.515 40.000 23.11 15.32 44.72 3.86
901 902 6.045577 TCCTTTTTCCTTAAGGAGATTGGAGT 59.954 38.462 23.11 0.00 44.72 3.85
902 903 6.721668 CCTTTTTCCTTAAGGAGATTGGAGTT 59.278 38.462 23.11 0.00 46.36 3.01
903 904 7.309438 CCTTTTTCCTTAAGGAGATTGGAGTTG 60.309 40.741 23.11 7.53 46.36 3.16
904 905 4.844349 TCCTTAAGGAGATTGGAGTTGG 57.156 45.455 20.72 0.00 39.78 3.77
905 906 4.435137 TCCTTAAGGAGATTGGAGTTGGA 58.565 43.478 20.72 0.00 39.78 3.53
906 907 4.471386 TCCTTAAGGAGATTGGAGTTGGAG 59.529 45.833 20.72 0.00 39.78 3.86
907 908 4.471386 CCTTAAGGAGATTGGAGTTGGAGA 59.529 45.833 17.21 0.00 37.39 3.71
908 909 3.990959 AAGGAGATTGGAGTTGGAGAC 57.009 47.619 0.00 0.00 0.00 3.36
909 910 3.197927 AGGAGATTGGAGTTGGAGACT 57.802 47.619 0.00 0.00 42.70 3.24
910 911 9.465166 CCTTAAGGAGATTGGAGTTGGAGACTC 62.465 48.148 17.21 0.00 45.19 3.36
916 917 3.354131 GAGTTGGAGACTCGATGCC 57.646 57.895 0.00 0.00 44.90 4.40
917 918 0.532573 GAGTTGGAGACTCGATGCCA 59.467 55.000 0.00 0.00 44.90 4.92
918 919 0.976641 AGTTGGAGACTCGATGCCAA 59.023 50.000 0.00 0.00 38.02 4.52
919 920 1.066573 AGTTGGAGACTCGATGCCAAG 60.067 52.381 8.19 0.00 40.75 3.61
920 921 0.976641 TTGGAGACTCGATGCCAAGT 59.023 50.000 0.00 0.00 35.61 3.16
921 922 0.532573 TGGAGACTCGATGCCAAGTC 59.467 55.000 0.00 0.00 41.81 3.01
928 929 4.688021 GACTCGATGCCAAGTCTTATTCT 58.312 43.478 0.00 0.00 39.06 2.40
929 930 5.091261 ACTCGATGCCAAGTCTTATTCTT 57.909 39.130 0.00 0.00 0.00 2.52
930 931 5.491982 ACTCGATGCCAAGTCTTATTCTTT 58.508 37.500 0.00 0.00 0.00 2.52
931 932 5.940470 ACTCGATGCCAAGTCTTATTCTTTT 59.060 36.000 0.00 0.00 0.00 2.27
932 933 6.092807 ACTCGATGCCAAGTCTTATTCTTTTC 59.907 38.462 0.00 0.00 0.00 2.29
933 934 6.173339 TCGATGCCAAGTCTTATTCTTTTCT 58.827 36.000 0.00 0.00 0.00 2.52
934 935 6.655003 TCGATGCCAAGTCTTATTCTTTTCTT 59.345 34.615 0.00 0.00 0.00 2.52
935 936 7.174946 TCGATGCCAAGTCTTATTCTTTTCTTT 59.825 33.333 0.00 0.00 0.00 2.52
936 937 7.809806 CGATGCCAAGTCTTATTCTTTTCTTTT 59.190 33.333 0.00 0.00 0.00 2.27
937 938 9.133627 GATGCCAAGTCTTATTCTTTTCTTTTC 57.866 33.333 0.00 0.00 0.00 2.29
938 939 8.237811 TGCCAAGTCTTATTCTTTTCTTTTCT 57.762 30.769 0.00 0.00 0.00 2.52
939 940 9.349713 TGCCAAGTCTTATTCTTTTCTTTTCTA 57.650 29.630 0.00 0.00 0.00 2.10
940 941 9.833182 GCCAAGTCTTATTCTTTTCTTTTCTAG 57.167 33.333 0.00 0.00 0.00 2.43
943 944 8.568676 AGTCTTATTCTTTTCTTTTCTAGGGC 57.431 34.615 0.00 0.00 0.00 5.19
944 945 8.164070 AGTCTTATTCTTTTCTTTTCTAGGGCA 58.836 33.333 0.00 0.00 0.00 5.36
945 946 8.237949 GTCTTATTCTTTTCTTTTCTAGGGCAC 58.762 37.037 0.00 0.00 0.00 5.01
946 947 8.164070 TCTTATTCTTTTCTTTTCTAGGGCACT 58.836 33.333 0.00 0.00 0.00 4.40
947 948 9.449719 CTTATTCTTTTCTTTTCTAGGGCACTA 57.550 33.333 0.00 0.00 0.00 2.74
948 949 7.689446 ATTCTTTTCTTTTCTAGGGCACTAC 57.311 36.000 0.00 0.00 0.00 2.73
949 950 6.435292 TCTTTTCTTTTCTAGGGCACTACT 57.565 37.500 0.00 0.00 0.00 2.57
950 951 6.838382 TCTTTTCTTTTCTAGGGCACTACTT 58.162 36.000 0.00 0.00 0.00 2.24
951 952 6.710744 TCTTTTCTTTTCTAGGGCACTACTTG 59.289 38.462 0.00 0.00 0.00 3.16
952 953 4.553330 TCTTTTCTAGGGCACTACTTGG 57.447 45.455 0.00 0.00 0.00 3.61
960 961 2.256391 GCACTACTTGGCACATGCA 58.744 52.632 6.15 0.00 44.36 3.96
961 962 0.597568 GCACTACTTGGCACATGCAA 59.402 50.000 6.15 0.00 44.36 4.08
962 963 1.666888 GCACTACTTGGCACATGCAAC 60.667 52.381 6.15 0.00 44.36 4.17
963 964 0.874390 ACTACTTGGCACATGCAACG 59.126 50.000 6.15 0.00 44.36 4.10
964 965 0.454957 CTACTTGGCACATGCAACGC 60.455 55.000 6.15 0.00 44.36 4.84
965 966 2.181372 TACTTGGCACATGCAACGCG 62.181 55.000 3.53 3.53 44.36 6.01
966 967 4.340019 TTGGCACATGCAACGCGG 62.340 61.111 12.47 0.00 44.36 6.46
968 969 4.036804 GGCACATGCAACGCGGAA 62.037 61.111 12.47 0.00 44.36 4.30
969 970 2.050533 GCACATGCAACGCGGAAA 60.051 55.556 12.47 0.00 41.59 3.13
970 971 2.082366 GCACATGCAACGCGGAAAG 61.082 57.895 12.47 0.00 41.59 2.62
971 972 2.082366 CACATGCAACGCGGAAAGC 61.082 57.895 12.47 9.31 43.95 3.51
972 973 2.260869 ACATGCAACGCGGAAAGCT 61.261 52.632 12.47 0.00 45.59 3.74
973 974 1.798725 CATGCAACGCGGAAAGCTG 60.799 57.895 12.47 5.42 45.59 4.24
974 975 2.260869 ATGCAACGCGGAAAGCTGT 61.261 52.632 12.47 0.00 45.59 4.40
975 976 1.795170 ATGCAACGCGGAAAGCTGTT 61.795 50.000 12.47 0.00 45.59 3.16
976 977 1.725973 GCAACGCGGAAAGCTGTTC 60.726 57.895 12.47 0.00 45.59 3.18
977 978 1.082104 CAACGCGGAAAGCTGTTCC 60.082 57.895 12.47 14.28 45.59 3.62
978 979 1.525077 AACGCGGAAAGCTGTTCCA 60.525 52.632 12.47 0.00 45.59 3.53
979 980 0.889186 AACGCGGAAAGCTGTTCCAT 60.889 50.000 12.47 8.42 45.59 3.41
980 981 1.298859 ACGCGGAAAGCTGTTCCATC 61.299 55.000 12.47 13.37 45.59 3.51
981 982 1.803289 GCGGAAAGCTGTTCCATCC 59.197 57.895 20.52 8.08 44.04 3.51
982 983 0.960364 GCGGAAAGCTGTTCCATCCA 60.960 55.000 20.52 0.00 44.04 3.41
983 984 1.755179 CGGAAAGCTGTTCCATCCAT 58.245 50.000 20.52 0.00 38.49 3.41
984 985 1.402968 CGGAAAGCTGTTCCATCCATG 59.597 52.381 20.52 0.00 38.49 3.66
985 986 2.450476 GGAAAGCTGTTCCATCCATGT 58.550 47.619 17.61 0.00 38.45 3.21
986 987 2.165030 GGAAAGCTGTTCCATCCATGTG 59.835 50.000 17.61 0.00 38.45 3.21
987 988 1.180029 AAGCTGTTCCATCCATGTGC 58.820 50.000 0.00 0.00 0.00 4.57
988 989 1.028330 AGCTGTTCCATCCATGTGCG 61.028 55.000 0.00 0.00 0.00 5.34
989 990 1.026182 GCTGTTCCATCCATGTGCGA 61.026 55.000 0.00 0.00 0.00 5.10
990 991 0.729116 CTGTTCCATCCATGTGCGAC 59.271 55.000 0.00 0.00 0.00 5.19
991 992 0.324614 TGTTCCATCCATGTGCGACT 59.675 50.000 0.00 0.00 0.00 4.18
992 993 1.552792 TGTTCCATCCATGTGCGACTA 59.447 47.619 0.00 0.00 0.00 2.59
993 994 2.205074 GTTCCATCCATGTGCGACTAG 58.795 52.381 0.00 0.00 0.00 2.57
1002 1003 2.124445 TGCGACTAGCTCCCGCTA 60.124 61.111 21.92 10.38 46.79 4.26
1003 1004 1.528542 TGCGACTAGCTCCCGCTAT 60.529 57.895 21.92 0.00 46.93 2.97
1004 1005 0.250597 TGCGACTAGCTCCCGCTATA 60.251 55.000 21.92 5.61 46.93 1.31
1005 1006 1.096416 GCGACTAGCTCCCGCTATAT 58.904 55.000 16.67 0.00 46.93 0.86
1006 1007 2.286872 GCGACTAGCTCCCGCTATATA 58.713 52.381 16.67 0.00 46.93 0.86
1007 1008 2.879646 GCGACTAGCTCCCGCTATATAT 59.120 50.000 16.67 0.00 46.93 0.86
1008 1009 4.063689 GCGACTAGCTCCCGCTATATATA 58.936 47.826 16.67 0.00 46.93 0.86
1009 1010 4.083908 GCGACTAGCTCCCGCTATATATAC 60.084 50.000 16.67 0.00 46.93 1.47
1010 1011 5.055144 CGACTAGCTCCCGCTATATATACA 58.945 45.833 0.00 0.00 46.93 2.29
1011 1012 5.701750 CGACTAGCTCCCGCTATATATACAT 59.298 44.000 0.00 0.00 46.93 2.29
1012 1013 6.872547 CGACTAGCTCCCGCTATATATACATA 59.127 42.308 0.00 0.00 46.93 2.29
1013 1014 7.549842 CGACTAGCTCCCGCTATATATACATAT 59.450 40.741 0.00 0.00 46.93 1.78
1014 1015 9.887629 GACTAGCTCCCGCTATATATACATATA 57.112 37.037 0.00 0.00 46.93 0.86
1015 1016 9.669887 ACTAGCTCCCGCTATATATACATATAC 57.330 37.037 0.00 0.00 46.93 1.47
1016 1017 7.612668 AGCTCCCGCTATATATACATATACG 57.387 40.000 0.00 0.00 46.79 3.06
1017 1018 6.598457 AGCTCCCGCTATATATACATATACGG 59.402 42.308 11.78 11.78 46.79 4.02
1022 1023 8.199176 CCGCTATATATACATATACGGGAGAG 57.801 42.308 11.25 0.00 38.67 3.20
1023 1024 7.201626 CCGCTATATATACATATACGGGAGAGC 60.202 44.444 11.25 0.00 38.67 4.09
1024 1025 7.464311 CGCTATATATACATATACGGGAGAGCG 60.464 44.444 0.00 0.00 32.69 5.03
1025 1026 7.201626 GCTATATATACATATACGGGAGAGCGG 60.202 44.444 0.00 0.00 0.00 5.52
1026 1027 1.830279 TACATATACGGGAGAGCGGG 58.170 55.000 0.00 0.00 0.00 6.13
1027 1028 1.215647 CATATACGGGAGAGCGGGC 59.784 63.158 0.00 0.00 0.00 6.13
1028 1029 1.228769 ATATACGGGAGAGCGGGCA 60.229 57.895 0.00 0.00 0.00 5.36
1029 1030 0.830444 ATATACGGGAGAGCGGGCAA 60.830 55.000 0.00 0.00 0.00 4.52
1030 1031 1.461091 TATACGGGAGAGCGGGCAAG 61.461 60.000 0.00 0.00 0.00 4.01
1040 1041 4.856801 CGGGCAAGCGGGCACTAT 62.857 66.667 7.25 0.00 45.66 2.12
1041 1042 2.508928 GGGCAAGCGGGCACTATA 59.491 61.111 7.25 0.00 45.66 1.31
1042 1043 1.892391 GGGCAAGCGGGCACTATAC 60.892 63.158 7.25 0.00 45.66 1.47
1043 1044 2.244651 GGCAAGCGGGCACTATACG 61.245 63.158 5.04 0.00 42.77 3.06
1053 1054 3.285816 GGCACTATACGCCTTAGACTC 57.714 52.381 1.77 0.00 46.56 3.36
1054 1055 2.885894 GGCACTATACGCCTTAGACTCT 59.114 50.000 1.77 0.00 46.56 3.24
1060 1061 0.612174 ACGCCTTAGACTCTCCAGCA 60.612 55.000 0.00 0.00 0.00 4.41
1061 1062 0.749649 CGCCTTAGACTCTCCAGCAT 59.250 55.000 0.00 0.00 0.00 3.79
1062 1063 1.269517 CGCCTTAGACTCTCCAGCATC 60.270 57.143 0.00 0.00 0.00 3.91
1063 1064 1.759445 GCCTTAGACTCTCCAGCATCA 59.241 52.381 0.00 0.00 0.00 3.07
1079 1082 5.994054 CCAGCATCATAGCTAGCTAGAAAAA 59.006 40.000 27.42 7.85 44.54 1.94
1152 1158 1.452651 CATGGCCATTCTGACCGCT 60.453 57.895 17.92 0.00 0.00 5.52
1166 1172 2.401766 CCGCTACGGTGACCTACGT 61.402 63.158 0.00 0.00 42.73 3.57
1167 1173 1.061570 CGCTACGGTGACCTACGTC 59.938 63.158 0.00 0.00 43.02 4.34
1176 1182 3.412879 GACCTACGTCGCTGGGCTC 62.413 68.421 0.00 0.00 0.00 4.70
1248 1254 1.139734 CCAGATCCTGGTCGTGACG 59.860 63.158 0.00 0.00 45.82 4.35
1257 1263 2.049433 GTCGTGACGGACCACCAG 60.049 66.667 4.70 0.00 35.59 4.00
1284 1290 4.003648 ACAATGCCTTCTACTACAGCAAC 58.996 43.478 0.00 0.00 36.95 4.17
1305 1311 2.746277 ACCGCGTTCATGGCTTCC 60.746 61.111 4.92 0.00 0.00 3.46
1308 1314 2.480555 GCGTTCATGGCTTCCGTG 59.519 61.111 0.00 0.00 41.56 4.94
1313 1319 3.443045 CATGGCTTCCGTGGTGGC 61.443 66.667 0.00 2.49 36.92 5.01
1362 1368 2.034687 ATGGACAAGCTGCGCCTT 59.965 55.556 4.18 0.00 0.00 4.35
1390 1396 0.246635 GCTCAGGTACGTCATGGTGT 59.753 55.000 0.00 0.00 0.00 4.16
1395 1401 1.906574 AGGTACGTCATGGTGTTGGAT 59.093 47.619 0.00 0.00 0.00 3.41
1477 1483 3.414193 CCTCCATGCTGGCCTCCA 61.414 66.667 3.32 0.41 37.47 3.86
1503 1509 1.081892 TCGTCTACGTCACTGGCTAC 58.918 55.000 0.00 0.00 40.80 3.58
1529 1535 1.043816 CCACATCTGCTCGGGTCTAT 58.956 55.000 0.00 0.00 0.00 1.98
1530 1536 2.239400 CCACATCTGCTCGGGTCTATA 58.761 52.381 0.00 0.00 0.00 1.31
1546 1552 0.956633 TATACCCGACCATGACGAGC 59.043 55.000 12.39 0.00 0.00 5.03
1549 1555 2.710902 CCCGACCATGACGAGCTCA 61.711 63.158 15.40 0.00 0.00 4.26
1551 1557 1.508545 CGACCATGACGAGCTCAGT 59.491 57.895 15.40 12.55 30.20 3.41
1552 1558 0.109086 CGACCATGACGAGCTCAGTT 60.109 55.000 15.40 0.00 30.20 3.16
1554 1560 1.728971 GACCATGACGAGCTCAGTTTG 59.271 52.381 15.40 13.00 30.20 2.93
1564 1570 2.560105 GAGCTCAGTTTGGAGGCAAAAT 59.440 45.455 9.40 0.00 35.41 1.82
1574 1595 0.678048 GAGGCAAAATCCAGGCTCGT 60.678 55.000 0.00 0.00 45.53 4.18
1576 1597 1.153958 GCAAAATCCAGGCTCGTGC 60.154 57.895 0.00 0.00 38.76 5.34
1635 1656 3.230522 AACGGTCACCTACACGGCC 62.231 63.158 0.00 0.00 35.61 6.13
1669 1690 3.047877 GTGGTTTCTGGGCCGACG 61.048 66.667 0.00 0.00 0.00 5.12
1750 1783 4.556233 CTTCTTCATCTGTAACACCGTCA 58.444 43.478 0.00 0.00 0.00 4.35
1798 1831 3.433598 GCTGATGCTCCTAACCACCATTA 60.434 47.826 0.00 0.00 36.03 1.90
1837 1870 0.778815 CGCCGAGTTCGCTCATATTC 59.221 55.000 0.00 0.00 44.28 1.75
1906 1939 4.752879 TCTTGGTGGCCTACGCGC 62.753 66.667 5.73 0.00 35.02 6.86
1936 1969 1.342074 CAGGAAGACTCACTCCACCA 58.658 55.000 0.00 0.00 0.00 4.17
1962 1995 2.124507 TTTTCTGCCTGGTCCTCCCG 62.125 60.000 0.00 0.00 35.15 5.14
1968 2001 2.359967 CCTGGTCCTCCCGGTTCTC 61.360 68.421 0.00 0.00 37.99 2.87
1978 2014 1.104630 CCCGGTTCTCCTCTACACTC 58.895 60.000 0.00 0.00 0.00 3.51
1989 2025 6.673583 TCTCCTCTACACTCTCATCCAATTA 58.326 40.000 0.00 0.00 0.00 1.40
2019 2055 6.443849 TCCAGAGATACTGTTGGGATAAACTT 59.556 38.462 0.00 0.00 44.40 2.66
2024 2060 3.496331 ACTGTTGGGATAAACTTGTGGG 58.504 45.455 0.00 0.00 0.00 4.61
2025 2061 2.231235 CTGTTGGGATAAACTTGTGGGC 59.769 50.000 0.00 0.00 0.00 5.36
2026 2062 1.548719 GTTGGGATAAACTTGTGGGCC 59.451 52.381 0.00 0.00 0.00 5.80
2067 2103 1.798725 CGTAGCGTACACCACCGTG 60.799 63.158 0.00 0.00 46.11 4.94
2069 2105 2.562876 TAGCGTACACCACCGTGCA 61.563 57.895 0.00 0.00 44.40 4.57
2070 2106 1.879737 TAGCGTACACCACCGTGCAT 61.880 55.000 0.00 0.00 44.40 3.96
2071 2107 3.022401 GCGTACACCACCGTGCATG 62.022 63.158 0.00 0.00 44.40 4.06
2072 2108 1.666553 CGTACACCACCGTGCATGT 60.667 57.895 4.96 10.49 44.40 3.21
2073 2109 1.866237 GTACACCACCGTGCATGTG 59.134 57.895 14.01 8.65 44.40 3.21
2074 2110 0.882927 GTACACCACCGTGCATGTGT 60.883 55.000 15.54 14.10 44.40 3.72
2075 2111 0.882484 TACACCACCGTGCATGTGTG 60.882 55.000 17.39 16.29 44.40 3.82
2076 2112 1.891449 CACCACCGTGCATGTGTGA 60.891 57.895 21.88 0.00 32.04 3.58
2077 2113 1.891919 ACCACCGTGCATGTGTGAC 60.892 57.895 21.88 0.00 31.66 3.67
2078 2114 2.550772 CACCGTGCATGTGTGACG 59.449 61.111 17.64 3.09 31.66 4.35
2079 2115 2.108157 ACCGTGCATGTGTGACGT 59.892 55.556 4.96 0.00 31.47 4.34
2080 2116 1.522806 ACCGTGCATGTGTGACGTT 60.523 52.632 4.96 0.00 31.47 3.99
2081 2117 1.082821 CCGTGCATGTGTGACGTTG 60.083 57.895 4.96 0.00 31.47 4.10
2082 2118 1.494766 CCGTGCATGTGTGACGTTGA 61.495 55.000 4.96 0.00 31.47 3.18
2083 2119 0.303191 CGTGCATGTGTGACGTTGAA 59.697 50.000 0.00 0.00 0.00 2.69
2084 2120 1.267782 CGTGCATGTGTGACGTTGAAA 60.268 47.619 0.00 0.00 0.00 2.69
2085 2121 2.601979 CGTGCATGTGTGACGTTGAAAT 60.602 45.455 0.00 0.00 0.00 2.17
2086 2122 3.363477 CGTGCATGTGTGACGTTGAAATA 60.363 43.478 0.00 0.00 0.00 1.40
2087 2123 4.532276 GTGCATGTGTGACGTTGAAATAA 58.468 39.130 0.00 0.00 0.00 1.40
2088 2124 5.153513 GTGCATGTGTGACGTTGAAATAAT 58.846 37.500 0.00 0.00 0.00 1.28
2098 2134 9.484326 TGTGACGTTGAAATAATTAATTCATCG 57.516 29.630 28.55 28.55 46.36 3.84
2153 2194 2.918712 ATATCCTACACTGCAGGCAC 57.081 50.000 19.93 0.00 32.82 5.01
2154 2195 1.866015 TATCCTACACTGCAGGCACT 58.134 50.000 19.93 0.00 43.88 4.40
2155 2196 0.987294 ATCCTACACTGCAGGCACTT 59.013 50.000 19.93 0.00 34.60 3.16
2157 2198 1.974957 TCCTACACTGCAGGCACTTAA 59.025 47.619 19.93 0.00 34.60 1.85
2158 2199 2.076863 CCTACACTGCAGGCACTTAAC 58.923 52.381 19.93 0.00 34.60 2.01
2159 2200 2.549992 CCTACACTGCAGGCACTTAACA 60.550 50.000 19.93 0.00 34.60 2.41
2160 2201 2.276732 ACACTGCAGGCACTTAACAT 57.723 45.000 19.93 0.00 34.60 2.71
2161 2202 1.881973 ACACTGCAGGCACTTAACATG 59.118 47.619 19.93 5.36 34.60 3.21
2203 2252 2.446435 GGGCTTCAACTTATGCTGGAA 58.554 47.619 0.00 0.00 0.00 3.53
2204 2253 2.164422 GGGCTTCAACTTATGCTGGAAC 59.836 50.000 0.00 0.00 0.00 3.62
2205 2254 2.159517 GGCTTCAACTTATGCTGGAACG 60.160 50.000 0.00 0.00 0.00 3.95
2206 2255 2.159517 GCTTCAACTTATGCTGGAACGG 60.160 50.000 0.00 0.00 38.10 4.44
2211 2260 3.521947 ACTTATGCTGGAACGGACTAC 57.478 47.619 0.00 0.00 36.31 2.73
2225 2274 0.528684 GACTACGCTCATGCTGGACC 60.529 60.000 0.00 0.00 36.97 4.46
2229 2278 1.953138 CGCTCATGCTGGACCGATC 60.953 63.158 0.00 0.00 36.97 3.69
2231 2280 2.037620 GCTCATGCTGGACCGATCCT 62.038 60.000 0.00 0.00 46.43 3.24
2233 2282 1.898472 CTCATGCTGGACCGATCCTAT 59.102 52.381 0.00 0.00 46.43 2.57
2235 2284 1.066573 CATGCTGGACCGATCCTATCC 60.067 57.143 0.00 0.00 46.43 2.59
2236 2285 0.105709 TGCTGGACCGATCCTATCCA 60.106 55.000 0.00 6.97 46.43 3.41
2243 2292 2.872858 GACCGATCCTATCCAGCAAAAC 59.127 50.000 0.00 0.00 0.00 2.43
2245 2294 1.261619 CGATCCTATCCAGCAAAACGC 59.738 52.381 0.00 0.00 42.91 4.84
2256 2305 1.817609 GCAAAACGCGCGGTAATATT 58.182 45.000 35.22 16.52 0.00 1.28
2257 2306 2.971607 GCAAAACGCGCGGTAATATTA 58.028 42.857 35.22 0.00 0.00 0.98
2258 2307 3.547601 GCAAAACGCGCGGTAATATTAT 58.452 40.909 35.22 7.61 0.00 1.28
2259 2308 3.596562 GCAAAACGCGCGGTAATATTATC 59.403 43.478 35.22 9.94 0.00 1.75
2261 2310 3.308438 AACGCGCGGTAATATTATCCT 57.692 42.857 35.22 4.55 0.00 3.24
2262 2311 3.308438 ACGCGCGGTAATATTATCCTT 57.692 42.857 35.22 4.03 0.00 3.36
2263 2312 4.439305 ACGCGCGGTAATATTATCCTTA 57.561 40.909 35.22 0.00 0.00 2.69
2264 2313 4.168760 ACGCGCGGTAATATTATCCTTAC 58.831 43.478 35.22 0.00 0.00 2.34
2266 2315 4.860907 CGCGCGGTAATATTATCCTTACTT 59.139 41.667 24.84 0.00 0.00 2.24
2268 2317 6.453396 CGCGCGGTAATATTATCCTTACTTTC 60.453 42.308 24.84 0.00 0.00 2.62
2287 2420 7.951530 ACTTTCATTTGCCAAAGTAAATCAG 57.048 32.000 0.00 0.00 40.35 2.90
2300 2433 8.391106 CCAAAGTAAATCAGATACTAACTGCAC 58.609 37.037 0.00 0.00 33.36 4.57
2302 2435 7.096884 AGTAAATCAGATACTAACTGCACGA 57.903 36.000 0.00 0.00 35.61 4.35
2308 2441 7.060600 TCAGATACTAACTGCACGAAATTTG 57.939 36.000 0.00 0.00 35.61 2.32
2309 2442 6.092122 TCAGATACTAACTGCACGAAATTTGG 59.908 38.462 0.00 0.00 35.61 3.28
2314 2447 2.676076 ACTGCACGAAATTTGGCAATC 58.324 42.857 0.00 0.00 35.59 2.67
2315 2448 2.297033 ACTGCACGAAATTTGGCAATCT 59.703 40.909 0.00 0.00 35.59 2.40
2319 2452 5.101628 TGCACGAAATTTGGCAATCTATTC 58.898 37.500 0.00 3.03 32.54 1.75
2321 2454 5.004726 GCACGAAATTTGGCAATCTATTCAC 59.995 40.000 0.00 0.00 0.00 3.18
2329 2462 3.118261 TGGCAATCTATTCACCAGGAGAC 60.118 47.826 0.00 0.00 0.00 3.36
2338 2471 6.897966 TCTATTCACCAGGAGACAAGATAACT 59.102 38.462 0.00 0.00 0.00 2.24
2339 2472 5.407407 TTCACCAGGAGACAAGATAACTC 57.593 43.478 0.00 0.00 0.00 3.01
2403 2536 2.394563 GCTTCTTGCCACTCTCGCC 61.395 63.158 0.00 0.00 35.15 5.54
2571 2704 1.067212 GTCGCCTCCATAGTCGTCATT 59.933 52.381 0.00 0.00 0.00 2.57
2585 2718 3.751175 GTCGTCATTTTCATGGTCCTCAA 59.249 43.478 0.00 0.00 0.00 3.02
2589 2722 4.520492 GTCATTTTCATGGTCCTCAACAGT 59.480 41.667 0.00 0.00 0.00 3.55
2600 2736 0.667487 CTCAACAGTCACGTGCGGAT 60.667 55.000 11.67 0.00 0.00 4.18
2787 2923 0.248296 CGCTCGAGACTACAAGGAGC 60.248 60.000 18.75 1.44 44.97 4.70
3075 3245 0.109458 CACTCTACTTGTGCGCGGTA 60.109 55.000 8.83 0.00 0.00 4.02
3135 3305 4.451150 TCTCGGCACATGCGGACC 62.451 66.667 9.79 0.00 43.87 4.46
3193 3363 0.610174 TTTCATCGTCCTGCTGCTCT 59.390 50.000 0.00 0.00 0.00 4.09
3211 3381 4.565022 GCTCTTAGCACTCAAGTTTCTCT 58.435 43.478 0.00 0.00 41.89 3.10
3212 3382 4.994217 GCTCTTAGCACTCAAGTTTCTCTT 59.006 41.667 0.00 0.00 41.89 2.85
3213 3383 5.120053 GCTCTTAGCACTCAAGTTTCTCTTC 59.880 44.000 0.00 0.00 41.89 2.87
3214 3384 5.542779 TCTTAGCACTCAAGTTTCTCTTCC 58.457 41.667 0.00 0.00 33.63 3.46
3215 3385 3.133141 AGCACTCAAGTTTCTCTTCCC 57.867 47.619 0.00 0.00 33.63 3.97
3216 3386 2.155279 GCACTCAAGTTTCTCTTCCCC 58.845 52.381 0.00 0.00 33.63 4.81
3217 3387 2.487265 GCACTCAAGTTTCTCTTCCCCA 60.487 50.000 0.00 0.00 33.63 4.96
3218 3388 3.142174 CACTCAAGTTTCTCTTCCCCAC 58.858 50.000 0.00 0.00 33.63 4.61
3220 3390 0.875059 CAAGTTTCTCTTCCCCACGC 59.125 55.000 0.00 0.00 33.63 5.34
3222 3392 1.128188 AGTTTCTCTTCCCCACGCCT 61.128 55.000 0.00 0.00 0.00 5.52
3224 3394 2.748058 TTTCTCTTCCCCACGCCTGC 62.748 60.000 0.00 0.00 0.00 4.85
3239 3409 4.166888 TGCCGCTGCTCCTGATCC 62.167 66.667 0.70 0.00 38.71 3.36
3242 3412 2.429767 CCGCTGCTCCTGATCCTGA 61.430 63.158 0.00 0.00 0.00 3.86
3243 3413 1.519246 CGCTGCTCCTGATCCTGAA 59.481 57.895 0.00 0.00 0.00 3.02
3244 3414 0.530211 CGCTGCTCCTGATCCTGAAG 60.530 60.000 0.00 0.00 0.00 3.02
3245 3415 0.814812 GCTGCTCCTGATCCTGAAGC 60.815 60.000 0.00 0.00 0.00 3.86
3246 3416 0.540454 CTGCTCCTGATCCTGAAGCA 59.460 55.000 8.35 8.35 0.00 3.91
3248 3418 1.339438 TGCTCCTGATCCTGAAGCAAC 60.339 52.381 6.68 0.00 0.00 4.17
3250 3420 2.354259 CTCCTGATCCTGAAGCAACAC 58.646 52.381 0.00 0.00 0.00 3.32
3251 3421 1.699083 TCCTGATCCTGAAGCAACACA 59.301 47.619 0.00 0.00 0.00 3.72
3252 3422 2.082231 CCTGATCCTGAAGCAACACAG 58.918 52.381 0.00 0.00 0.00 3.66
3253 3423 1.467734 CTGATCCTGAAGCAACACAGC 59.532 52.381 0.00 0.00 33.40 4.40
3254 3424 0.807496 GATCCTGAAGCAACACAGCC 59.193 55.000 0.00 0.00 34.23 4.85
3257 3427 1.285023 CTGAAGCAACACAGCCTGC 59.715 57.895 0.00 0.00 38.91 4.85
3258 3428 2.138656 CTGAAGCAACACAGCCTGCC 62.139 60.000 0.00 0.00 39.47 4.85
3259 3429 1.900498 GAAGCAACACAGCCTGCCT 60.900 57.895 0.00 0.00 39.47 4.75
3260 3430 1.860484 GAAGCAACACAGCCTGCCTC 61.860 60.000 0.00 0.00 39.47 4.70
3261 3431 3.368571 GCAACACAGCCTGCCTCC 61.369 66.667 0.00 0.00 32.18 4.30
3262 3432 3.052082 CAACACAGCCTGCCTCCG 61.052 66.667 0.00 0.00 0.00 4.63
3264 3434 3.120086 AACACAGCCTGCCTCCGTT 62.120 57.895 0.00 0.00 0.00 4.44
3265 3435 3.052082 CACAGCCTGCCTCCGTTG 61.052 66.667 0.00 0.00 0.00 4.10
3267 3437 4.711949 CAGCCTGCCTCCGTTGCT 62.712 66.667 0.00 0.00 0.00 3.91
3268 3438 4.400961 AGCCTGCCTCCGTTGCTC 62.401 66.667 0.00 0.00 0.00 4.26
3270 3440 3.710722 CCTGCCTCCGTTGCTCCT 61.711 66.667 0.00 0.00 0.00 3.69
3271 3441 2.435586 CTGCCTCCGTTGCTCCTG 60.436 66.667 0.00 0.00 0.00 3.86
3273 3443 2.125350 GCCTCCGTTGCTCCTGAG 60.125 66.667 0.00 0.00 0.00 3.35
3288 3458 1.334419 CCTGAGCAAGAAACAACAGCG 60.334 52.381 0.00 0.00 0.00 5.18
3291 3461 1.103398 AGCAAGAAACAACAGCGCCT 61.103 50.000 2.29 0.00 0.00 5.52
3295 3465 2.832661 AAACAACAGCGCCTGCCA 60.833 55.556 2.29 0.00 44.31 4.92
3306 3476 3.790437 CCTGCCACCGCTGATCCT 61.790 66.667 0.00 0.00 36.08 3.24
3307 3477 2.513204 CTGCCACCGCTGATCCTG 60.513 66.667 0.00 0.00 36.08 3.86
3308 3478 3.002583 TGCCACCGCTGATCCTGA 61.003 61.111 0.00 0.00 35.36 3.86
3309 3479 2.321263 CTGCCACCGCTGATCCTGAT 62.321 60.000 0.00 0.00 36.08 2.90
3310 3480 1.890979 GCCACCGCTGATCCTGATG 60.891 63.158 0.00 0.00 0.00 3.07
3311 3481 1.890979 CCACCGCTGATCCTGATGC 60.891 63.158 0.00 0.00 0.00 3.91
3312 3482 1.153309 CACCGCTGATCCTGATGCA 60.153 57.895 0.00 0.00 0.00 3.96
3314 3484 0.745845 ACCGCTGATCCTGATGCAAC 60.746 55.000 0.00 0.00 0.00 4.17
3316 3486 0.376152 CGCTGATCCTGATGCAACAC 59.624 55.000 0.00 0.00 0.00 3.32
3317 3487 1.456296 GCTGATCCTGATGCAACACA 58.544 50.000 0.00 0.00 0.00 3.72
3318 3488 1.400846 GCTGATCCTGATGCAACACAG 59.599 52.381 7.65 7.65 0.00 3.66
3320 3490 0.737219 GATCCTGATGCAACACAGCC 59.263 55.000 11.65 2.70 32.10 4.85
3322 3492 0.607217 TCCTGATGCAACACAGCCTG 60.607 55.000 11.65 0.00 32.10 4.85
3323 3493 1.211969 CTGATGCAACACAGCCTGC 59.788 57.895 0.00 0.00 39.09 4.85
3324 3494 2.209064 CTGATGCAACACAGCCTGCC 62.209 60.000 0.00 0.00 37.79 4.85
3325 3495 2.203523 ATGCAACACAGCCTGCCA 60.204 55.556 0.00 0.00 37.79 4.92
3326 3496 2.482296 GATGCAACACAGCCTGCCAC 62.482 60.000 0.00 0.00 37.79 5.01
3327 3497 3.982241 GCAACACAGCCTGCCACC 61.982 66.667 0.00 0.00 32.18 4.61
3329 3499 4.189580 AACACAGCCTGCCACCGT 62.190 61.111 0.00 0.00 0.00 4.83
3330 3500 3.714487 AACACAGCCTGCCACCGTT 62.714 57.895 0.00 0.00 0.00 4.44
3331 3501 3.663176 CACAGCCTGCCACCGTTG 61.663 66.667 0.00 0.00 0.00 4.10
3336 3506 4.335647 CCTGCCACCGTTGCTCCT 62.336 66.667 0.00 0.00 0.00 3.69
3337 3507 3.052082 CTGCCACCGTTGCTCCTG 61.052 66.667 0.00 0.00 0.00 3.86
3338 3508 3.535629 CTGCCACCGTTGCTCCTGA 62.536 63.158 0.00 0.00 0.00 3.86
3354 3602 1.334419 CCTGAGCAAGAAACAACAGCG 60.334 52.381 0.00 0.00 0.00 5.18
3357 3605 1.103398 AGCAAGAAACAACAGCGCCT 61.103 50.000 2.29 0.00 0.00 5.52
3373 3621 4.798344 CTGCCCCTGCTGCTCCTG 62.798 72.222 0.00 0.00 38.71 3.86
3379 3627 2.750637 CTGCTGCTCCTGGGCAAG 60.751 66.667 10.39 3.72 41.94 4.01
3380 3628 3.251509 TGCTGCTCCTGGGCAAGA 61.252 61.111 10.39 0.00 41.94 3.02
3381 3629 2.034687 GCTGCTCCTGGGCAAGAA 59.965 61.111 10.39 0.00 41.94 2.52
3383 3631 1.871126 GCTGCTCCTGGGCAAGAAAC 61.871 60.000 10.39 0.00 41.94 2.78
3385 3633 0.106268 TGCTCCTGGGCAAGAAACAA 60.106 50.000 7.29 0.00 39.43 2.83
3386 3634 1.260544 GCTCCTGGGCAAGAAACAAT 58.739 50.000 0.00 0.00 0.00 2.71
3388 3636 2.164422 GCTCCTGGGCAAGAAACAATAC 59.836 50.000 0.00 0.00 0.00 1.89
3390 3638 1.472480 CCTGGGCAAGAAACAATACGG 59.528 52.381 0.00 0.00 0.00 4.02
3392 3640 0.172578 GGGCAAGAAACAATACGGCC 59.827 55.000 0.00 0.00 39.18 6.13
3394 3642 1.135402 GGCAAGAAACAATACGGCCTG 60.135 52.381 0.00 0.00 37.00 4.85
3395 3643 1.732405 GCAAGAAACAATACGGCCTGC 60.732 52.381 0.00 0.00 0.00 4.85
3396 3644 1.135402 CAAGAAACAATACGGCCTGCC 60.135 52.381 0.00 0.00 0.00 4.85
3398 3646 1.663379 GAAACAATACGGCCTGCCCC 61.663 60.000 0.00 0.00 0.00 5.80
3399 3647 3.655350 AACAATACGGCCTGCCCCC 62.655 63.158 0.00 0.00 0.00 5.40
3417 3665 2.556287 GCCGCTGAAGGACAAACG 59.444 61.111 0.00 0.00 0.00 3.60
3419 3667 1.301401 CCGCTGAAGGACAAACGGA 60.301 57.895 0.00 0.00 45.32 4.69
3422 3670 2.343101 CGCTGAAGGACAAACGGATAA 58.657 47.619 0.00 0.00 0.00 1.75
3423 3671 2.348666 CGCTGAAGGACAAACGGATAAG 59.651 50.000 0.00 0.00 0.00 1.73
3431 3679 3.930848 GGACAAACGGATAAGTACACCAG 59.069 47.826 0.00 0.00 0.00 4.00
3440 3688 0.884704 AAGTACACCAGGCGCAAGTG 60.885 55.000 18.55 18.55 41.68 3.16
3483 3731 2.202623 GCGAGCGTCACCTACCAG 60.203 66.667 0.00 0.00 0.00 4.00
3494 3742 3.399181 CTACCAGGCCGGCCTCAA 61.399 66.667 45.31 29.75 46.28 3.02
3534 3794 3.188786 GACAGCATCGACGGGCAC 61.189 66.667 13.46 0.00 0.00 5.01
3603 3863 5.936956 CCATTTCTTCTTCTACAGCAACTCT 59.063 40.000 0.00 0.00 0.00 3.24
3645 3905 3.006430 TCGTTGTCATCTTCCTGCTACAA 59.994 43.478 0.00 0.00 0.00 2.41
3735 4058 4.214327 CTCGGCCTCCTCTTCGCC 62.214 72.222 0.00 0.00 39.41 5.54
3744 4067 2.413765 CTCTTCGCCTACGCCTCC 59.586 66.667 0.00 0.00 39.84 4.30
3789 4112 2.342279 GGGCATATGGTCGCGCTA 59.658 61.111 5.56 0.00 38.01 4.26
3790 4113 1.301401 GGGCATATGGTCGCGCTAA 60.301 57.895 5.56 0.00 38.01 3.09
3792 4115 1.487231 GCATATGGTCGCGCTAACG 59.513 57.895 5.56 0.00 44.07 3.18
3850 4173 2.595124 ATCATGCCGTCACGACAATA 57.405 45.000 0.00 0.00 0.00 1.90
3851 4174 1.921243 TCATGCCGTCACGACAATAG 58.079 50.000 0.00 0.00 0.00 1.73
3853 4176 0.175760 ATGCCGTCACGACAATAGCT 59.824 50.000 0.00 0.00 0.00 3.32
3855 4178 0.457853 GCCGTCACGACAATAGCTCA 60.458 55.000 0.00 0.00 0.00 4.26
3857 4180 1.402325 CCGTCACGACAATAGCTCACA 60.402 52.381 0.00 0.00 0.00 3.58
3866 4189 4.130118 GACAATAGCTCACATAACCCCAG 58.870 47.826 0.00 0.00 0.00 4.45
3868 4191 3.845781 ATAGCTCACATAACCCCAGTG 57.154 47.619 0.00 0.00 34.67 3.66
3869 4192 0.035056 AGCTCACATAACCCCAGTGC 60.035 55.000 0.00 0.00 33.44 4.40
3870 4193 0.035056 GCTCACATAACCCCAGTGCT 60.035 55.000 0.00 0.00 33.44 4.40
3871 4194 1.742761 CTCACATAACCCCAGTGCTG 58.257 55.000 0.00 0.00 33.44 4.41
3872 4195 1.278985 CTCACATAACCCCAGTGCTGA 59.721 52.381 0.02 0.00 33.44 4.26
3873 4196 1.003118 TCACATAACCCCAGTGCTGAC 59.997 52.381 0.02 0.00 33.44 3.51
3874 4197 1.064003 ACATAACCCCAGTGCTGACA 58.936 50.000 0.02 0.00 0.00 3.58
3875 4198 1.003580 ACATAACCCCAGTGCTGACAG 59.996 52.381 0.00 0.00 0.00 3.51
3876 4199 0.620556 ATAACCCCAGTGCTGACAGG 59.379 55.000 4.26 1.65 0.00 4.00
3877 4200 0.766674 TAACCCCAGTGCTGACAGGT 60.767 55.000 4.26 2.24 32.31 4.00
3878 4201 2.056906 AACCCCAGTGCTGACAGGTC 62.057 60.000 4.26 0.00 31.18 3.85
3879 4202 2.348998 CCCAGTGCTGACAGGTCC 59.651 66.667 4.26 0.00 0.00 4.46
3880 4203 2.519622 CCCAGTGCTGACAGGTCCA 61.520 63.158 4.26 0.00 0.00 4.02
3881 4204 1.681666 CCAGTGCTGACAGGTCCAT 59.318 57.895 4.26 0.00 0.00 3.41
3882 4205 0.904649 CCAGTGCTGACAGGTCCATA 59.095 55.000 4.26 0.00 0.00 2.74
3883 4206 1.278985 CCAGTGCTGACAGGTCCATAA 59.721 52.381 4.26 0.00 0.00 1.90
3884 4207 2.350522 CAGTGCTGACAGGTCCATAAC 58.649 52.381 4.26 0.00 0.00 1.89
3894 4217 0.464452 GGTCCATAACCCGTGAGAGG 59.536 60.000 0.00 0.00 42.85 3.69
3901 4224 3.936535 CCCGTGAGAGGGTACTCC 58.063 66.667 0.00 0.00 46.38 3.85
3911 4234 2.577593 GGTACTCCCCACTGACGC 59.422 66.667 0.00 0.00 0.00 5.19
3914 4237 1.180029 GTACTCCCCACTGACGCTTA 58.820 55.000 0.00 0.00 0.00 3.09
3924 4247 2.672961 CTGACGCTTATCAGGAACCA 57.327 50.000 2.42 0.00 42.13 3.67
3926 4249 3.126831 CTGACGCTTATCAGGAACCATC 58.873 50.000 2.42 0.00 42.13 3.51
3932 4255 4.636249 GCTTATCAGGAACCATCAGTAGG 58.364 47.826 0.00 0.00 0.00 3.18
3933 4256 4.345257 GCTTATCAGGAACCATCAGTAGGA 59.655 45.833 0.00 0.00 0.00 2.94
3935 4258 2.752030 TCAGGAACCATCAGTAGGAGG 58.248 52.381 0.00 0.00 0.00 4.30
3936 4259 1.139853 CAGGAACCATCAGTAGGAGGC 59.860 57.143 0.00 0.00 0.00 4.70
3937 4260 1.204146 GGAACCATCAGTAGGAGGCA 58.796 55.000 0.00 0.00 0.00 4.75
3938 4261 1.771255 GGAACCATCAGTAGGAGGCAT 59.229 52.381 0.00 0.00 0.00 4.40
3939 4262 2.486191 GGAACCATCAGTAGGAGGCATG 60.486 54.545 0.00 0.00 0.00 4.06
3940 4263 1.885049 ACCATCAGTAGGAGGCATGT 58.115 50.000 0.00 0.00 0.00 3.21
3942 4265 1.269988 CCATCAGTAGGAGGCATGTCG 60.270 57.143 0.00 0.00 0.00 4.35
3943 4266 1.043816 ATCAGTAGGAGGCATGTCGG 58.956 55.000 0.00 0.00 0.00 4.79
3944 4267 0.324368 TCAGTAGGAGGCATGTCGGT 60.324 55.000 0.00 0.00 0.00 4.69
3945 4268 0.179100 CAGTAGGAGGCATGTCGGTG 60.179 60.000 0.00 0.00 0.00 4.94
3946 4269 1.144057 GTAGGAGGCATGTCGGTGG 59.856 63.158 0.00 0.00 0.00 4.61
3947 4270 1.305802 TAGGAGGCATGTCGGTGGT 60.306 57.895 0.00 0.00 0.00 4.16
3948 4271 1.613317 TAGGAGGCATGTCGGTGGTG 61.613 60.000 0.00 0.00 0.00 4.17
3977 4326 5.338632 TGACTAAATCACCCTAGTCTCCAA 58.661 41.667 9.85 0.00 42.96 3.53
3979 4328 6.098409 TGACTAAATCACCCTAGTCTCCAATC 59.902 42.308 9.85 0.00 42.96 2.67
3981 4330 4.762289 AATCACCCTAGTCTCCAATCAC 57.238 45.455 0.00 0.00 0.00 3.06
3994 4343 1.202580 CCAATCACGGGTGGAGATCTC 60.203 57.143 14.75 14.75 37.03 2.75
4009 4358 4.202030 GGAGATCTCTACCGGTTAGTGTTG 60.202 50.000 21.81 0.00 0.00 3.33
4018 4367 4.263435 ACCGGTTAGTGTTGAGTTTGAAA 58.737 39.130 0.00 0.00 0.00 2.69
4025 4374 7.979537 GGTTAGTGTTGAGTTTGAAAGGATTTT 59.020 33.333 0.00 0.00 39.27 1.82
4026 4375 9.366216 GTTAGTGTTGAGTTTGAAAGGATTTTT 57.634 29.630 0.00 0.00 39.27 1.94
4054 4405 0.740737 GACCACCATTACAGCCATGC 59.259 55.000 0.00 0.00 0.00 4.06
4056 4407 1.394266 CCACCATTACAGCCATGCCC 61.394 60.000 0.00 0.00 0.00 5.36
4065 4416 1.075374 ACAGCCATGCCCACTTTTCTA 59.925 47.619 0.00 0.00 0.00 2.10
4066 4417 2.291800 ACAGCCATGCCCACTTTTCTAT 60.292 45.455 0.00 0.00 0.00 1.98
4070 4421 5.022787 AGCCATGCCCACTTTTCTATTTTA 58.977 37.500 0.00 0.00 0.00 1.52
4074 4425 8.150296 GCCATGCCCACTTTTCTATTTTATAAT 58.850 33.333 0.00 0.00 0.00 1.28
4097 4448 5.174037 TCGGTTCCAATAATTCAGGAGTT 57.826 39.130 0.00 0.00 32.11 3.01
4098 4449 6.302535 TCGGTTCCAATAATTCAGGAGTTA 57.697 37.500 0.00 0.00 32.11 2.24
4103 4454 9.628500 GGTTCCAATAATTCAGGAGTTATTACT 57.372 33.333 8.78 0.00 33.35 2.24
4123 4475 4.251268 ACTGAATTTCGTACTTGGTAGCC 58.749 43.478 0.00 0.00 0.00 3.93
4124 4476 4.020485 ACTGAATTTCGTACTTGGTAGCCT 60.020 41.667 0.00 0.00 0.00 4.58
4126 4478 5.310451 TGAATTTCGTACTTGGTAGCCTTT 58.690 37.500 0.00 0.00 0.00 3.11
4136 4488 4.975794 ACTTGGTAGCCTTTCATATACCCT 59.024 41.667 0.00 0.00 37.47 4.34
4229 4584 9.774742 ATGAACTATTGTAATTCGAAAAGCTTC 57.225 29.630 0.00 0.00 0.00 3.86
4248 4603 4.363999 CTTCCTAAGTCTGTATGAAGGCG 58.636 47.826 0.00 0.00 0.00 5.52
4260 4626 0.960364 TGAAGGCGGCCAATGAAGTC 60.960 55.000 23.09 6.90 0.00 3.01
4267 4633 2.223340 GCGGCCAATGAAGTCTATGTTG 60.223 50.000 2.24 0.00 0.00 3.33
4277 4643 8.627403 CAATGAAGTCTATGTTGAAATGGCTAT 58.373 33.333 0.00 0.00 0.00 2.97
4282 4648 7.675062 AGTCTATGTTGAAATGGCTATCCTAG 58.325 38.462 0.00 0.00 0.00 3.02
4320 4686 7.337942 GCCGGGAGAAGATCATATAAATCATTT 59.662 37.037 2.18 0.00 0.00 2.32
4451 4821 1.082104 GCTTCGCCTCGTGGTTTTG 60.082 57.895 5.26 0.00 35.27 2.44
4452 4822 1.782028 GCTTCGCCTCGTGGTTTTGT 61.782 55.000 5.26 0.00 35.27 2.83
4453 4823 0.661020 CTTCGCCTCGTGGTTTTGTT 59.339 50.000 5.26 0.00 35.27 2.83
4454 4824 0.378962 TTCGCCTCGTGGTTTTGTTG 59.621 50.000 5.26 0.00 35.27 3.33
4455 4825 0.745128 TCGCCTCGTGGTTTTGTTGT 60.745 50.000 5.26 0.00 35.27 3.32
4456 4826 0.099791 CGCCTCGTGGTTTTGTTGTT 59.900 50.000 5.26 0.00 35.27 2.83
4457 4827 1.468395 CGCCTCGTGGTTTTGTTGTTT 60.468 47.619 5.26 0.00 35.27 2.83
4458 4828 2.612604 GCCTCGTGGTTTTGTTGTTTT 58.387 42.857 5.26 0.00 35.27 2.43
4485 4855 9.737427 CCATGTTAAAAATGTTGTGTACTTGTA 57.263 29.630 0.00 0.00 0.00 2.41
4497 4867 4.171005 GTGTACTTGTAGCGATGTTGCTA 58.829 43.478 0.00 0.00 45.14 3.49
4515 4885 4.793201 TGCTACTGCAGATTAGAGAGGTA 58.207 43.478 23.35 0.00 45.31 3.08
4518 4888 5.278266 GCTACTGCAGATTAGAGAGGTACTG 60.278 48.000 23.35 0.00 37.89 2.74
4528 4898 8.228206 AGATTAGAGAGGTACTGATGACCAATA 58.772 37.037 0.00 0.00 41.55 1.90
4541 4911 6.759272 TGATGACCAATACACTATCTTAGGC 58.241 40.000 0.00 0.00 0.00 3.93
4542 4912 6.554982 TGATGACCAATACACTATCTTAGGCT 59.445 38.462 0.00 0.00 0.00 4.58
4555 4925 4.634012 TCTTAGGCTTGGTTTTGAGCTA 57.366 40.909 0.00 0.00 38.89 3.32
4583 4953 9.743581 TTTTCTCCATATATGTGTGATGCATAT 57.256 29.630 11.73 0.00 41.05 1.78
4584 4954 8.726870 TTCTCCATATATGTGTGATGCATATG 57.273 34.615 11.73 0.00 39.19 1.78
4589 4959 9.563898 CCATATATGTGTGATGCATATGTTTTC 57.436 33.333 11.73 0.14 39.19 2.29
4593 4963 9.740239 ATATGTGTGATGCATATGTTTTCTTTC 57.260 29.630 0.00 0.00 37.91 2.62
4594 4964 6.979465 TGTGTGATGCATATGTTTTCTTTCA 58.021 32.000 0.00 0.00 0.00 2.69
4595 4965 7.604549 TGTGTGATGCATATGTTTTCTTTCAT 58.395 30.769 0.00 0.00 0.00 2.57
4596 4966 8.738106 TGTGTGATGCATATGTTTTCTTTCATA 58.262 29.630 0.00 0.00 0.00 2.15
4597 4967 9.571810 GTGTGATGCATATGTTTTCTTTCATAA 57.428 29.630 0.00 0.00 31.67 1.90
4598 4968 9.571810 TGTGATGCATATGTTTTCTTTCATAAC 57.428 29.630 0.00 1.12 31.67 1.89
4599 4969 8.736742 GTGATGCATATGTTTTCTTTCATAACG 58.263 33.333 0.00 0.00 31.67 3.18
4600 4970 8.672815 TGATGCATATGTTTTCTTTCATAACGA 58.327 29.630 0.00 0.00 31.67 3.85
4601 4971 9.502145 GATGCATATGTTTTCTTTCATAACGAA 57.498 29.630 0.00 0.00 31.67 3.85
4602 4972 8.667987 TGCATATGTTTTCTTTCATAACGAAC 57.332 30.769 4.29 0.00 31.73 3.95
4603 4973 8.293157 TGCATATGTTTTCTTTCATAACGAACA 58.707 29.630 4.29 0.00 31.73 3.18
4604 4974 9.123709 GCATATGTTTTCTTTCATAACGAACAA 57.876 29.630 4.29 0.00 31.73 2.83
4608 4978 9.912634 ATGTTTTCTTTCATAACGAACAATGAT 57.087 25.926 0.00 0.00 32.40 2.45
4609 4979 9.393249 TGTTTTCTTTCATAACGAACAATGATC 57.607 29.630 0.00 0.00 32.40 2.92
4610 4980 9.612620 GTTTTCTTTCATAACGAACAATGATCT 57.387 29.630 0.00 0.00 32.40 2.75
4613 4983 9.611284 TTCTTTCATAACGAACAATGATCTTTG 57.389 29.630 17.34 17.34 32.40 2.77
4614 4984 8.998377 TCTTTCATAACGAACAATGATCTTTGA 58.002 29.630 23.84 4.83 32.40 2.69
4615 4985 9.270576 CTTTCATAACGAACAATGATCTTTGAG 57.729 33.333 23.84 16.77 32.40 3.02
4616 4986 7.905604 TCATAACGAACAATGATCTTTGAGT 57.094 32.000 23.84 17.27 0.00 3.41
4617 4987 8.322906 TCATAACGAACAATGATCTTTGAGTT 57.677 30.769 23.84 23.33 0.00 3.01
4618 4988 9.430623 TCATAACGAACAATGATCTTTGAGTTA 57.569 29.630 23.84 24.25 33.71 2.24
4619 4989 9.694520 CATAACGAACAATGATCTTTGAGTTAG 57.305 33.333 23.84 13.12 33.26 2.34
4620 4990 7.730364 AACGAACAATGATCTTTGAGTTAGT 57.270 32.000 23.84 13.63 0.00 2.24
4621 4991 8.827177 AACGAACAATGATCTTTGAGTTAGTA 57.173 30.769 23.84 0.00 0.00 1.82
4622 4992 8.467402 ACGAACAATGATCTTTGAGTTAGTAG 57.533 34.615 23.84 10.57 0.00 2.57
4623 4993 8.304596 ACGAACAATGATCTTTGAGTTAGTAGA 58.695 33.333 23.84 0.00 0.00 2.59
4624 4994 8.587950 CGAACAATGATCTTTGAGTTAGTAGAC 58.412 37.037 23.84 0.65 0.00 2.59
4625 4995 9.424319 GAACAATGATCTTTGAGTTAGTAGACA 57.576 33.333 23.84 0.00 0.00 3.41
4626 4996 9.778741 AACAATGATCTTTGAGTTAGTAGACAA 57.221 29.630 23.84 0.00 0.00 3.18
4627 4997 9.429359 ACAATGATCTTTGAGTTAGTAGACAAG 57.571 33.333 23.84 0.00 0.00 3.16
4628 4998 9.429359 CAATGATCTTTGAGTTAGTAGACAAGT 57.571 33.333 14.57 0.00 0.00 3.16
4629 4999 8.994429 ATGATCTTTGAGTTAGTAGACAAGTG 57.006 34.615 0.00 0.00 0.00 3.16
4630 5000 7.378966 TGATCTTTGAGTTAGTAGACAAGTGG 58.621 38.462 0.00 0.00 0.00 4.00
4631 5001 5.539048 TCTTTGAGTTAGTAGACAAGTGGC 58.461 41.667 0.00 0.00 0.00 5.01
4632 5002 3.570926 TGAGTTAGTAGACAAGTGGCG 57.429 47.619 0.00 0.00 0.00 5.69
4633 5003 2.260481 GAGTTAGTAGACAAGTGGCGC 58.740 52.381 0.00 0.00 0.00 6.53
4634 5004 1.893801 AGTTAGTAGACAAGTGGCGCT 59.106 47.619 7.64 0.00 0.00 5.92
4635 5005 1.993370 GTTAGTAGACAAGTGGCGCTG 59.007 52.381 7.64 0.00 0.00 5.18
4636 5006 1.541379 TAGTAGACAAGTGGCGCTGA 58.459 50.000 7.64 0.00 0.00 4.26
4637 5007 0.679505 AGTAGACAAGTGGCGCTGAA 59.320 50.000 7.64 0.00 0.00 3.02
4638 5008 1.276421 AGTAGACAAGTGGCGCTGAAT 59.724 47.619 7.64 0.00 0.00 2.57
4639 5009 2.076863 GTAGACAAGTGGCGCTGAATT 58.923 47.619 7.64 0.00 0.00 2.17
4640 5010 2.472695 AGACAAGTGGCGCTGAATTA 57.527 45.000 7.64 0.00 0.00 1.40
4641 5011 2.778299 AGACAAGTGGCGCTGAATTAA 58.222 42.857 7.64 0.00 0.00 1.40
4642 5012 3.347216 AGACAAGTGGCGCTGAATTAAT 58.653 40.909 7.64 0.00 0.00 1.40
4643 5013 3.758554 AGACAAGTGGCGCTGAATTAATT 59.241 39.130 7.64 0.00 0.00 1.40
4644 5014 4.096732 ACAAGTGGCGCTGAATTAATTC 57.903 40.909 19.37 19.37 37.31 2.17
4645 5015 3.758554 ACAAGTGGCGCTGAATTAATTCT 59.241 39.130 24.77 3.57 37.67 2.40
4646 5016 4.142600 ACAAGTGGCGCTGAATTAATTCTC 60.143 41.667 24.77 16.55 37.67 2.87
4647 5017 3.878778 AGTGGCGCTGAATTAATTCTCT 58.121 40.909 24.77 11.20 37.67 3.10
4648 5018 3.624861 AGTGGCGCTGAATTAATTCTCTG 59.375 43.478 24.77 16.71 37.67 3.35
4649 5019 3.375299 GTGGCGCTGAATTAATTCTCTGT 59.625 43.478 24.77 0.00 37.67 3.41
4650 5020 4.009675 TGGCGCTGAATTAATTCTCTGTT 58.990 39.130 24.77 0.00 37.67 3.16
4651 5021 4.094887 TGGCGCTGAATTAATTCTCTGTTC 59.905 41.667 24.77 12.78 37.67 3.18
4652 5022 4.496507 GGCGCTGAATTAATTCTCTGTTCC 60.497 45.833 24.77 15.44 37.67 3.62
4653 5023 4.094887 GCGCTGAATTAATTCTCTGTTCCA 59.905 41.667 24.77 5.91 37.67 3.53
4654 5024 5.220931 GCGCTGAATTAATTCTCTGTTCCAT 60.221 40.000 24.77 0.00 37.67 3.41
4655 5025 6.678900 GCGCTGAATTAATTCTCTGTTCCATT 60.679 38.462 24.77 0.00 37.67 3.16
4656 5026 6.690098 CGCTGAATTAATTCTCTGTTCCATTG 59.310 38.462 24.77 5.93 37.67 2.82
4657 5027 7.414429 CGCTGAATTAATTCTCTGTTCCATTGA 60.414 37.037 24.77 3.46 37.67 2.57
4658 5028 7.914346 GCTGAATTAATTCTCTGTTCCATTGAG 59.086 37.037 24.77 12.40 37.67 3.02
4659 5029 9.170734 CTGAATTAATTCTCTGTTCCATTGAGA 57.829 33.333 24.77 2.53 37.67 3.27
4660 5030 9.690913 TGAATTAATTCTCTGTTCCATTGAGAT 57.309 29.630 24.77 0.00 36.82 2.75
4666 5036 9.745018 AATTCTCTGTTCCATTGAGATTTTAGA 57.255 29.630 0.00 0.00 36.82 2.10
4667 5037 9.917887 ATTCTCTGTTCCATTGAGATTTTAGAT 57.082 29.630 0.00 0.00 36.82 1.98
4668 5038 8.954950 TCTCTGTTCCATTGAGATTTTAGATC 57.045 34.615 0.00 0.00 32.63 2.75
4669 5039 8.542926 TCTCTGTTCCATTGAGATTTTAGATCA 58.457 33.333 0.00 0.00 32.63 2.92
4670 5040 8.498054 TCTGTTCCATTGAGATTTTAGATCAC 57.502 34.615 0.00 0.00 0.00 3.06
4671 5041 8.324306 TCTGTTCCATTGAGATTTTAGATCACT 58.676 33.333 0.00 0.00 0.00 3.41
4672 5042 9.605275 CTGTTCCATTGAGATTTTAGATCACTA 57.395 33.333 0.00 0.00 0.00 2.74
4676 5046 9.993454 TCCATTGAGATTTTAGATCACTATCAG 57.007 33.333 0.00 0.00 34.28 2.90
4677 5047 9.775854 CCATTGAGATTTTAGATCACTATCAGT 57.224 33.333 0.00 0.00 34.28 3.41
4683 5053 9.950496 AGATTTTAGATCACTATCAGTTTGTGT 57.050 29.630 0.00 0.00 34.28 3.72
4689 5059 8.225603 AGATCACTATCAGTTTGTGTTTTTGT 57.774 30.769 0.00 0.00 34.28 2.83
4690 5060 8.131100 AGATCACTATCAGTTTGTGTTTTTGTG 58.869 33.333 0.00 0.00 34.28 3.33
4691 5061 7.151999 TCACTATCAGTTTGTGTTTTTGTGT 57.848 32.000 0.00 0.00 33.82 3.72
4692 5062 7.598278 TCACTATCAGTTTGTGTTTTTGTGTT 58.402 30.769 0.00 0.00 33.82 3.32
4693 5063 8.731605 TCACTATCAGTTTGTGTTTTTGTGTTA 58.268 29.630 0.00 0.00 33.82 2.41
4694 5064 9.347934 CACTATCAGTTTGTGTTTTTGTGTTAA 57.652 29.630 0.00 0.00 0.00 2.01
4698 5068 8.245701 TCAGTTTGTGTTTTTGTGTTAATTCC 57.754 30.769 0.00 0.00 0.00 3.01
4699 5069 8.091449 TCAGTTTGTGTTTTTGTGTTAATTCCT 58.909 29.630 0.00 0.00 0.00 3.36
4700 5070 8.716909 CAGTTTGTGTTTTTGTGTTAATTCCTT 58.283 29.630 0.00 0.00 0.00 3.36
4701 5071 9.930693 AGTTTGTGTTTTTGTGTTAATTCCTTA 57.069 25.926 0.00 0.00 0.00 2.69
4726 5096 8.879427 AACATTGGGCTATTATAAAGATACCC 57.121 34.615 0.00 0.00 36.60 3.69
4727 5097 8.232098 ACATTGGGCTATTATAAAGATACCCT 57.768 34.615 11.45 0.00 37.01 4.34
4728 5098 8.678798 ACATTGGGCTATTATAAAGATACCCTT 58.321 33.333 11.45 0.00 37.01 3.95
4731 5101 7.844009 TGGGCTATTATAAAGATACCCTTACG 58.156 38.462 11.45 0.00 37.01 3.18
4732 5102 6.760298 GGGCTATTATAAAGATACCCTTACGC 59.240 42.308 0.00 0.00 34.00 4.42
4733 5103 6.760298 GGCTATTATAAAGATACCCTTACGCC 59.240 42.308 0.00 0.00 34.00 5.68
4734 5104 7.364497 GGCTATTATAAAGATACCCTTACGCCT 60.364 40.741 0.00 0.00 34.00 5.52
4735 5105 8.689972 GCTATTATAAAGATACCCTTACGCCTA 58.310 37.037 0.00 0.00 34.00 3.93
4738 5108 3.679824 AAGATACCCTTACGCCTATGC 57.320 47.619 0.00 0.00 32.24 3.14
4739 5109 2.605257 AGATACCCTTACGCCTATGCA 58.395 47.619 0.00 0.00 37.32 3.96
4740 5110 2.299297 AGATACCCTTACGCCTATGCAC 59.701 50.000 0.00 0.00 37.32 4.57
4741 5111 1.487300 TACCCTTACGCCTATGCACA 58.513 50.000 0.00 0.00 37.32 4.57
4742 5112 0.837272 ACCCTTACGCCTATGCACAT 59.163 50.000 0.00 0.00 37.32 3.21
4743 5113 1.229428 CCCTTACGCCTATGCACATG 58.771 55.000 0.00 0.00 37.32 3.21
4744 5114 1.475034 CCCTTACGCCTATGCACATGT 60.475 52.381 0.00 0.00 37.32 3.21
4745 5115 2.224185 CCCTTACGCCTATGCACATGTA 60.224 50.000 0.00 0.00 37.32 2.29
4746 5116 3.557054 CCCTTACGCCTATGCACATGTAT 60.557 47.826 0.00 0.00 37.32 2.29
4747 5117 4.065088 CCTTACGCCTATGCACATGTATT 58.935 43.478 0.00 0.00 37.32 1.89
4748 5118 4.515191 CCTTACGCCTATGCACATGTATTT 59.485 41.667 0.00 0.00 37.32 1.40
4749 5119 3.969117 ACGCCTATGCACATGTATTTG 57.031 42.857 0.00 0.00 37.32 2.32
4750 5120 3.278574 ACGCCTATGCACATGTATTTGT 58.721 40.909 0.00 0.00 37.32 2.83
4751 5121 3.694072 ACGCCTATGCACATGTATTTGTT 59.306 39.130 0.00 0.00 37.32 2.83
4752 5122 4.878971 ACGCCTATGCACATGTATTTGTTA 59.121 37.500 0.00 0.00 37.32 2.41
4753 5123 5.530915 ACGCCTATGCACATGTATTTGTTAT 59.469 36.000 0.00 0.00 37.32 1.89
4754 5124 6.039270 ACGCCTATGCACATGTATTTGTTATT 59.961 34.615 0.00 0.00 37.32 1.40
4755 5125 6.360414 CGCCTATGCACATGTATTTGTTATTG 59.640 38.462 0.00 0.00 37.32 1.90
4756 5126 6.642131 GCCTATGCACATGTATTTGTTATTGG 59.358 38.462 0.00 0.00 37.47 3.16
4757 5127 7.684187 GCCTATGCACATGTATTTGTTATTGGT 60.684 37.037 0.00 0.00 37.47 3.67
4758 5128 7.648908 CCTATGCACATGTATTTGTTATTGGTG 59.351 37.037 0.00 0.00 0.00 4.17
4759 5129 6.338214 TGCACATGTATTTGTTATTGGTGT 57.662 33.333 0.00 0.00 0.00 4.16
4760 5130 6.753180 TGCACATGTATTTGTTATTGGTGTT 58.247 32.000 0.00 0.00 0.00 3.32
4761 5131 7.886338 TGCACATGTATTTGTTATTGGTGTTA 58.114 30.769 0.00 0.00 0.00 2.41
4762 5132 8.526978 TGCACATGTATTTGTTATTGGTGTTAT 58.473 29.630 0.00 0.00 0.00 1.89
4812 5182 9.529823 TTCTTATAGAAACAACCTCTGTAGAGA 57.470 33.333 10.40 0.00 37.23 3.10
4813 5183 9.702253 TCTTATAGAAACAACCTCTGTAGAGAT 57.298 33.333 10.40 0.00 44.74 2.75
4817 5187 7.639113 AGAAACAACCTCTGTAGAGATAGAG 57.361 40.000 10.40 0.00 44.74 2.43
4818 5188 5.845391 AACAACCTCTGTAGAGATAGAGC 57.155 43.478 10.40 0.00 44.74 4.09
4819 5189 4.861196 ACAACCTCTGTAGAGATAGAGCA 58.139 43.478 10.40 0.00 44.74 4.26
4820 5190 4.642885 ACAACCTCTGTAGAGATAGAGCAC 59.357 45.833 10.40 0.00 44.74 4.40
4821 5191 3.472652 ACCTCTGTAGAGATAGAGCACG 58.527 50.000 10.40 0.00 44.74 5.34
4822 5192 2.811431 CCTCTGTAGAGATAGAGCACGG 59.189 54.545 10.40 0.00 44.74 4.94
4823 5193 3.495276 CCTCTGTAGAGATAGAGCACGGA 60.495 52.174 10.40 0.00 44.74 4.69
4824 5194 4.130857 CTCTGTAGAGATAGAGCACGGAA 58.869 47.826 2.72 0.00 44.74 4.30
4825 5195 4.524053 TCTGTAGAGATAGAGCACGGAAA 58.476 43.478 0.00 0.00 0.00 3.13
4826 5196 4.948004 TCTGTAGAGATAGAGCACGGAAAA 59.052 41.667 0.00 0.00 0.00 2.29
4827 5197 5.594725 TCTGTAGAGATAGAGCACGGAAAAT 59.405 40.000 0.00 0.00 0.00 1.82
4828 5198 6.096987 TCTGTAGAGATAGAGCACGGAAAATT 59.903 38.462 0.00 0.00 0.00 1.82
4829 5199 7.284716 TCTGTAGAGATAGAGCACGGAAAATTA 59.715 37.037 0.00 0.00 0.00 1.40
4830 5200 7.952671 TGTAGAGATAGAGCACGGAAAATTAT 58.047 34.615 0.00 0.00 0.00 1.28
4831 5201 7.867909 TGTAGAGATAGAGCACGGAAAATTATG 59.132 37.037 0.00 0.00 0.00 1.90
4832 5202 6.821388 AGAGATAGAGCACGGAAAATTATGT 58.179 36.000 0.00 0.00 0.00 2.29
4833 5203 7.952671 AGAGATAGAGCACGGAAAATTATGTA 58.047 34.615 0.00 0.00 0.00 2.29
4834 5204 8.589338 AGAGATAGAGCACGGAAAATTATGTAT 58.411 33.333 0.00 0.00 0.00 2.29
4835 5205 8.539770 AGATAGAGCACGGAAAATTATGTATG 57.460 34.615 0.00 0.00 0.00 2.39
4836 5206 8.150945 AGATAGAGCACGGAAAATTATGTATGT 58.849 33.333 0.00 0.00 0.00 2.29
4837 5207 8.677148 ATAGAGCACGGAAAATTATGTATGTT 57.323 30.769 0.00 0.00 0.00 2.71
4838 5208 7.391148 AGAGCACGGAAAATTATGTATGTTT 57.609 32.000 0.00 0.00 0.00 2.83
4839 5209 7.250569 AGAGCACGGAAAATTATGTATGTTTG 58.749 34.615 0.00 0.00 0.00 2.93
4840 5210 6.329496 AGCACGGAAAATTATGTATGTTTGG 58.671 36.000 0.00 0.00 0.00 3.28
4841 5211 5.518487 GCACGGAAAATTATGTATGTTTGGG 59.482 40.000 0.00 0.00 0.00 4.12
4842 5212 6.039616 CACGGAAAATTATGTATGTTTGGGG 58.960 40.000 0.00 0.00 0.00 4.96
4843 5213 5.128008 ACGGAAAATTATGTATGTTTGGGGG 59.872 40.000 0.00 0.00 0.00 5.40
4844 5214 5.364778 GGAAAATTATGTATGTTTGGGGGC 58.635 41.667 0.00 0.00 0.00 5.80
4845 5215 5.104735 GGAAAATTATGTATGTTTGGGGGCA 60.105 40.000 0.00 0.00 0.00 5.36
4846 5216 6.409120 GGAAAATTATGTATGTTTGGGGGCAT 60.409 38.462 0.00 0.00 0.00 4.40
4847 5217 5.806654 AATTATGTATGTTTGGGGGCATC 57.193 39.130 0.00 0.00 0.00 3.91
4848 5218 2.086610 ATGTATGTTTGGGGGCATCC 57.913 50.000 0.00 0.00 0.00 3.51
4849 5219 1.006813 TGTATGTTTGGGGGCATCCT 58.993 50.000 0.00 0.00 35.33 3.24
4850 5220 2.209758 TGTATGTTTGGGGGCATCCTA 58.790 47.619 0.00 0.00 35.33 2.94
4851 5221 2.583101 TGTATGTTTGGGGGCATCCTAA 59.417 45.455 0.00 0.00 33.93 2.69
4852 5222 2.159179 ATGTTTGGGGGCATCCTAAC 57.841 50.000 13.36 13.36 40.96 2.34
4853 5223 0.780637 TGTTTGGGGGCATCCTAACA 59.219 50.000 16.99 16.99 45.32 2.41
4854 5224 1.148027 TGTTTGGGGGCATCCTAACAA 59.852 47.619 18.01 7.23 44.85 2.83
4855 5225 2.225496 TGTTTGGGGGCATCCTAACAAT 60.225 45.455 18.01 0.00 44.85 2.71
4856 5226 2.430694 GTTTGGGGGCATCCTAACAATC 59.569 50.000 14.65 0.34 40.52 2.67
4857 5227 0.182537 TGGGGGCATCCTAACAATCG 59.817 55.000 0.00 0.00 35.33 3.34
4858 5228 0.537371 GGGGGCATCCTAACAATCGG 60.537 60.000 0.00 0.00 35.33 4.18
4859 5229 0.537371 GGGGCATCCTAACAATCGGG 60.537 60.000 0.00 0.00 0.00 5.14
4860 5230 0.537371 GGGCATCCTAACAATCGGGG 60.537 60.000 0.00 0.00 0.00 5.73
4861 5231 0.182775 GGCATCCTAACAATCGGGGT 59.817 55.000 0.00 0.00 0.00 4.95
4862 5232 1.308998 GCATCCTAACAATCGGGGTG 58.691 55.000 0.00 0.00 34.61 4.61
4863 5233 1.308998 CATCCTAACAATCGGGGTGC 58.691 55.000 0.00 0.00 0.00 5.01
4864 5234 1.134098 CATCCTAACAATCGGGGTGCT 60.134 52.381 0.00 0.00 0.00 4.40
4865 5235 0.251916 TCCTAACAATCGGGGTGCTG 59.748 55.000 0.00 0.00 0.00 4.41
4866 5236 1.376609 CCTAACAATCGGGGTGCTGC 61.377 60.000 0.00 0.00 0.00 5.25
4867 5237 1.705337 CTAACAATCGGGGTGCTGCG 61.705 60.000 0.00 0.00 0.00 5.18
4868 5238 2.457743 TAACAATCGGGGTGCTGCGT 62.458 55.000 0.00 0.00 0.00 5.24
4869 5239 3.055719 CAATCGGGGTGCTGCGTT 61.056 61.111 0.00 0.00 0.00 4.84
4870 5240 1.743623 CAATCGGGGTGCTGCGTTA 60.744 57.895 0.00 0.00 0.00 3.18
4871 5241 1.743995 AATCGGGGTGCTGCGTTAC 60.744 57.895 0.00 0.00 0.00 2.50
4872 5242 2.457743 AATCGGGGTGCTGCGTTACA 62.458 55.000 0.00 0.00 0.00 2.41
4873 5243 3.419759 CGGGGTGCTGCGTTACAC 61.420 66.667 0.00 0.00 36.03 2.90
4874 5244 2.032071 GGGGTGCTGCGTTACACT 59.968 61.111 0.00 0.00 36.99 3.55
4875 5245 1.294138 GGGGTGCTGCGTTACACTA 59.706 57.895 0.00 0.00 36.99 2.74
4876 5246 0.739813 GGGGTGCTGCGTTACACTAG 60.740 60.000 0.00 0.00 36.99 2.57
4877 5247 0.037605 GGGTGCTGCGTTACACTAGT 60.038 55.000 0.00 0.00 36.99 2.57
4878 5248 1.068474 GGTGCTGCGTTACACTAGTG 58.932 55.000 21.44 21.44 36.99 2.74
4879 5249 1.336517 GGTGCTGCGTTACACTAGTGA 60.337 52.381 29.30 10.19 36.99 3.41
4880 5250 1.986378 GTGCTGCGTTACACTAGTGAG 59.014 52.381 29.30 15.31 33.92 3.51
4881 5251 1.883926 TGCTGCGTTACACTAGTGAGA 59.116 47.619 29.30 13.51 0.00 3.27
4882 5252 2.095212 TGCTGCGTTACACTAGTGAGAG 60.095 50.000 29.30 16.68 0.00 3.20
4883 5253 2.161808 GCTGCGTTACACTAGTGAGAGA 59.838 50.000 29.30 8.49 0.00 3.10
4884 5254 3.181495 GCTGCGTTACACTAGTGAGAGAT 60.181 47.826 29.30 9.00 0.00 2.75
4885 5255 4.675671 GCTGCGTTACACTAGTGAGAGATT 60.676 45.833 29.30 8.24 0.00 2.40
4886 5256 5.386958 TGCGTTACACTAGTGAGAGATTT 57.613 39.130 29.30 7.49 0.00 2.17
4887 5257 5.161358 TGCGTTACACTAGTGAGAGATTTG 58.839 41.667 29.30 10.71 0.00 2.32
4888 5258 5.162075 GCGTTACACTAGTGAGAGATTTGT 58.838 41.667 29.30 5.99 0.00 2.83
4889 5259 5.061064 GCGTTACACTAGTGAGAGATTTGTG 59.939 44.000 29.30 8.19 0.00 3.33
4890 5260 5.061064 CGTTACACTAGTGAGAGATTTGTGC 59.939 44.000 29.30 4.99 0.00 4.57
4891 5261 4.607293 ACACTAGTGAGAGATTTGTGCA 57.393 40.909 29.30 0.00 0.00 4.57
4892 5262 5.157940 ACACTAGTGAGAGATTTGTGCAT 57.842 39.130 29.30 0.00 0.00 3.96
4893 5263 5.555017 ACACTAGTGAGAGATTTGTGCATT 58.445 37.500 29.30 0.00 0.00 3.56
4894 5264 6.701340 ACACTAGTGAGAGATTTGTGCATTA 58.299 36.000 29.30 0.00 0.00 1.90
4895 5265 6.591834 ACACTAGTGAGAGATTTGTGCATTAC 59.408 38.462 29.30 0.00 0.00 1.89
4896 5266 6.591448 CACTAGTGAGAGATTTGTGCATTACA 59.409 38.462 18.45 0.00 37.56 2.41
4911 5281 9.571810 TTGTGCATTACAAATTCTATTGCTAAG 57.428 29.630 0.00 0.00 45.86 2.18
4912 5282 7.701924 TGTGCATTACAAATTCTATTGCTAAGC 59.298 33.333 0.00 0.00 36.06 3.09
4913 5283 7.168135 GTGCATTACAAATTCTATTGCTAAGCC 59.832 37.037 0.00 0.00 33.52 4.35
4914 5284 6.360681 GCATTACAAATTCTATTGCTAAGCCG 59.639 38.462 0.00 0.00 33.52 5.52
4915 5285 4.292977 ACAAATTCTATTGCTAAGCCGC 57.707 40.909 0.00 0.00 33.52 6.53
4916 5286 3.066760 ACAAATTCTATTGCTAAGCCGCC 59.933 43.478 0.00 0.00 33.52 6.13
4917 5287 2.638480 ATTCTATTGCTAAGCCGCCA 57.362 45.000 0.00 0.00 0.00 5.69
4918 5288 1.663695 TTCTATTGCTAAGCCGCCAC 58.336 50.000 0.00 0.00 0.00 5.01
4919 5289 0.179056 TCTATTGCTAAGCCGCCACC 60.179 55.000 0.00 0.00 0.00 4.61
4920 5290 1.153046 TATTGCTAAGCCGCCACCC 60.153 57.895 0.00 0.00 0.00 4.61
4921 5291 1.916206 TATTGCTAAGCCGCCACCCA 61.916 55.000 0.00 0.00 0.00 4.51
4922 5292 2.779742 ATTGCTAAGCCGCCACCCAA 62.780 55.000 0.00 0.00 0.00 4.12
4923 5293 2.675075 GCTAAGCCGCCACCCAAA 60.675 61.111 0.00 0.00 0.00 3.28
4924 5294 2.989881 GCTAAGCCGCCACCCAAAC 61.990 63.158 0.00 0.00 0.00 2.93
4925 5295 2.282603 TAAGCCGCCACCCAAACC 60.283 61.111 0.00 0.00 0.00 3.27
4926 5296 2.764637 CTAAGCCGCCACCCAAACCT 62.765 60.000 0.00 0.00 0.00 3.50
4927 5297 4.974721 AGCCGCCACCCAAACCTG 62.975 66.667 0.00 0.00 0.00 4.00
4929 5299 2.520741 CCGCCACCCAAACCTGTT 60.521 61.111 0.00 0.00 0.00 3.16
4930 5300 2.131067 CCGCCACCCAAACCTGTTT 61.131 57.895 0.00 0.00 0.00 2.83
4931 5301 1.067250 CGCCACCCAAACCTGTTTG 59.933 57.895 14.35 14.35 46.93 2.93
4941 5311 3.951775 AAACCTGTTTGACAAAGCACA 57.048 38.095 0.00 0.00 0.00 4.57
4942 5312 4.470334 AAACCTGTTTGACAAAGCACAT 57.530 36.364 0.00 0.00 0.00 3.21
4943 5313 3.715628 ACCTGTTTGACAAAGCACATC 57.284 42.857 0.00 0.00 0.00 3.06
4944 5314 3.290710 ACCTGTTTGACAAAGCACATCT 58.709 40.909 0.00 0.00 0.00 2.90
4945 5315 4.460263 ACCTGTTTGACAAAGCACATCTA 58.540 39.130 0.00 0.00 0.00 1.98
4946 5316 5.072741 ACCTGTTTGACAAAGCACATCTAT 58.927 37.500 0.00 0.00 0.00 1.98
4947 5317 6.237901 ACCTGTTTGACAAAGCACATCTATA 58.762 36.000 0.00 0.00 0.00 1.31
4948 5318 6.714810 ACCTGTTTGACAAAGCACATCTATAA 59.285 34.615 0.00 0.00 0.00 0.98
4949 5319 7.394359 ACCTGTTTGACAAAGCACATCTATAAT 59.606 33.333 0.00 0.00 0.00 1.28
4950 5320 8.246180 CCTGTTTGACAAAGCACATCTATAATT 58.754 33.333 0.00 0.00 0.00 1.40
4951 5321 9.630098 CTGTTTGACAAAGCACATCTATAATTT 57.370 29.630 0.00 0.00 0.00 1.82
4952 5322 9.979578 TGTTTGACAAAGCACATCTATAATTTT 57.020 25.926 0.00 0.00 0.00 1.82
4999 5369 9.781834 TTTTTCGTAGGAATGCAACTATATTTG 57.218 29.630 0.00 0.00 30.88 2.32
5010 5380 5.757850 CAACTATATTTGCTTGGACCTCC 57.242 43.478 0.00 0.00 0.00 4.30
5011 5381 5.440610 CAACTATATTTGCTTGGACCTCCT 58.559 41.667 0.00 0.00 36.82 3.69
5012 5382 5.717119 ACTATATTTGCTTGGACCTCCTT 57.283 39.130 0.00 0.00 36.82 3.36
5013 5383 6.079712 ACTATATTTGCTTGGACCTCCTTT 57.920 37.500 0.00 0.00 36.82 3.11
5014 5384 6.494059 ACTATATTTGCTTGGACCTCCTTTT 58.506 36.000 0.00 0.00 36.82 2.27
5015 5385 5.665916 ATATTTGCTTGGACCTCCTTTTG 57.334 39.130 0.00 0.00 36.82 2.44
5016 5386 1.039856 TTGCTTGGACCTCCTTTTGC 58.960 50.000 0.00 0.00 36.82 3.68
5017 5387 0.106268 TGCTTGGACCTCCTTTTGCA 60.106 50.000 0.00 0.00 36.82 4.08
5018 5388 0.315251 GCTTGGACCTCCTTTTGCAC 59.685 55.000 0.00 0.00 36.82 4.57
5019 5389 1.691196 CTTGGACCTCCTTTTGCACA 58.309 50.000 0.00 0.00 36.82 4.57
5020 5390 1.338020 CTTGGACCTCCTTTTGCACAC 59.662 52.381 0.00 0.00 36.82 3.82
5021 5391 0.257328 TGGACCTCCTTTTGCACACA 59.743 50.000 0.00 0.00 36.82 3.72
5022 5392 1.341482 TGGACCTCCTTTTGCACACAA 60.341 47.619 0.00 0.00 36.82 3.33
5023 5393 1.754226 GGACCTCCTTTTGCACACAAA 59.246 47.619 0.00 0.00 43.97 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 1.512694 GAGCATTTTTGCCCTCCGG 59.487 57.895 0.00 0.00 34.90 5.14
32 33 1.250154 TGGAGCATTTTTGCCCTCCG 61.250 55.000 0.00 0.00 45.36 4.63
33 34 0.533951 CTGGAGCATTTTTGCCCTCC 59.466 55.000 0.00 0.00 43.27 4.30
34 35 0.108472 GCTGGAGCATTTTTGCCCTC 60.108 55.000 0.00 0.00 41.59 4.30
35 36 1.547472 GGCTGGAGCATTTTTGCCCT 61.547 55.000 0.20 0.00 44.36 5.19
36 37 1.078918 GGCTGGAGCATTTTTGCCC 60.079 57.895 0.20 0.00 44.36 5.36
37 38 1.078918 GGGCTGGAGCATTTTTGCC 60.079 57.895 0.20 0.00 44.36 4.52
38 39 0.251073 ATGGGCTGGAGCATTTTTGC 59.749 50.000 0.20 0.00 44.36 3.68
39 40 1.276989 ACATGGGCTGGAGCATTTTTG 59.723 47.619 0.00 0.00 44.36 2.44
40 41 1.648116 ACATGGGCTGGAGCATTTTT 58.352 45.000 0.00 0.00 44.36 1.94
41 42 1.648116 AACATGGGCTGGAGCATTTT 58.352 45.000 0.00 0.00 44.36 1.82
42 43 2.102578 GTAACATGGGCTGGAGCATTT 58.897 47.619 0.00 0.00 44.36 2.32
43 44 1.767759 GTAACATGGGCTGGAGCATT 58.232 50.000 0.00 0.00 44.36 3.56
44 45 0.464373 CGTAACATGGGCTGGAGCAT 60.464 55.000 0.00 0.00 44.36 3.79
45 46 1.078497 CGTAACATGGGCTGGAGCA 60.078 57.895 0.00 0.00 44.36 4.26
46 47 2.472909 GCGTAACATGGGCTGGAGC 61.473 63.158 0.00 0.00 41.14 4.70
47 48 1.819632 GGCGTAACATGGGCTGGAG 60.820 63.158 0.00 0.00 0.00 3.86
48 49 1.847798 AAGGCGTAACATGGGCTGGA 61.848 55.000 0.00 0.00 39.22 3.86
49 50 1.378514 AAGGCGTAACATGGGCTGG 60.379 57.895 0.00 0.00 39.22 4.85
50 51 0.676466 TCAAGGCGTAACATGGGCTG 60.676 55.000 0.00 0.00 39.22 4.85
51 52 0.392998 CTCAAGGCGTAACATGGGCT 60.393 55.000 0.00 0.00 41.27 5.19
52 53 0.392461 TCTCAAGGCGTAACATGGGC 60.392 55.000 0.00 0.00 0.00 5.36
53 54 1.369625 GTCTCAAGGCGTAACATGGG 58.630 55.000 0.00 0.00 0.00 4.00
54 55 0.999406 CGTCTCAAGGCGTAACATGG 59.001 55.000 0.00 0.00 0.00 3.66
55 56 0.999406 CCGTCTCAAGGCGTAACATG 59.001 55.000 3.09 0.00 0.00 3.21
56 57 0.739813 GCCGTCTCAAGGCGTAACAT 60.740 55.000 3.09 0.00 45.58 2.71
57 58 1.373748 GCCGTCTCAAGGCGTAACA 60.374 57.895 3.09 0.00 45.58 2.41
58 59 3.471399 GCCGTCTCAAGGCGTAAC 58.529 61.111 3.09 0.00 45.58 2.50
76 77 0.525882 GACTTTAGAGACGGAGCGCC 60.526 60.000 2.29 0.00 0.00 6.53
77 78 0.452585 AGACTTTAGAGACGGAGCGC 59.547 55.000 0.00 0.00 0.00 5.92
78 79 1.064357 GGAGACTTTAGAGACGGAGCG 59.936 57.143 0.00 0.00 0.00 5.03
79 80 2.356695 GAGGAGACTTTAGAGACGGAGC 59.643 54.545 0.00 0.00 44.43 4.70
80 81 2.946990 GGAGGAGACTTTAGAGACGGAG 59.053 54.545 0.00 0.00 44.43 4.63
81 82 2.577105 AGGAGGAGACTTTAGAGACGGA 59.423 50.000 0.00 0.00 44.43 4.69
82 83 3.007473 AGGAGGAGACTTTAGAGACGG 57.993 52.381 0.00 0.00 44.43 4.79
83 84 6.702716 ATTAAGGAGGAGACTTTAGAGACG 57.297 41.667 0.00 0.00 44.43 4.18
93 94 9.901172 TTGACCTAAAATTATTAAGGAGGAGAC 57.099 33.333 11.70 1.44 33.16 3.36
116 117 9.529325 CGTCTTCTGGTATATAAGTCATTTTGA 57.471 33.333 0.00 0.00 0.00 2.69
117 118 8.765219 CCGTCTTCTGGTATATAAGTCATTTTG 58.235 37.037 0.00 0.00 0.00 2.44
118 119 7.931948 CCCGTCTTCTGGTATATAAGTCATTTT 59.068 37.037 0.00 0.00 0.00 1.82
119 120 7.442656 CCCGTCTTCTGGTATATAAGTCATTT 58.557 38.462 0.00 0.00 0.00 2.32
120 121 6.518537 GCCCGTCTTCTGGTATATAAGTCATT 60.519 42.308 0.00 0.00 0.00 2.57
121 122 5.047235 GCCCGTCTTCTGGTATATAAGTCAT 60.047 44.000 0.00 0.00 0.00 3.06
122 123 4.280174 GCCCGTCTTCTGGTATATAAGTCA 59.720 45.833 0.00 0.00 0.00 3.41
123 124 4.280174 TGCCCGTCTTCTGGTATATAAGTC 59.720 45.833 0.00 0.00 0.00 3.01
124 125 4.038883 GTGCCCGTCTTCTGGTATATAAGT 59.961 45.833 0.00 0.00 0.00 2.24
125 126 4.281182 AGTGCCCGTCTTCTGGTATATAAG 59.719 45.833 0.00 0.00 0.00 1.73
126 127 4.038763 CAGTGCCCGTCTTCTGGTATATAA 59.961 45.833 0.00 0.00 0.00 0.98
127 128 3.572682 CAGTGCCCGTCTTCTGGTATATA 59.427 47.826 0.00 0.00 0.00 0.86
128 129 2.365617 CAGTGCCCGTCTTCTGGTATAT 59.634 50.000 0.00 0.00 0.00 0.86
129 130 1.754803 CAGTGCCCGTCTTCTGGTATA 59.245 52.381 0.00 0.00 0.00 1.47
130 131 0.537188 CAGTGCCCGTCTTCTGGTAT 59.463 55.000 0.00 0.00 0.00 2.73
131 132 1.541310 CCAGTGCCCGTCTTCTGGTA 61.541 60.000 0.00 0.00 41.51 3.25
132 133 2.743718 CAGTGCCCGTCTTCTGGT 59.256 61.111 0.00 0.00 0.00 4.00
133 134 2.046892 CCAGTGCCCGTCTTCTGG 60.047 66.667 0.00 0.00 40.83 3.86
134 135 1.669115 CACCAGTGCCCGTCTTCTG 60.669 63.158 0.00 0.00 0.00 3.02
135 136 2.743718 CACCAGTGCCCGTCTTCT 59.256 61.111 0.00 0.00 0.00 2.85
136 137 2.358737 CCACCAGTGCCCGTCTTC 60.359 66.667 0.00 0.00 0.00 2.87
137 138 3.168528 ACCACCAGTGCCCGTCTT 61.169 61.111 0.00 0.00 0.00 3.01
138 139 3.941188 CACCACCAGTGCCCGTCT 61.941 66.667 0.00 0.00 40.28 4.18
145 146 4.704833 CTCGGCCCACCACCAGTG 62.705 72.222 0.00 0.00 46.83 3.66
212 213 3.128375 CACCAAGTGGGCACAACC 58.872 61.111 0.00 0.00 42.05 3.77
221 222 3.260100 AGAGGGGCCCACCAAGTG 61.260 66.667 27.72 0.00 42.91 3.16
222 223 3.260100 CAGAGGGGCCCACCAAGT 61.260 66.667 27.72 1.17 42.91 3.16
223 224 4.052518 CCAGAGGGGCCCACCAAG 62.053 72.222 27.72 11.43 42.91 3.61
224 225 3.508786 TACCAGAGGGGCCCACCAA 62.509 63.158 27.72 1.24 42.91 3.67
225 226 3.948360 TACCAGAGGGGCCCACCA 61.948 66.667 27.72 0.81 42.91 4.17
226 227 3.408853 GTACCAGAGGGGCCCACC 61.409 72.222 27.72 16.38 42.05 4.61
227 228 0.619543 TAAGTACCAGAGGGGCCCAC 60.620 60.000 27.72 20.26 42.05 4.61
228 229 0.345502 ATAAGTACCAGAGGGGCCCA 59.654 55.000 27.72 0.00 42.05 5.36
229 230 1.519498 AATAAGTACCAGAGGGGCCC 58.481 55.000 17.12 17.12 42.05 5.80
230 231 2.932261 CAAATAAGTACCAGAGGGGCC 58.068 52.381 0.00 0.00 42.05 5.80
231 232 2.092375 AGCAAATAAGTACCAGAGGGGC 60.092 50.000 0.00 0.00 42.05 5.80
232 233 3.933861 AGCAAATAAGTACCAGAGGGG 57.066 47.619 0.00 0.00 44.81 4.79
233 234 4.843728 TGAAGCAAATAAGTACCAGAGGG 58.156 43.478 0.00 0.00 41.29 4.30
234 235 8.506168 TTATTGAAGCAAATAAGTACCAGAGG 57.494 34.615 0.00 0.00 30.41 3.69
237 238 9.736023 GGAATTATTGAAGCAAATAAGTACCAG 57.264 33.333 0.00 0.00 35.91 4.00
238 239 9.474313 AGGAATTATTGAAGCAAATAAGTACCA 57.526 29.630 5.92 0.00 33.39 3.25
277 278 5.770162 AGATGAAACTTCACGGAGGATTTTT 59.230 36.000 0.00 0.00 40.49 1.94
278 279 5.316987 AGATGAAACTTCACGGAGGATTTT 58.683 37.500 0.00 0.00 40.49 1.82
279 280 4.911390 AGATGAAACTTCACGGAGGATTT 58.089 39.130 0.00 0.00 40.49 2.17
280 281 4.020218 TGAGATGAAACTTCACGGAGGATT 60.020 41.667 0.00 0.00 40.49 3.01
281 282 3.515502 TGAGATGAAACTTCACGGAGGAT 59.484 43.478 0.00 0.00 40.49 3.24
282 283 2.897326 TGAGATGAAACTTCACGGAGGA 59.103 45.455 0.00 0.00 40.49 3.71
283 284 3.319137 TGAGATGAAACTTCACGGAGG 57.681 47.619 0.00 0.00 40.49 4.30
284 285 5.409520 TGAAATGAGATGAAACTTCACGGAG 59.590 40.000 0.00 0.00 40.49 4.63
285 286 5.304778 TGAAATGAGATGAAACTTCACGGA 58.695 37.500 0.00 0.00 40.49 4.69
286 287 5.611796 TGAAATGAGATGAAACTTCACGG 57.388 39.130 0.00 0.00 40.49 4.94
287 288 6.662616 ACTTGAAATGAGATGAAACTTCACG 58.337 36.000 0.00 0.00 40.49 4.35
288 289 7.917505 ACAACTTGAAATGAGATGAAACTTCAC 59.082 33.333 0.00 0.00 40.49 3.18
289 290 7.916977 CACAACTTGAAATGAGATGAAACTTCA 59.083 33.333 0.00 0.00 42.14 3.02
290 291 7.096312 GCACAACTTGAAATGAGATGAAACTTC 60.096 37.037 0.00 0.00 0.00 3.01
291 292 6.698766 GCACAACTTGAAATGAGATGAAACTT 59.301 34.615 0.00 0.00 0.00 2.66
292 293 6.211515 GCACAACTTGAAATGAGATGAAACT 58.788 36.000 0.00 0.00 0.00 2.66
293 294 5.116074 CGCACAACTTGAAATGAGATGAAAC 59.884 40.000 0.00 0.00 0.00 2.78
294 295 5.214417 CGCACAACTTGAAATGAGATGAAA 58.786 37.500 0.00 0.00 0.00 2.69
295 296 4.320421 CCGCACAACTTGAAATGAGATGAA 60.320 41.667 0.00 0.00 0.00 2.57
296 297 3.189080 CCGCACAACTTGAAATGAGATGA 59.811 43.478 0.00 0.00 0.00 2.92
297 298 3.189080 TCCGCACAACTTGAAATGAGATG 59.811 43.478 0.00 0.00 0.00 2.90
298 299 3.411446 TCCGCACAACTTGAAATGAGAT 58.589 40.909 0.00 0.00 0.00 2.75
299 300 2.844946 TCCGCACAACTTGAAATGAGA 58.155 42.857 0.00 0.00 0.00 3.27
300 301 3.624326 TTCCGCACAACTTGAAATGAG 57.376 42.857 0.00 0.00 0.00 2.90
301 302 4.155826 CCTATTCCGCACAACTTGAAATGA 59.844 41.667 0.00 0.00 0.00 2.57
302 303 4.082787 ACCTATTCCGCACAACTTGAAATG 60.083 41.667 0.00 0.00 0.00 2.32
303 304 4.079253 ACCTATTCCGCACAACTTGAAAT 58.921 39.130 0.00 0.00 0.00 2.17
304 305 3.482436 ACCTATTCCGCACAACTTGAAA 58.518 40.909 0.00 0.00 0.00 2.69
305 306 3.134574 ACCTATTCCGCACAACTTGAA 57.865 42.857 0.00 0.00 0.00 2.69
306 307 2.851263 ACCTATTCCGCACAACTTGA 57.149 45.000 0.00 0.00 0.00 3.02
307 308 3.596214 ACTACCTATTCCGCACAACTTG 58.404 45.455 0.00 0.00 0.00 3.16
308 309 3.514309 AGACTACCTATTCCGCACAACTT 59.486 43.478 0.00 0.00 0.00 2.66
309 310 3.097614 AGACTACCTATTCCGCACAACT 58.902 45.455 0.00 0.00 0.00 3.16
310 311 3.187700 CAGACTACCTATTCCGCACAAC 58.812 50.000 0.00 0.00 0.00 3.32
311 312 2.167693 CCAGACTACCTATTCCGCACAA 59.832 50.000 0.00 0.00 0.00 3.33
312 313 1.754803 CCAGACTACCTATTCCGCACA 59.245 52.381 0.00 0.00 0.00 4.57
313 314 1.068741 CCCAGACTACCTATTCCGCAC 59.931 57.143 0.00 0.00 0.00 5.34
314 315 1.342674 ACCCAGACTACCTATTCCGCA 60.343 52.381 0.00 0.00 0.00 5.69
315 316 1.411041 ACCCAGACTACCTATTCCGC 58.589 55.000 0.00 0.00 0.00 5.54
316 317 2.483188 GCAACCCAGACTACCTATTCCG 60.483 54.545 0.00 0.00 0.00 4.30
317 318 2.772515 AGCAACCCAGACTACCTATTCC 59.227 50.000 0.00 0.00 0.00 3.01
318 319 4.489306 AAGCAACCCAGACTACCTATTC 57.511 45.455 0.00 0.00 0.00 1.75
319 320 4.929146 AAAGCAACCCAGACTACCTATT 57.071 40.909 0.00 0.00 0.00 1.73
320 321 4.929146 AAAAGCAACCCAGACTACCTAT 57.071 40.909 0.00 0.00 0.00 2.57
321 322 4.717279 AAAAAGCAACCCAGACTACCTA 57.283 40.909 0.00 0.00 0.00 3.08
322 323 3.595190 AAAAAGCAACCCAGACTACCT 57.405 42.857 0.00 0.00 0.00 3.08
323 324 4.217767 CCTTAAAAAGCAACCCAGACTACC 59.782 45.833 0.00 0.00 0.00 3.18
324 325 4.825634 ACCTTAAAAAGCAACCCAGACTAC 59.174 41.667 0.00 0.00 0.00 2.73
325 326 5.056553 ACCTTAAAAAGCAACCCAGACTA 57.943 39.130 0.00 0.00 0.00 2.59
326 327 3.910989 ACCTTAAAAAGCAACCCAGACT 58.089 40.909 0.00 0.00 0.00 3.24
327 328 4.098807 TGAACCTTAAAAAGCAACCCAGAC 59.901 41.667 0.00 0.00 0.00 3.51
328 329 4.282496 TGAACCTTAAAAAGCAACCCAGA 58.718 39.130 0.00 0.00 0.00 3.86
329 330 4.664150 TGAACCTTAAAAAGCAACCCAG 57.336 40.909 0.00 0.00 0.00 4.45
330 331 5.422214 TTTGAACCTTAAAAAGCAACCCA 57.578 34.783 0.00 0.00 0.00 4.51
331 332 6.935741 ATTTTGAACCTTAAAAAGCAACCC 57.064 33.333 0.00 0.00 31.54 4.11
332 333 8.454894 TGAAATTTTGAACCTTAAAAAGCAACC 58.545 29.630 0.00 0.00 31.54 3.77
333 334 9.489393 CTGAAATTTTGAACCTTAAAAAGCAAC 57.511 29.630 0.00 0.00 31.54 4.17
334 335 8.180920 GCTGAAATTTTGAACCTTAAAAAGCAA 58.819 29.630 0.00 0.00 31.99 3.91
335 336 7.552330 AGCTGAAATTTTGAACCTTAAAAAGCA 59.448 29.630 0.00 0.00 33.14 3.91
336 337 7.852454 CAGCTGAAATTTTGAACCTTAAAAAGC 59.148 33.333 8.42 0.00 31.90 3.51
337 338 7.852454 GCAGCTGAAATTTTGAACCTTAAAAAG 59.148 33.333 20.43 0.00 31.54 2.27
338 339 7.201688 GGCAGCTGAAATTTTGAACCTTAAAAA 60.202 33.333 20.43 0.00 31.54 1.94
339 340 6.259829 GGCAGCTGAAATTTTGAACCTTAAAA 59.740 34.615 20.43 0.00 0.00 1.52
340 341 5.757808 GGCAGCTGAAATTTTGAACCTTAAA 59.242 36.000 20.43 0.00 0.00 1.52
341 342 5.296748 GGCAGCTGAAATTTTGAACCTTAA 58.703 37.500 20.43 0.00 0.00 1.85
342 343 4.558496 CGGCAGCTGAAATTTTGAACCTTA 60.558 41.667 20.43 0.00 0.00 2.69
343 344 3.732212 GGCAGCTGAAATTTTGAACCTT 58.268 40.909 20.43 0.00 0.00 3.50
344 345 2.288395 CGGCAGCTGAAATTTTGAACCT 60.288 45.455 20.43 0.00 0.00 3.50
345 346 2.061028 CGGCAGCTGAAATTTTGAACC 58.939 47.619 20.43 3.57 0.00 3.62
346 347 2.061028 CCGGCAGCTGAAATTTTGAAC 58.939 47.619 20.43 0.00 0.00 3.18
347 348 1.686052 ACCGGCAGCTGAAATTTTGAA 59.314 42.857 20.43 0.00 0.00 2.69
348 349 1.327303 ACCGGCAGCTGAAATTTTGA 58.673 45.000 20.43 0.00 0.00 2.69
349 350 3.508744 ATACCGGCAGCTGAAATTTTG 57.491 42.857 20.43 0.00 0.00 2.44
350 351 3.763897 AGAATACCGGCAGCTGAAATTTT 59.236 39.130 20.43 2.79 0.00 1.82
351 352 3.356290 AGAATACCGGCAGCTGAAATTT 58.644 40.909 20.43 2.19 0.00 1.82
352 353 2.945668 GAGAATACCGGCAGCTGAAATT 59.054 45.455 20.43 8.42 0.00 1.82
353 354 2.565841 GAGAATACCGGCAGCTGAAAT 58.434 47.619 20.43 1.29 0.00 2.17
354 355 1.406887 GGAGAATACCGGCAGCTGAAA 60.407 52.381 20.43 0.00 0.00 2.69
355 356 0.178068 GGAGAATACCGGCAGCTGAA 59.822 55.000 20.43 0.00 0.00 3.02
356 357 1.686325 GGGAGAATACCGGCAGCTGA 61.686 60.000 20.43 0.00 0.00 4.26
357 358 1.227674 GGGAGAATACCGGCAGCTG 60.228 63.158 10.11 10.11 0.00 4.24
358 359 1.383248 AGGGAGAATACCGGCAGCT 60.383 57.895 0.00 0.00 0.00 4.24
359 360 1.069935 GAGGGAGAATACCGGCAGC 59.930 63.158 0.00 0.00 0.00 5.25
360 361 1.123928 AAGAGGGAGAATACCGGCAG 58.876 55.000 0.00 0.00 0.00 4.85
361 362 0.830648 CAAGAGGGAGAATACCGGCA 59.169 55.000 0.00 0.00 0.00 5.69
362 363 1.120530 TCAAGAGGGAGAATACCGGC 58.879 55.000 0.00 0.00 0.00 6.13
363 364 2.700897 ACATCAAGAGGGAGAATACCGG 59.299 50.000 0.00 0.00 0.00 5.28
364 365 5.531122 TTACATCAAGAGGGAGAATACCG 57.469 43.478 0.00 0.00 0.00 4.02
365 366 6.056236 GGTTTACATCAAGAGGGAGAATACC 58.944 44.000 0.00 0.00 0.00 2.73
366 367 6.890293 AGGTTTACATCAAGAGGGAGAATAC 58.110 40.000 0.00 0.00 0.00 1.89
367 368 7.338710 CAAGGTTTACATCAAGAGGGAGAATA 58.661 38.462 0.00 0.00 0.00 1.75
368 369 6.183347 CAAGGTTTACATCAAGAGGGAGAAT 58.817 40.000 0.00 0.00 0.00 2.40
369 370 5.560724 CAAGGTTTACATCAAGAGGGAGAA 58.439 41.667 0.00 0.00 0.00 2.87
370 371 4.565652 GCAAGGTTTACATCAAGAGGGAGA 60.566 45.833 0.00 0.00 0.00 3.71
371 372 3.691609 GCAAGGTTTACATCAAGAGGGAG 59.308 47.826 0.00 0.00 0.00 4.30
372 373 3.073798 TGCAAGGTTTACATCAAGAGGGA 59.926 43.478 0.00 0.00 0.00 4.20
373 374 3.420893 TGCAAGGTTTACATCAAGAGGG 58.579 45.455 0.00 0.00 0.00 4.30
374 375 6.949352 ATATGCAAGGTTTACATCAAGAGG 57.051 37.500 0.00 0.00 0.00 3.69
375 376 9.888878 CATAATATGCAAGGTTTACATCAAGAG 57.111 33.333 0.00 0.00 0.00 2.85
376 377 9.625747 TCATAATATGCAAGGTTTACATCAAGA 57.374 29.630 0.00 0.00 0.00 3.02
377 378 9.888878 CTCATAATATGCAAGGTTTACATCAAG 57.111 33.333 0.00 0.00 0.00 3.02
378 379 9.625747 TCTCATAATATGCAAGGTTTACATCAA 57.374 29.630 0.00 0.00 0.00 2.57
379 380 9.276590 CTCTCATAATATGCAAGGTTTACATCA 57.723 33.333 0.00 0.00 0.00 3.07
380 381 9.494271 TCTCTCATAATATGCAAGGTTTACATC 57.506 33.333 0.00 0.00 0.00 3.06
381 382 9.851686 TTCTCTCATAATATGCAAGGTTTACAT 57.148 29.630 0.00 0.00 0.00 2.29
382 383 9.679661 TTTCTCTCATAATATGCAAGGTTTACA 57.320 29.630 0.00 0.00 0.00 2.41
385 386 8.689972 CCTTTTCTCTCATAATATGCAAGGTTT 58.310 33.333 0.00 0.00 0.00 3.27
386 387 7.836183 ACCTTTTCTCTCATAATATGCAAGGTT 59.164 33.333 0.00 0.00 31.04 3.50
387 388 7.349598 ACCTTTTCTCTCATAATATGCAAGGT 58.650 34.615 0.00 0.00 0.00 3.50
388 389 7.814264 ACCTTTTCTCTCATAATATGCAAGG 57.186 36.000 0.00 0.00 0.00 3.61
457 458 9.979578 TTGCATCATGTTTTTCTACTGTTATTT 57.020 25.926 0.00 0.00 0.00 1.40
458 459 9.979578 TTTGCATCATGTTTTTCTACTGTTATT 57.020 25.926 0.00 0.00 0.00 1.40
459 460 9.979578 TTTTGCATCATGTTTTTCTACTGTTAT 57.020 25.926 0.00 0.00 0.00 1.89
460 461 9.979578 ATTTTGCATCATGTTTTTCTACTGTTA 57.020 25.926 0.00 0.00 0.00 2.41
461 462 8.767085 CATTTTGCATCATGTTTTTCTACTGTT 58.233 29.630 0.00 0.00 0.00 3.16
462 463 7.385752 CCATTTTGCATCATGTTTTTCTACTGT 59.614 33.333 0.00 0.00 0.00 3.55
463 464 7.599621 TCCATTTTGCATCATGTTTTTCTACTG 59.400 33.333 0.00 0.00 0.00 2.74
464 465 7.599998 GTCCATTTTGCATCATGTTTTTCTACT 59.400 33.333 0.00 0.00 0.00 2.57
465 466 7.410728 CGTCCATTTTGCATCATGTTTTTCTAC 60.411 37.037 0.00 0.00 0.00 2.59
466 467 6.585702 CGTCCATTTTGCATCATGTTTTTCTA 59.414 34.615 0.00 0.00 0.00 2.10
467 468 5.406175 CGTCCATTTTGCATCATGTTTTTCT 59.594 36.000 0.00 0.00 0.00 2.52
468 469 5.177327 ACGTCCATTTTGCATCATGTTTTTC 59.823 36.000 0.00 0.00 0.00 2.29
469 470 5.050227 CACGTCCATTTTGCATCATGTTTTT 60.050 36.000 0.00 0.00 0.00 1.94
470 471 4.448395 CACGTCCATTTTGCATCATGTTTT 59.552 37.500 0.00 0.00 0.00 2.43
471 472 3.989167 CACGTCCATTTTGCATCATGTTT 59.011 39.130 0.00 0.00 0.00 2.83
472 473 3.005684 ACACGTCCATTTTGCATCATGTT 59.994 39.130 0.00 0.00 0.00 2.71
473 474 2.557924 ACACGTCCATTTTGCATCATGT 59.442 40.909 0.00 0.00 0.00 3.21
474 475 2.918600 CACACGTCCATTTTGCATCATG 59.081 45.455 0.00 0.00 0.00 3.07
475 476 2.557924 ACACACGTCCATTTTGCATCAT 59.442 40.909 0.00 0.00 0.00 2.45
476 477 1.952990 ACACACGTCCATTTTGCATCA 59.047 42.857 0.00 0.00 0.00 3.07
477 478 2.584791 GACACACGTCCATTTTGCATC 58.415 47.619 0.00 0.00 36.02 3.91
478 479 2.704725 GACACACGTCCATTTTGCAT 57.295 45.000 0.00 0.00 36.02 3.96
488 489 3.683340 GGAGGAAAATAAGGACACACGTC 59.317 47.826 0.00 0.00 41.80 4.34
489 490 3.326880 AGGAGGAAAATAAGGACACACGT 59.673 43.478 0.00 0.00 0.00 4.49
490 491 3.939066 AGGAGGAAAATAAGGACACACG 58.061 45.455 0.00 0.00 0.00 4.49
491 492 7.610305 TCAATAAGGAGGAAAATAAGGACACAC 59.390 37.037 0.00 0.00 0.00 3.82
492 493 7.695055 TCAATAAGGAGGAAAATAAGGACACA 58.305 34.615 0.00 0.00 0.00 3.72
493 494 8.753497 ATCAATAAGGAGGAAAATAAGGACAC 57.247 34.615 0.00 0.00 0.00 3.67
494 495 9.768215 AAATCAATAAGGAGGAAAATAAGGACA 57.232 29.630 0.00 0.00 0.00 4.02
503 504 9.762933 CAAAACAGAAAATCAATAAGGAGGAAA 57.237 29.630 0.00 0.00 0.00 3.13
504 505 8.923270 ACAAAACAGAAAATCAATAAGGAGGAA 58.077 29.630 0.00 0.00 0.00 3.36
505 506 8.477419 ACAAAACAGAAAATCAATAAGGAGGA 57.523 30.769 0.00 0.00 0.00 3.71
506 507 7.814587 GGACAAAACAGAAAATCAATAAGGAGG 59.185 37.037 0.00 0.00 0.00 4.30
507 508 7.538678 CGGACAAAACAGAAAATCAATAAGGAG 59.461 37.037 0.00 0.00 0.00 3.69
508 509 7.229707 TCGGACAAAACAGAAAATCAATAAGGA 59.770 33.333 0.00 0.00 0.00 3.36
509 510 7.367285 TCGGACAAAACAGAAAATCAATAAGG 58.633 34.615 0.00 0.00 0.00 2.69
510 511 8.289618 TCTCGGACAAAACAGAAAATCAATAAG 58.710 33.333 0.00 0.00 0.00 1.73
511 512 8.160521 TCTCGGACAAAACAGAAAATCAATAA 57.839 30.769 0.00 0.00 0.00 1.40
512 513 7.737972 TCTCGGACAAAACAGAAAATCAATA 57.262 32.000 0.00 0.00 0.00 1.90
513 514 6.633500 TCTCGGACAAAACAGAAAATCAAT 57.367 33.333 0.00 0.00 0.00 2.57
514 515 6.633500 ATCTCGGACAAAACAGAAAATCAA 57.367 33.333 0.00 0.00 0.00 2.57
515 516 6.708502 TGTATCTCGGACAAAACAGAAAATCA 59.291 34.615 0.00 0.00 0.00 2.57
516 517 7.129109 TGTATCTCGGACAAAACAGAAAATC 57.871 36.000 0.00 0.00 0.00 2.17
517 518 7.504924 TTGTATCTCGGACAAAACAGAAAAT 57.495 32.000 0.00 0.00 33.93 1.82
518 519 6.928979 TTGTATCTCGGACAAAACAGAAAA 57.071 33.333 0.00 0.00 33.93 2.29
519 520 6.928979 TTTGTATCTCGGACAAAACAGAAA 57.071 33.333 0.00 0.00 42.33 2.52
520 521 6.928979 TTTTGTATCTCGGACAAAACAGAA 57.071 33.333 9.07 0.00 46.55 3.02
541 542 1.409982 GCAGCGTTGCGTGTGTTTTT 61.410 50.000 8.94 0.00 41.13 1.94
542 543 1.871789 GCAGCGTTGCGTGTGTTTT 60.872 52.632 8.94 0.00 41.13 2.43
543 544 2.277884 GCAGCGTTGCGTGTGTTT 60.278 55.556 8.94 0.00 41.13 2.83
552 553 5.641777 ATGCATATATATACGCAGCGTTG 57.358 39.130 28.31 17.20 41.54 4.10
553 554 5.890110 GATGCATATATATACGCAGCGTT 57.110 39.130 28.31 16.07 41.54 4.84
556 557 5.107837 GGTTCGATGCATATATATACGCAGC 60.108 44.000 16.81 16.81 37.88 5.25
557 558 5.115622 CGGTTCGATGCATATATATACGCAG 59.884 44.000 17.51 6.66 37.88 5.18
558 559 4.973663 CGGTTCGATGCATATATATACGCA 59.026 41.667 15.23 15.23 39.01 5.24
559 560 5.115171 GTCGGTTCGATGCATATATATACGC 59.885 44.000 0.00 3.84 38.42 4.42
560 561 5.624081 GGTCGGTTCGATGCATATATATACG 59.376 44.000 0.00 0.00 38.42 3.06
561 562 5.919141 GGGTCGGTTCGATGCATATATATAC 59.081 44.000 0.00 0.00 38.42 1.47
562 563 5.595133 TGGGTCGGTTCGATGCATATATATA 59.405 40.000 0.00 0.00 38.42 0.86
563 564 4.404394 TGGGTCGGTTCGATGCATATATAT 59.596 41.667 0.00 0.00 38.42 0.86
564 565 3.764972 TGGGTCGGTTCGATGCATATATA 59.235 43.478 0.00 0.00 38.42 0.86
565 566 2.565391 TGGGTCGGTTCGATGCATATAT 59.435 45.455 0.00 0.00 38.42 0.86
566 567 1.964933 TGGGTCGGTTCGATGCATATA 59.035 47.619 0.00 0.00 38.42 0.86
567 568 0.756294 TGGGTCGGTTCGATGCATAT 59.244 50.000 0.00 0.00 38.42 1.78
568 569 0.537653 TTGGGTCGGTTCGATGCATA 59.462 50.000 0.00 0.00 38.42 3.14
569 570 1.024579 GTTGGGTCGGTTCGATGCAT 61.025 55.000 0.00 0.00 38.42 3.96
570 571 1.669760 GTTGGGTCGGTTCGATGCA 60.670 57.895 0.00 0.00 38.42 3.96
571 572 2.736682 CGTTGGGTCGGTTCGATGC 61.737 63.158 0.00 0.00 38.42 3.91
572 573 1.080366 TCGTTGGGTCGGTTCGATG 60.080 57.895 0.00 0.00 38.42 3.84
573 574 1.080298 GTCGTTGGGTCGGTTCGAT 60.080 57.895 0.00 0.00 38.42 3.59
574 575 0.888736 TAGTCGTTGGGTCGGTTCGA 60.889 55.000 0.00 0.00 0.00 3.71
575 576 0.455633 CTAGTCGTTGGGTCGGTTCG 60.456 60.000 0.00 0.00 0.00 3.95
576 577 0.600057 ACTAGTCGTTGGGTCGGTTC 59.400 55.000 0.00 0.00 0.00 3.62
577 578 1.043022 AACTAGTCGTTGGGTCGGTT 58.957 50.000 0.00 0.00 33.72 4.44
578 579 1.043022 AAACTAGTCGTTGGGTCGGT 58.957 50.000 0.00 0.00 35.61 4.69
579 580 1.796459 CAAAACTAGTCGTTGGGTCGG 59.204 52.381 0.00 0.00 35.61 4.79
580 581 1.796459 CCAAAACTAGTCGTTGGGTCG 59.204 52.381 22.38 5.21 38.52 4.79
581 582 2.804527 GTCCAAAACTAGTCGTTGGGTC 59.195 50.000 26.50 19.40 41.82 4.46
582 583 2.436911 AGTCCAAAACTAGTCGTTGGGT 59.563 45.455 26.50 17.04 41.82 4.51
583 584 3.064931 GAGTCCAAAACTAGTCGTTGGG 58.935 50.000 26.50 14.04 41.82 4.12
584 585 3.064931 GGAGTCCAAAACTAGTCGTTGG 58.935 50.000 23.44 23.44 42.70 3.77
585 586 3.724374 TGGAGTCCAAAACTAGTCGTTG 58.276 45.455 10.20 10.82 38.74 4.10
586 587 4.411256 TTGGAGTCCAAAACTAGTCGTT 57.589 40.909 22.59 0.00 40.92 3.85
592 593 8.685253 TCCATGTAGGATTGGAGTCCAAAACTA 61.685 40.741 27.93 25.71 43.07 2.24
593 594 7.950045 TCCATGTAGGATTGGAGTCCAAAACT 61.950 42.308 27.93 26.64 43.07 2.66
594 595 5.806406 TCCATGTAGGATTGGAGTCCAAAAC 60.806 44.000 27.93 21.80 43.07 2.43
595 596 4.290985 TCCATGTAGGATTGGAGTCCAAAA 59.709 41.667 27.93 7.42 43.07 2.44
596 597 3.849574 TCCATGTAGGATTGGAGTCCAAA 59.150 43.478 27.93 11.32 43.07 3.28
597 598 3.459828 TCCATGTAGGATTGGAGTCCAA 58.540 45.455 26.54 26.54 43.07 3.53
598 599 3.129262 TCCATGTAGGATTGGAGTCCA 57.871 47.619 8.12 8.12 43.07 4.02
608 609 4.689150 GCTGGAGTACTAGTCCATGTAGGA 60.689 50.000 12.33 0.00 45.99 2.94
609 610 3.570550 GCTGGAGTACTAGTCCATGTAGG 59.429 52.174 12.33 3.15 45.99 3.18
610 611 4.036971 GTGCTGGAGTACTAGTCCATGTAG 59.963 50.000 12.33 3.47 45.99 2.74
611 612 3.952323 GTGCTGGAGTACTAGTCCATGTA 59.048 47.826 12.33 5.06 45.99 2.29
612 613 2.761208 GTGCTGGAGTACTAGTCCATGT 59.239 50.000 12.33 0.00 45.99 3.21
613 614 2.101582 GGTGCTGGAGTACTAGTCCATG 59.898 54.545 12.33 8.43 45.99 3.66
614 615 2.023888 AGGTGCTGGAGTACTAGTCCAT 60.024 50.000 12.33 0.00 45.99 3.41
615 616 1.358103 AGGTGCTGGAGTACTAGTCCA 59.642 52.381 11.53 11.53 45.07 4.02
616 617 2.146920 AGGTGCTGGAGTACTAGTCC 57.853 55.000 0.00 3.18 38.22 3.85
617 618 5.593010 CAATTAGGTGCTGGAGTACTAGTC 58.407 45.833 0.00 0.00 0.00 2.59
618 619 4.141914 GCAATTAGGTGCTGGAGTACTAGT 60.142 45.833 0.00 0.00 41.51 2.57
619 620 4.141937 TGCAATTAGGTGCTGGAGTACTAG 60.142 45.833 0.00 0.00 45.17 2.57
620 621 3.772572 TGCAATTAGGTGCTGGAGTACTA 59.227 43.478 0.00 0.00 45.17 1.82
621 622 2.571653 TGCAATTAGGTGCTGGAGTACT 59.428 45.455 0.00 0.00 45.17 2.73
622 623 2.985896 TGCAATTAGGTGCTGGAGTAC 58.014 47.619 0.00 0.00 45.17 2.73
623 624 3.712016 TTGCAATTAGGTGCTGGAGTA 57.288 42.857 0.00 0.00 45.17 2.59
624 625 2.584835 TTGCAATTAGGTGCTGGAGT 57.415 45.000 0.00 0.00 45.17 3.85
625 626 2.416431 GCTTTGCAATTAGGTGCTGGAG 60.416 50.000 0.00 0.00 45.17 3.86
626 627 1.545582 GCTTTGCAATTAGGTGCTGGA 59.454 47.619 0.00 0.00 45.17 3.86
627 628 1.404583 GGCTTTGCAATTAGGTGCTGG 60.405 52.381 0.00 0.00 45.17 4.85
628 629 1.733389 CGGCTTTGCAATTAGGTGCTG 60.733 52.381 0.00 0.07 45.17 4.41
629 630 0.527565 CGGCTTTGCAATTAGGTGCT 59.472 50.000 0.00 0.00 45.17 4.40
630 631 0.458370 CCGGCTTTGCAATTAGGTGC 60.458 55.000 0.00 0.00 45.15 5.01
631 632 0.887933 ACCGGCTTTGCAATTAGGTG 59.112 50.000 0.00 0.00 0.00 4.00
632 633 1.173913 GACCGGCTTTGCAATTAGGT 58.826 50.000 13.77 13.77 0.00 3.08
633 634 1.135402 GTGACCGGCTTTGCAATTAGG 60.135 52.381 0.00 4.58 0.00 2.69
634 635 1.135402 GGTGACCGGCTTTGCAATTAG 60.135 52.381 0.00 0.00 0.00 1.73
635 636 0.885196 GGTGACCGGCTTTGCAATTA 59.115 50.000 0.00 0.00 0.00 1.40
636 637 1.665442 GGTGACCGGCTTTGCAATT 59.335 52.632 0.00 0.00 0.00 2.32
637 638 2.275380 GGGTGACCGGCTTTGCAAT 61.275 57.895 0.00 0.00 43.64 3.56
638 639 2.909965 GGGTGACCGGCTTTGCAA 60.910 61.111 0.00 0.00 43.64 4.08
649 650 2.188817 AGTTGAGATGTAGGGGGTGAC 58.811 52.381 0.00 0.00 0.00 3.67
650 651 2.642171 AGTTGAGATGTAGGGGGTGA 57.358 50.000 0.00 0.00 0.00 4.02
651 652 3.118371 GGTAAGTTGAGATGTAGGGGGTG 60.118 52.174 0.00 0.00 0.00 4.61
652 653 3.113043 GGTAAGTTGAGATGTAGGGGGT 58.887 50.000 0.00 0.00 0.00 4.95
653 654 3.385115 AGGTAAGTTGAGATGTAGGGGG 58.615 50.000 0.00 0.00 0.00 5.40
654 655 5.209659 ACTAGGTAAGTTGAGATGTAGGGG 58.790 45.833 0.00 0.00 33.35 4.79
655 656 6.793505 AACTAGGTAAGTTGAGATGTAGGG 57.206 41.667 0.00 0.00 46.90 3.53
667 668 4.964897 AGCCGGGTAATTAACTAGGTAAGT 59.035 41.667 3.10 6.04 41.49 2.24
668 669 5.541953 AGCCGGGTAATTAACTAGGTAAG 57.458 43.478 3.10 0.00 0.00 2.34
669 670 5.011023 GCTAGCCGGGTAATTAACTAGGTAA 59.989 44.000 15.38 1.94 0.00 2.85
670 671 4.524328 GCTAGCCGGGTAATTAACTAGGTA 59.476 45.833 15.38 8.81 0.00 3.08
671 672 3.323115 GCTAGCCGGGTAATTAACTAGGT 59.677 47.826 15.38 8.25 0.00 3.08
672 673 3.577415 AGCTAGCCGGGTAATTAACTAGG 59.423 47.826 15.38 10.07 0.00 3.02
673 674 4.868314 AGCTAGCCGGGTAATTAACTAG 57.132 45.455 15.38 9.22 0.00 2.57
674 675 4.650588 TCAAGCTAGCCGGGTAATTAACTA 59.349 41.667 15.38 0.00 0.00 2.24
675 676 3.453353 TCAAGCTAGCCGGGTAATTAACT 59.547 43.478 15.38 4.60 0.00 2.24
676 677 3.800531 TCAAGCTAGCCGGGTAATTAAC 58.199 45.455 15.38 2.33 0.00 2.01
677 678 4.101898 TGATCAAGCTAGCCGGGTAATTAA 59.898 41.667 15.38 0.00 0.00 1.40
678 679 3.644265 TGATCAAGCTAGCCGGGTAATTA 59.356 43.478 15.38 0.00 0.00 1.40
679 680 2.438021 TGATCAAGCTAGCCGGGTAATT 59.562 45.455 15.38 9.69 0.00 1.40
680 681 2.047061 TGATCAAGCTAGCCGGGTAAT 58.953 47.619 15.38 4.59 0.00 1.89
681 682 1.138266 GTGATCAAGCTAGCCGGGTAA 59.862 52.381 15.38 0.00 0.00 2.85
682 683 0.750850 GTGATCAAGCTAGCCGGGTA 59.249 55.000 13.71 13.71 0.00 3.69
683 684 1.522569 GTGATCAAGCTAGCCGGGT 59.477 57.895 12.58 12.58 0.00 5.28
684 685 1.592669 CGTGATCAAGCTAGCCGGG 60.593 63.158 12.13 0.82 0.00 5.73
685 686 0.032678 ATCGTGATCAAGCTAGCCGG 59.967 55.000 12.13 0.00 0.00 6.13
686 687 1.858091 AATCGTGATCAAGCTAGCCG 58.142 50.000 12.13 6.00 0.00 5.52
687 688 3.491267 GTGTAATCGTGATCAAGCTAGCC 59.509 47.826 12.13 0.00 0.00 3.93
688 689 4.112634 TGTGTAATCGTGATCAAGCTAGC 58.887 43.478 6.62 6.62 0.00 3.42
689 690 7.358765 GCTTATGTGTAATCGTGATCAAGCTAG 60.359 40.741 3.49 0.00 33.61 3.42
690 691 6.420903 GCTTATGTGTAATCGTGATCAAGCTA 59.579 38.462 3.49 0.00 33.61 3.32
691 692 5.235186 GCTTATGTGTAATCGTGATCAAGCT 59.765 40.000 3.49 0.00 33.61 3.74
692 693 5.006649 TGCTTATGTGTAATCGTGATCAAGC 59.993 40.000 3.49 2.21 36.18 4.01
693 694 6.588348 TGCTTATGTGTAATCGTGATCAAG 57.412 37.500 0.00 0.00 0.00 3.02
694 695 6.976636 TTGCTTATGTGTAATCGTGATCAA 57.023 33.333 0.00 0.00 0.00 2.57
695 696 6.593770 AGTTTGCTTATGTGTAATCGTGATCA 59.406 34.615 0.00 0.00 0.00 2.92
696 697 7.005062 AGTTTGCTTATGTGTAATCGTGATC 57.995 36.000 0.00 0.00 0.00 2.92
697 698 6.985188 AGTTTGCTTATGTGTAATCGTGAT 57.015 33.333 0.00 0.00 0.00 3.06
698 699 7.601130 AGTTAGTTTGCTTATGTGTAATCGTGA 59.399 33.333 0.00 0.00 0.00 4.35
699 700 7.688167 CAGTTAGTTTGCTTATGTGTAATCGTG 59.312 37.037 0.00 0.00 0.00 4.35
700 701 7.148474 CCAGTTAGTTTGCTTATGTGTAATCGT 60.148 37.037 0.00 0.00 0.00 3.73
701 702 7.180079 CCAGTTAGTTTGCTTATGTGTAATCG 58.820 38.462 0.00 0.00 0.00 3.34
702 703 6.967199 GCCAGTTAGTTTGCTTATGTGTAATC 59.033 38.462 0.00 0.00 0.00 1.75
703 704 6.432783 TGCCAGTTAGTTTGCTTATGTGTAAT 59.567 34.615 0.00 0.00 0.00 1.89
704 705 5.765677 TGCCAGTTAGTTTGCTTATGTGTAA 59.234 36.000 0.00 0.00 0.00 2.41
705 706 5.180492 GTGCCAGTTAGTTTGCTTATGTGTA 59.820 40.000 0.00 0.00 0.00 2.90
706 707 4.023193 GTGCCAGTTAGTTTGCTTATGTGT 60.023 41.667 0.00 0.00 0.00 3.72
707 708 4.023279 TGTGCCAGTTAGTTTGCTTATGTG 60.023 41.667 0.00 0.00 0.00 3.21
708 709 4.023193 GTGTGCCAGTTAGTTTGCTTATGT 60.023 41.667 0.00 0.00 0.00 2.29
709 710 4.475944 GTGTGCCAGTTAGTTTGCTTATG 58.524 43.478 0.00 0.00 0.00 1.90
710 711 3.188460 CGTGTGCCAGTTAGTTTGCTTAT 59.812 43.478 0.00 0.00 0.00 1.73
711 712 2.546368 CGTGTGCCAGTTAGTTTGCTTA 59.454 45.455 0.00 0.00 0.00 3.09
712 713 1.333619 CGTGTGCCAGTTAGTTTGCTT 59.666 47.619 0.00 0.00 0.00 3.91
713 714 0.944386 CGTGTGCCAGTTAGTTTGCT 59.056 50.000 0.00 0.00 0.00 3.91
714 715 0.941542 TCGTGTGCCAGTTAGTTTGC 59.058 50.000 0.00 0.00 0.00 3.68
715 716 3.181534 CGTATCGTGTGCCAGTTAGTTTG 60.182 47.826 0.00 0.00 0.00 2.93
716 717 2.991190 CGTATCGTGTGCCAGTTAGTTT 59.009 45.455 0.00 0.00 0.00 2.66
717 718 2.029649 ACGTATCGTGTGCCAGTTAGTT 60.030 45.455 0.00 0.00 39.18 2.24
718 719 1.542915 ACGTATCGTGTGCCAGTTAGT 59.457 47.619 0.00 0.00 39.18 2.24
719 720 2.273370 ACGTATCGTGTGCCAGTTAG 57.727 50.000 0.00 0.00 39.18 2.34
730 731 4.399004 AGTACTAGGAGTCACGTATCGT 57.601 45.455 0.00 0.00 42.36 3.73
731 732 5.527951 AGTAGTACTAGGAGTCACGTATCG 58.472 45.833 1.87 0.00 0.00 2.92
732 733 7.429633 TGTAGTAGTACTAGGAGTCACGTATC 58.570 42.308 10.38 0.00 30.12 2.24
733 734 7.353414 TGTAGTAGTACTAGGAGTCACGTAT 57.647 40.000 10.38 0.00 30.12 3.06
734 735 6.775594 TGTAGTAGTACTAGGAGTCACGTA 57.224 41.667 10.38 0.00 30.12 3.57
735 736 5.667539 TGTAGTAGTACTAGGAGTCACGT 57.332 43.478 10.38 0.00 30.12 4.49
736 737 8.654230 TTAATGTAGTAGTACTAGGAGTCACG 57.346 38.462 10.38 0.00 30.12 4.35
747 748 9.460906 GCAGTGTCCTAATTAATGTAGTAGTAC 57.539 37.037 0.37 0.37 0.00 2.73
748 749 9.417561 AGCAGTGTCCTAATTAATGTAGTAGTA 57.582 33.333 0.00 0.00 0.00 1.82
749 750 8.307582 AGCAGTGTCCTAATTAATGTAGTAGT 57.692 34.615 0.00 0.00 0.00 2.73
752 753 7.705325 CGTTAGCAGTGTCCTAATTAATGTAGT 59.295 37.037 0.00 0.00 0.00 2.73
753 754 7.306632 GCGTTAGCAGTGTCCTAATTAATGTAG 60.307 40.741 0.00 0.00 44.35 2.74
754 755 6.477688 GCGTTAGCAGTGTCCTAATTAATGTA 59.522 38.462 0.00 0.00 44.35 2.29
755 756 5.293569 GCGTTAGCAGTGTCCTAATTAATGT 59.706 40.000 0.00 0.00 44.35 2.71
756 757 5.738370 GCGTTAGCAGTGTCCTAATTAATG 58.262 41.667 0.00 0.00 44.35 1.90
757 758 5.986004 GCGTTAGCAGTGTCCTAATTAAT 57.014 39.130 0.00 0.00 44.35 1.40
773 774 5.857822 AACTTGGTAAAAGCTAGCGTTAG 57.142 39.130 16.40 11.70 0.00 2.34
774 775 7.727331 TTAAACTTGGTAAAAGCTAGCGTTA 57.273 32.000 16.40 12.35 0.00 3.18
775 776 6.622833 TTAAACTTGGTAAAAGCTAGCGTT 57.377 33.333 10.30 10.30 0.00 4.84
776 777 6.038492 TGTTTAAACTTGGTAAAAGCTAGCGT 59.962 34.615 18.72 2.32 0.00 5.07
777 778 6.358822 GTGTTTAAACTTGGTAAAAGCTAGCG 59.641 38.462 18.72 0.00 0.00 4.26
778 779 7.197703 TGTGTTTAAACTTGGTAAAAGCTAGC 58.802 34.615 18.72 6.62 0.00 3.42
779 780 9.016623 GTTGTGTTTAAACTTGGTAAAAGCTAG 57.983 33.333 18.72 0.00 0.00 3.42
780 781 8.741841 AGTTGTGTTTAAACTTGGTAAAAGCTA 58.258 29.630 18.72 0.00 34.16 3.32
781 782 7.608153 AGTTGTGTTTAAACTTGGTAAAAGCT 58.392 30.769 18.72 0.00 34.16 3.74
782 783 7.821595 AGTTGTGTTTAAACTTGGTAAAAGC 57.178 32.000 18.72 0.00 34.16 3.51
797 798 9.609346 AAGTGTCAGTAGTATTAAGTTGTGTTT 57.391 29.630 0.00 0.00 0.00 2.83
799 800 9.909644 CTAAGTGTCAGTAGTATTAAGTTGTGT 57.090 33.333 0.00 0.00 0.00 3.72
800 801 9.355215 CCTAAGTGTCAGTAGTATTAAGTTGTG 57.645 37.037 0.00 0.00 0.00 3.33
801 802 8.033626 GCCTAAGTGTCAGTAGTATTAAGTTGT 58.966 37.037 0.00 0.00 0.00 3.32
802 803 8.033038 TGCCTAAGTGTCAGTAGTATTAAGTTG 58.967 37.037 0.00 0.00 0.00 3.16
803 804 8.130671 TGCCTAAGTGTCAGTAGTATTAAGTT 57.869 34.615 0.00 0.00 0.00 2.66
804 805 7.713734 TGCCTAAGTGTCAGTAGTATTAAGT 57.286 36.000 0.00 0.00 0.00 2.24
805 806 8.198109 ACATGCCTAAGTGTCAGTAGTATTAAG 58.802 37.037 0.00 0.00 0.00 1.85
806 807 8.074613 ACATGCCTAAGTGTCAGTAGTATTAA 57.925 34.615 0.00 0.00 0.00 1.40
807 808 7.655521 ACATGCCTAAGTGTCAGTAGTATTA 57.344 36.000 0.00 0.00 0.00 0.98
808 809 6.546428 ACATGCCTAAGTGTCAGTAGTATT 57.454 37.500 0.00 0.00 0.00 1.89
809 810 6.546428 AACATGCCTAAGTGTCAGTAGTAT 57.454 37.500 0.00 0.00 0.00 2.12
810 811 5.995565 AACATGCCTAAGTGTCAGTAGTA 57.004 39.130 0.00 0.00 0.00 1.82
811 812 4.891992 AACATGCCTAAGTGTCAGTAGT 57.108 40.909 0.00 0.00 0.00 2.73
812 813 4.393062 CCAAACATGCCTAAGTGTCAGTAG 59.607 45.833 0.00 0.00 0.00 2.57
813 814 4.041075 TCCAAACATGCCTAAGTGTCAGTA 59.959 41.667 0.00 0.00 0.00 2.74
814 815 3.149196 CCAAACATGCCTAAGTGTCAGT 58.851 45.455 0.00 0.00 0.00 3.41
815 816 3.411446 TCCAAACATGCCTAAGTGTCAG 58.589 45.455 0.00 0.00 0.00 3.51
816 817 3.500448 TCCAAACATGCCTAAGTGTCA 57.500 42.857 0.00 0.00 0.00 3.58
817 818 6.238759 GGATAATCCAAACATGCCTAAGTGTC 60.239 42.308 0.00 0.00 36.28 3.67
818 819 5.594317 GGATAATCCAAACATGCCTAAGTGT 59.406 40.000 0.00 0.00 36.28 3.55
819 820 5.593909 TGGATAATCCAAACATGCCTAAGTG 59.406 40.000 0.00 0.00 45.00 3.16
820 821 5.765510 TGGATAATCCAAACATGCCTAAGT 58.234 37.500 0.00 0.00 45.00 2.24
832 833 4.518590 CACAGTGTGTGTTGGATAATCCAA 59.481 41.667 15.43 0.00 45.47 3.53
833 834 4.071423 CACAGTGTGTGTTGGATAATCCA 58.929 43.478 15.43 0.00 42.91 3.41
834 835 4.685169 CACAGTGTGTGTTGGATAATCC 57.315 45.455 15.43 0.00 43.08 3.01
847 848 7.855904 GGAATAAGAACAAGTTTACACAGTGTG 59.144 37.037 21.77 21.77 39.75 3.82
848 849 7.773690 AGGAATAAGAACAAGTTTACACAGTGT 59.226 33.333 11.87 11.87 0.00 3.55
849 850 8.154649 AGGAATAAGAACAAGTTTACACAGTG 57.845 34.615 0.00 0.00 0.00 3.66
850 851 8.747538 AAGGAATAAGAACAAGTTTACACAGT 57.252 30.769 0.00 0.00 0.00 3.55
851 852 9.665264 GAAAGGAATAAGAACAAGTTTACACAG 57.335 33.333 0.00 0.00 0.00 3.66
852 853 8.626526 GGAAAGGAATAAGAACAAGTTTACACA 58.373 33.333 0.00 0.00 0.00 3.72
853 854 8.847196 AGGAAAGGAATAAGAACAAGTTTACAC 58.153 33.333 0.00 0.00 0.00 2.90
854 855 8.990163 AGGAAAGGAATAAGAACAAGTTTACA 57.010 30.769 0.00 0.00 0.00 2.41
858 859 9.817809 GAAAAAGGAAAGGAATAAGAACAAGTT 57.182 29.630 0.00 0.00 0.00 2.66
859 860 8.421784 GGAAAAAGGAAAGGAATAAGAACAAGT 58.578 33.333 0.00 0.00 0.00 3.16
860 861 8.642432 AGGAAAAAGGAAAGGAATAAGAACAAG 58.358 33.333 0.00 0.00 0.00 3.16
861 862 8.547481 AGGAAAAAGGAAAGGAATAAGAACAA 57.453 30.769 0.00 0.00 0.00 2.83
862 863 8.547481 AAGGAAAAAGGAAAGGAATAAGAACA 57.453 30.769 0.00 0.00 0.00 3.18
865 866 9.309224 CCTTAAGGAAAAAGGAAAGGAATAAGA 57.691 33.333 17.21 0.00 45.41 2.10
877 878 6.249192 ACTCCAATCTCCTTAAGGAAAAAGG 58.751 40.000 24.31 21.43 44.91 3.11
878 879 7.309438 CCAACTCCAATCTCCTTAAGGAAAAAG 60.309 40.741 24.31 16.65 44.91 2.27
879 880 6.493458 CCAACTCCAATCTCCTTAAGGAAAAA 59.507 38.462 24.31 13.45 44.91 1.94
880 881 6.010219 CCAACTCCAATCTCCTTAAGGAAAA 58.990 40.000 24.31 15.84 44.91 2.29
881 882 5.312178 TCCAACTCCAATCTCCTTAAGGAAA 59.688 40.000 24.31 13.18 44.91 3.13
882 883 4.849810 TCCAACTCCAATCTCCTTAAGGAA 59.150 41.667 24.31 15.48 44.91 3.36
883 884 4.435137 TCCAACTCCAATCTCCTTAAGGA 58.565 43.478 22.94 22.94 43.08 3.36
884 885 4.471386 TCTCCAACTCCAATCTCCTTAAGG 59.529 45.833 15.98 15.98 0.00 2.69
885 886 5.188751 AGTCTCCAACTCCAATCTCCTTAAG 59.811 44.000 0.00 0.00 30.02 1.85
886 887 5.094387 AGTCTCCAACTCCAATCTCCTTAA 58.906 41.667 0.00 0.00 30.02 1.85
887 888 4.689062 AGTCTCCAACTCCAATCTCCTTA 58.311 43.478 0.00 0.00 30.02 2.69
888 889 3.525862 AGTCTCCAACTCCAATCTCCTT 58.474 45.455 0.00 0.00 30.02 3.36
889 890 3.197927 AGTCTCCAACTCCAATCTCCT 57.802 47.619 0.00 0.00 30.02 3.69
899 900 0.976641 TTGGCATCGAGTCTCCAACT 59.023 50.000 6.42 0.00 42.42 3.16
900 901 1.338200 ACTTGGCATCGAGTCTCCAAC 60.338 52.381 6.42 0.00 32.26 3.77
901 902 0.976641 ACTTGGCATCGAGTCTCCAA 59.023 50.000 9.21 9.21 32.26 3.53
902 903 0.532573 GACTTGGCATCGAGTCTCCA 59.467 55.000 9.95 0.00 46.21 3.86
903 904 3.354131 GACTTGGCATCGAGTCTCC 57.646 57.895 9.95 0.00 46.21 3.71
907 908 4.744795 AGAATAAGACTTGGCATCGAGT 57.255 40.909 0.00 0.00 40.20 4.18
908 909 6.314896 AGAAAAGAATAAGACTTGGCATCGAG 59.685 38.462 0.00 0.00 0.00 4.04
909 910 6.173339 AGAAAAGAATAAGACTTGGCATCGA 58.827 36.000 0.00 0.00 0.00 3.59
910 911 6.428385 AGAAAAGAATAAGACTTGGCATCG 57.572 37.500 0.00 0.00 0.00 3.84
911 912 9.133627 GAAAAGAAAAGAATAAGACTTGGCATC 57.866 33.333 0.00 0.00 0.00 3.91
912 913 8.864087 AGAAAAGAAAAGAATAAGACTTGGCAT 58.136 29.630 0.00 0.00 0.00 4.40
913 914 8.237811 AGAAAAGAAAAGAATAAGACTTGGCA 57.762 30.769 0.00 0.00 0.00 4.92
914 915 9.833182 CTAGAAAAGAAAAGAATAAGACTTGGC 57.167 33.333 0.00 0.00 0.00 4.52
917 918 9.015367 GCCCTAGAAAAGAAAAGAATAAGACTT 57.985 33.333 0.00 0.00 0.00 3.01
918 919 8.164070 TGCCCTAGAAAAGAAAAGAATAAGACT 58.836 33.333 0.00 0.00 0.00 3.24
919 920 8.237949 GTGCCCTAGAAAAGAAAAGAATAAGAC 58.762 37.037 0.00 0.00 0.00 3.01
920 921 8.164070 AGTGCCCTAGAAAAGAAAAGAATAAGA 58.836 33.333 0.00 0.00 0.00 2.10
921 922 8.341892 AGTGCCCTAGAAAAGAAAAGAATAAG 57.658 34.615 0.00 0.00 0.00 1.73
922 923 9.227777 GTAGTGCCCTAGAAAAGAAAAGAATAA 57.772 33.333 0.00 0.00 0.00 1.40
923 924 8.603304 AGTAGTGCCCTAGAAAAGAAAAGAATA 58.397 33.333 0.00 0.00 0.00 1.75
924 925 7.462590 AGTAGTGCCCTAGAAAAGAAAAGAAT 58.537 34.615 0.00 0.00 0.00 2.40
925 926 6.838382 AGTAGTGCCCTAGAAAAGAAAAGAA 58.162 36.000 0.00 0.00 0.00 2.52
926 927 6.435292 AGTAGTGCCCTAGAAAAGAAAAGA 57.565 37.500 0.00 0.00 0.00 2.52
927 928 6.072452 CCAAGTAGTGCCCTAGAAAAGAAAAG 60.072 42.308 0.00 0.00 0.00 2.27
928 929 5.768164 CCAAGTAGTGCCCTAGAAAAGAAAA 59.232 40.000 0.00 0.00 0.00 2.29
929 930 5.313712 CCAAGTAGTGCCCTAGAAAAGAAA 58.686 41.667 0.00 0.00 0.00 2.52
930 931 4.806286 GCCAAGTAGTGCCCTAGAAAAGAA 60.806 45.833 0.00 0.00 0.00 2.52
931 932 3.307480 GCCAAGTAGTGCCCTAGAAAAGA 60.307 47.826 0.00 0.00 0.00 2.52
932 933 3.010420 GCCAAGTAGTGCCCTAGAAAAG 58.990 50.000 0.00 0.00 0.00 2.27
933 934 2.373836 TGCCAAGTAGTGCCCTAGAAAA 59.626 45.455 0.00 0.00 0.00 2.29
934 935 1.982226 TGCCAAGTAGTGCCCTAGAAA 59.018 47.619 0.00 0.00 0.00 2.52
935 936 1.278127 GTGCCAAGTAGTGCCCTAGAA 59.722 52.381 0.00 0.00 0.00 2.10
936 937 0.902531 GTGCCAAGTAGTGCCCTAGA 59.097 55.000 0.00 0.00 0.00 2.43
937 938 0.613260 TGTGCCAAGTAGTGCCCTAG 59.387 55.000 0.00 0.00 0.00 3.02
938 939 1.065491 CATGTGCCAAGTAGTGCCCTA 60.065 52.381 0.00 0.00 0.00 3.53
939 940 0.322816 CATGTGCCAAGTAGTGCCCT 60.323 55.000 0.00 0.00 0.00 5.19
940 941 1.937546 GCATGTGCCAAGTAGTGCCC 61.938 60.000 0.00 0.00 34.31 5.36
941 942 1.243342 TGCATGTGCCAAGTAGTGCC 61.243 55.000 2.07 0.00 41.18 5.01
942 943 0.597568 TTGCATGTGCCAAGTAGTGC 59.402 50.000 2.07 0.00 41.18 4.40
943 944 1.400113 CGTTGCATGTGCCAAGTAGTG 60.400 52.381 2.07 0.00 41.18 2.74
944 945 0.874390 CGTTGCATGTGCCAAGTAGT 59.126 50.000 2.07 0.00 41.18 2.73
945 946 0.454957 GCGTTGCATGTGCCAAGTAG 60.455 55.000 2.07 0.00 41.18 2.57
946 947 1.578926 GCGTTGCATGTGCCAAGTA 59.421 52.632 2.07 0.00 41.18 2.24
947 948 2.336088 GCGTTGCATGTGCCAAGT 59.664 55.556 2.07 0.00 41.18 3.16
948 949 2.801996 CGCGTTGCATGTGCCAAG 60.802 61.111 0.00 0.00 41.18 3.61
949 950 4.340019 CCGCGTTGCATGTGCCAA 62.340 61.111 4.92 0.00 41.18 4.52
951 952 3.550339 TTTCCGCGTTGCATGTGCC 62.550 57.895 4.92 0.00 41.18 5.01
952 953 2.050533 TTTCCGCGTTGCATGTGC 60.051 55.556 4.92 0.00 42.50 4.57
953 954 2.082366 GCTTTCCGCGTTGCATGTG 61.082 57.895 4.92 0.00 0.00 3.21
954 955 2.255252 GCTTTCCGCGTTGCATGT 59.745 55.556 4.92 0.00 0.00 3.21
955 956 1.798725 CAGCTTTCCGCGTTGCATG 60.799 57.895 4.92 0.00 45.59 4.06
956 957 1.795170 AACAGCTTTCCGCGTTGCAT 61.795 50.000 4.92 0.00 45.59 3.96
957 958 2.387125 GAACAGCTTTCCGCGTTGCA 62.387 55.000 4.92 0.00 45.59 4.08
958 959 1.725973 GAACAGCTTTCCGCGTTGC 60.726 57.895 4.92 3.41 45.59 4.17
959 960 1.082104 GGAACAGCTTTCCGCGTTG 60.082 57.895 4.92 0.00 45.59 4.10
960 961 1.525077 TGGAACAGCTTTCCGCGTT 60.525 52.632 17.40 4.32 45.59 4.84
961 962 2.110213 TGGAACAGCTTTCCGCGT 59.890 55.556 17.40 0.00 45.59 6.01
973 974 2.205074 CTAGTCGCACATGGATGGAAC 58.795 52.381 0.00 0.00 0.00 3.62
974 975 1.473257 GCTAGTCGCACATGGATGGAA 60.473 52.381 0.00 0.00 38.92 3.53
975 976 0.104855 GCTAGTCGCACATGGATGGA 59.895 55.000 0.00 0.00 38.92 3.41
976 977 0.105593 AGCTAGTCGCACATGGATGG 59.894 55.000 0.00 0.00 42.61 3.51
977 978 1.495878 GAGCTAGTCGCACATGGATG 58.504 55.000 0.00 0.00 42.61 3.51
978 979 0.390860 GGAGCTAGTCGCACATGGAT 59.609 55.000 0.00 0.00 42.61 3.41
979 980 1.676678 GGGAGCTAGTCGCACATGGA 61.677 60.000 0.00 0.00 42.61 3.41
980 981 1.227380 GGGAGCTAGTCGCACATGG 60.227 63.158 0.00 0.00 42.61 3.66
981 982 1.589993 CGGGAGCTAGTCGCACATG 60.590 63.158 0.00 0.00 42.61 3.21
982 983 2.808315 CGGGAGCTAGTCGCACAT 59.192 61.111 0.00 0.00 42.61 3.21
993 994 6.783162 CCGTATATGTATATATAGCGGGAGC 58.217 44.000 20.30 3.54 42.10 4.70
997 998 7.201626 GCTCTCCCGTATATGTATATATAGCGG 60.202 44.444 20.69 20.69 40.81 5.52
998 999 7.464311 CGCTCTCCCGTATATGTATATATAGCG 60.464 44.444 12.87 12.87 33.52 4.26
999 1000 7.201626 CCGCTCTCCCGTATATGTATATATAGC 60.202 44.444 0.00 0.17 33.52 2.97
1000 1001 7.280428 CCCGCTCTCCCGTATATGTATATATAG 59.720 44.444 0.00 0.00 33.52 1.31
1001 1002 7.108194 CCCGCTCTCCCGTATATGTATATATA 58.892 42.308 0.00 0.00 31.97 0.86
1002 1003 5.944599 CCCGCTCTCCCGTATATGTATATAT 59.055 44.000 0.00 0.00 34.04 0.86
1003 1004 5.311265 CCCGCTCTCCCGTATATGTATATA 58.689 45.833 0.00 0.00 0.00 0.86
1004 1005 4.142790 CCCGCTCTCCCGTATATGTATAT 58.857 47.826 0.00 0.00 0.00 0.86
1005 1006 3.548770 CCCGCTCTCCCGTATATGTATA 58.451 50.000 0.00 0.00 0.00 1.47
1006 1007 2.376109 CCCGCTCTCCCGTATATGTAT 58.624 52.381 0.00 0.00 0.00 2.29
1007 1008 1.830279 CCCGCTCTCCCGTATATGTA 58.170 55.000 0.00 0.00 0.00 2.29
1008 1009 1.533469 GCCCGCTCTCCCGTATATGT 61.533 60.000 0.00 0.00 0.00 2.29
1009 1010 1.215647 GCCCGCTCTCCCGTATATG 59.784 63.158 0.00 0.00 0.00 1.78
1010 1011 0.830444 TTGCCCGCTCTCCCGTATAT 60.830 55.000 0.00 0.00 0.00 0.86
1011 1012 1.456145 TTGCCCGCTCTCCCGTATA 60.456 57.895 0.00 0.00 0.00 1.47
1012 1013 2.762459 TTGCCCGCTCTCCCGTAT 60.762 61.111 0.00 0.00 0.00 3.06
1013 1014 3.458163 CTTGCCCGCTCTCCCGTA 61.458 66.667 0.00 0.00 0.00 4.02
1023 1024 3.454587 TATAGTGCCCGCTTGCCCG 62.455 63.158 0.00 0.00 0.00 6.13
1024 1025 1.892391 GTATAGTGCCCGCTTGCCC 60.892 63.158 0.00 0.00 0.00 5.36
1025 1026 2.244651 CGTATAGTGCCCGCTTGCC 61.245 63.158 0.00 0.00 0.00 4.52
1026 1027 2.882366 GCGTATAGTGCCCGCTTGC 61.882 63.158 0.00 0.00 43.81 4.01
1027 1028 3.319904 GCGTATAGTGCCCGCTTG 58.680 61.111 0.00 0.00 43.81 4.01
1034 1035 3.058085 GGAGAGTCTAAGGCGTATAGTGC 60.058 52.174 0.00 0.00 0.00 4.40
1035 1036 4.135306 TGGAGAGTCTAAGGCGTATAGTG 58.865 47.826 0.00 0.00 0.00 2.74
1036 1037 4.391155 CTGGAGAGTCTAAGGCGTATAGT 58.609 47.826 0.00 0.00 0.00 2.12
1037 1038 3.189702 GCTGGAGAGTCTAAGGCGTATAG 59.810 52.174 0.00 0.00 0.00 1.31
1038 1039 3.147629 GCTGGAGAGTCTAAGGCGTATA 58.852 50.000 0.00 0.00 0.00 1.47
1039 1040 1.957877 GCTGGAGAGTCTAAGGCGTAT 59.042 52.381 0.00 0.00 0.00 3.06
1040 1041 1.340697 TGCTGGAGAGTCTAAGGCGTA 60.341 52.381 0.00 0.00 0.00 4.42
1041 1042 0.612174 TGCTGGAGAGTCTAAGGCGT 60.612 55.000 0.00 0.00 0.00 5.68
1042 1043 0.749649 ATGCTGGAGAGTCTAAGGCG 59.250 55.000 0.00 0.00 0.00 5.52
1043 1044 1.759445 TGATGCTGGAGAGTCTAAGGC 59.241 52.381 0.00 0.00 0.00 4.35
1044 1045 4.321899 GCTATGATGCTGGAGAGTCTAAGG 60.322 50.000 0.00 0.00 0.00 2.69
1045 1046 4.523943 AGCTATGATGCTGGAGAGTCTAAG 59.476 45.833 0.00 0.00 42.33 2.18
1046 1047 4.478203 AGCTATGATGCTGGAGAGTCTAA 58.522 43.478 0.00 0.00 42.33 2.10
1047 1048 4.111255 AGCTATGATGCTGGAGAGTCTA 57.889 45.455 0.00 0.00 42.33 2.59
1048 1049 2.961510 AGCTATGATGCTGGAGAGTCT 58.038 47.619 0.00 0.00 42.33 3.24
1049 1050 3.367292 GCTAGCTATGATGCTGGAGAGTC 60.367 52.174 7.70 0.00 42.97 3.36
1050 1051 2.562298 GCTAGCTATGATGCTGGAGAGT 59.438 50.000 7.70 0.00 42.97 3.24
1051 1052 2.827322 AGCTAGCTATGATGCTGGAGAG 59.173 50.000 17.69 0.00 42.97 3.20
1052 1053 2.886913 AGCTAGCTATGATGCTGGAGA 58.113 47.619 17.69 0.00 42.97 3.71
1053 1054 4.015764 TCTAGCTAGCTATGATGCTGGAG 58.984 47.826 24.36 10.85 42.97 3.86
1054 1055 4.039603 TCTAGCTAGCTATGATGCTGGA 57.960 45.455 24.36 12.67 42.97 3.86
1079 1082 1.959085 CTGTCAGGCGCCATGTTTT 59.041 52.632 31.54 2.66 0.00 2.43
1082 1085 4.334118 TGCTGTCAGGCGCCATGT 62.334 61.111 31.54 4.59 34.52 3.21
1152 1158 1.375908 AGCGACGTAGGTCACCGTA 60.376 57.895 15.36 0.00 43.61 4.02
1201 1207 3.103911 GTGGTCGTCTTCGGTGCG 61.104 66.667 0.00 0.00 37.69 5.34
1205 1211 2.178521 CGAGGTGGTCGTCTTCGG 59.821 66.667 0.00 0.00 44.20 4.30
1222 1228 2.825836 CAGGATCTGGTTGCCGGC 60.826 66.667 22.73 22.73 0.00 6.13
1248 1254 1.078426 ATTGTAGCGCTGGTGGTCC 60.078 57.895 22.90 0.00 0.00 4.46
1257 1263 1.941325 AGTAGAAGGCATTGTAGCGC 58.059 50.000 0.00 0.00 34.64 5.92
1305 1311 3.391665 GAGGAGGATGGCCACCACG 62.392 68.421 21.71 0.00 46.39 4.94
1308 1314 2.367512 AGGAGGAGGATGGCCACC 60.368 66.667 8.16 12.35 44.52 4.61
1313 1319 0.178935 GAGGAGGAGGAGGAGGATGG 60.179 65.000 0.00 0.00 0.00 3.51
1362 1368 1.583495 CGTACCTGAGCACCACGAGA 61.583 60.000 0.00 0.00 34.66 4.04
1390 1396 1.205655 CAGGAGTGCGAAGAGATCCAA 59.794 52.381 0.00 0.00 32.21 3.53
1395 1401 1.536073 CCACCAGGAGTGCGAAGAGA 61.536 60.000 0.00 0.00 45.83 3.10
1477 1483 3.304525 CCAGTGACGTAGACGAAGACTTT 60.305 47.826 9.41 0.00 43.02 2.66
1529 1535 1.379443 AGCTCGTCATGGTCGGGTA 60.379 57.895 11.38 0.00 0.00 3.69
1530 1536 2.680352 AGCTCGTCATGGTCGGGT 60.680 61.111 11.38 6.02 0.00 5.28
1533 1539 0.109086 AACTGAGCTCGTCATGGTCG 60.109 55.000 9.64 0.00 33.51 4.79
1538 1544 1.066573 CCTCCAAACTGAGCTCGTCAT 60.067 52.381 9.64 0.86 33.51 3.06
1546 1552 2.892852 TGGATTTTGCCTCCAAACTGAG 59.107 45.455 0.00 0.00 40.45 3.35
1549 1555 2.250924 CCTGGATTTTGCCTCCAAACT 58.749 47.619 0.00 0.00 42.12 2.66
1551 1557 0.975887 GCCTGGATTTTGCCTCCAAA 59.024 50.000 0.00 0.00 42.12 3.28
1552 1558 0.114954 AGCCTGGATTTTGCCTCCAA 59.885 50.000 0.00 0.00 42.12 3.53
1554 1560 1.379642 CGAGCCTGGATTTTGCCTCC 61.380 60.000 0.00 0.00 0.00 4.30
1576 1597 3.570638 CAGGATCTTGCGCCGCTG 61.571 66.667 11.67 3.20 0.00 5.18
1620 1641 4.446413 CCGGCCGTGTAGGTGACC 62.446 72.222 26.12 0.00 43.70 4.02
1663 1684 3.314388 CTGCTTCTTTGGCGTCGGC 62.314 63.158 12.58 12.58 38.90 5.54
1669 1690 2.653115 GTGGCCTGCTTCTTTGGC 59.347 61.111 3.32 0.00 45.42 4.52
1672 1693 2.282462 CCGGTGGCCTGCTTCTTT 60.282 61.111 3.32 0.00 0.00 2.52
1692 1713 4.746309 TGCATGACTGGGCTGCCC 62.746 66.667 30.97 30.97 45.71 5.36
1798 1831 1.294780 CCTGCCTGAACTCGCTTCT 59.705 57.895 0.00 0.00 0.00 2.85
1906 1939 1.163554 GTCTTCCTGCAGCTTCCAAG 58.836 55.000 8.66 4.87 0.00 3.61
1936 1969 3.525199 AGGACCAGGCAGAAAACATAGAT 59.475 43.478 0.00 0.00 0.00 1.98
1962 1995 3.634910 GGATGAGAGTGTAGAGGAGAACC 59.365 52.174 0.00 0.00 0.00 3.62
1968 2001 6.322456 TGAGTAATTGGATGAGAGTGTAGAGG 59.678 42.308 0.00 0.00 0.00 3.69
1978 2014 6.416631 TCTCTGGATGAGTAATTGGATGAG 57.583 41.667 0.00 0.00 43.13 2.90
2024 2060 3.996363 CCTTTGTATTTTCTTGGCAAGGC 59.004 43.478 25.92 10.60 0.00 4.35
2025 2061 5.213891 ACCTTTGTATTTTCTTGGCAAGG 57.786 39.130 25.92 9.50 0.00 3.61
2026 2062 5.856455 CGTACCTTTGTATTTTCTTGGCAAG 59.144 40.000 21.17 21.17 0.00 4.01
2034 2070 5.768333 ACGCTACGTACCTTTGTATTTTC 57.232 39.130 0.00 0.00 38.73 2.29
2067 2103 7.789341 TTAATTATTTCAACGTCACACATGC 57.211 32.000 0.00 0.00 0.00 4.06
2072 2108 9.484326 CGATGAATTAATTATTTCAACGTCACA 57.516 29.630 27.23 9.07 0.00 3.58
2073 2109 9.485591 ACGATGAATTAATTATTTCAACGTCAC 57.514 29.630 31.22 17.10 32.79 3.67
2126 2167 9.078990 TGCCTGCAGTGTAGGATATATATATAC 57.921 37.037 29.35 6.84 37.52 1.47
2144 2185 1.135489 CAGCATGTTAAGTGCCTGCAG 60.135 52.381 6.78 6.78 43.50 4.41
2149 2190 0.171903 CCAGCAGCATGTTAAGTGCC 59.828 55.000 8.69 0.00 43.50 5.01
2153 2194 0.729116 CGGTCCAGCAGCATGTTAAG 59.271 55.000 0.00 0.00 39.31 1.85
2154 2195 0.676466 CCGGTCCAGCAGCATGTTAA 60.676 55.000 0.00 0.00 39.31 2.01
2155 2196 1.078497 CCGGTCCAGCAGCATGTTA 60.078 57.895 0.00 0.00 39.31 2.41
2157 2198 4.415150 CCCGGTCCAGCAGCATGT 62.415 66.667 0.00 0.00 39.31 3.21
2161 2202 4.096003 TTAGCCCGGTCCAGCAGC 62.096 66.667 0.00 0.00 0.00 5.25
2186 2235 3.125316 GTCCGTTCCAGCATAAGTTGAAG 59.875 47.826 0.00 0.00 0.00 3.02
2194 2243 0.101759 GCGTAGTCCGTTCCAGCATA 59.898 55.000 0.00 0.00 39.32 3.14
2197 2246 1.516603 GAGCGTAGTCCGTTCCAGC 60.517 63.158 0.00 0.00 40.49 4.85
2225 2274 1.261619 GCGTTTTGCTGGATAGGATCG 59.738 52.381 0.00 0.00 41.73 3.69
2229 2278 1.062525 GCGCGTTTTGCTGGATAGG 59.937 57.895 8.43 0.00 43.27 2.57
2231 2280 2.745785 CCGCGCGTTTTGCTGGATA 61.746 57.895 29.95 0.00 43.27 2.59
2235 2284 0.095589 TATTACCGCGCGTTTTGCTG 59.904 50.000 29.95 13.89 43.27 4.41
2236 2285 1.011333 ATATTACCGCGCGTTTTGCT 58.989 45.000 29.95 10.39 43.27 3.91
2237 2286 1.817609 AATATTACCGCGCGTTTTGC 58.182 45.000 29.95 0.00 41.47 3.68
2243 2292 4.418392 AGTAAGGATAATATTACCGCGCG 58.582 43.478 25.67 25.67 33.29 6.86
2245 2294 7.878477 TGAAAGTAAGGATAATATTACCGCG 57.122 36.000 0.00 0.00 33.29 6.46
2256 2305 7.775053 ACTTTGGCAAATGAAAGTAAGGATA 57.225 32.000 13.89 0.00 39.96 2.59
2257 2306 6.670695 ACTTTGGCAAATGAAAGTAAGGAT 57.329 33.333 13.89 0.00 39.96 3.24
2258 2307 7.589958 TTACTTTGGCAAATGAAAGTAAGGA 57.410 32.000 13.89 0.00 44.19 3.36
2261 2310 9.474920 CTGATTTACTTTGGCAAATGAAAGTAA 57.525 29.630 13.89 14.18 45.94 2.24
2262 2311 8.855110 TCTGATTTACTTTGGCAAATGAAAGTA 58.145 29.630 13.89 8.78 41.53 2.24
2263 2312 7.725251 TCTGATTTACTTTGGCAAATGAAAGT 58.275 30.769 13.89 9.82 43.28 2.66
2264 2313 8.767478 ATCTGATTTACTTTGGCAAATGAAAG 57.233 30.769 13.89 3.58 35.64 2.62
2266 2315 9.023962 AGTATCTGATTTACTTTGGCAAATGAA 57.976 29.630 13.89 7.78 0.00 2.57
2272 2405 7.065803 GCAGTTAGTATCTGATTTACTTTGGCA 59.934 37.037 11.67 0.00 35.20 4.92
2287 2420 5.028375 GCCAAATTTCGTGCAGTTAGTATC 58.972 41.667 0.00 0.00 0.00 2.24
2300 2433 5.649557 TGGTGAATAGATTGCCAAATTTCG 58.350 37.500 0.00 0.00 0.00 3.46
2302 2435 5.721000 TCCTGGTGAATAGATTGCCAAATTT 59.279 36.000 0.00 0.00 0.00 1.82
2308 2441 3.118261 TGTCTCCTGGTGAATAGATTGCC 60.118 47.826 0.00 0.00 0.00 4.52
2309 2442 4.142609 TGTCTCCTGGTGAATAGATTGC 57.857 45.455 0.00 0.00 0.00 3.56
2314 2447 7.069331 AGAGTTATCTTGTCTCCTGGTGAATAG 59.931 40.741 0.00 1.67 28.57 1.73
2315 2448 6.897966 AGAGTTATCTTGTCTCCTGGTGAATA 59.102 38.462 0.00 0.00 28.57 1.75
2319 2452 4.382470 CCAGAGTTATCTTGTCTCCTGGTG 60.382 50.000 0.00 0.00 31.64 4.17
2321 2454 3.133721 CCCAGAGTTATCTTGTCTCCTGG 59.866 52.174 0.00 0.00 31.64 4.45
2329 2462 3.107601 TCCCTGTCCCAGAGTTATCTTG 58.892 50.000 0.00 0.00 31.64 3.02
2360 2493 1.146930 ATAGTGTGGGCCATCTGCG 59.853 57.895 10.70 0.00 42.61 5.18
2361 2494 0.820891 CCATAGTGTGGGCCATCTGC 60.821 60.000 10.70 0.00 44.79 4.26
2362 2495 3.409201 CCATAGTGTGGGCCATCTG 57.591 57.895 10.70 3.12 44.79 2.90
2494 2627 0.457166 CGTCCCAGATGCGTCGTTAA 60.457 55.000 0.00 0.00 0.00 2.01
2571 2704 3.476552 GTGACTGTTGAGGACCATGAAA 58.523 45.455 0.00 0.00 0.00 2.69
2585 2718 2.126463 CGATCCGCACGTGACTGT 60.126 61.111 22.23 1.13 0.00 3.55
2600 2736 4.980805 GGTGCTTGTGGACGGCGA 62.981 66.667 16.62 0.00 35.23 5.54
2695 2831 0.831307 ATTAAGCGGAGGGAGGTGTC 59.169 55.000 0.00 0.00 0.00 3.67
2739 2875 1.469703 ACGATGTGGATCACGACGTAA 59.530 47.619 15.78 0.00 42.62 3.18
2787 2923 3.842923 ATCACAGCCGGCTCCTCG 61.843 66.667 30.29 18.80 0.00 4.63
2798 2951 2.071540 TGCGCTTCTTCTTCATCACAG 58.928 47.619 9.73 0.00 0.00 3.66
2830 2983 0.250124 ACGACCAAGATGGCGAACAA 60.250 50.000 16.23 0.00 42.67 2.83
3057 3227 0.815734 ATACCGCGCACAAGTAGAGT 59.184 50.000 8.75 0.00 0.00 3.24
3111 3281 2.685017 ATGTGCCGAGAGCTCCCA 60.685 61.111 10.93 0.00 44.23 4.37
3135 3305 1.970917 GCGCGACCACAAAGATGGAG 61.971 60.000 12.10 0.00 43.02 3.86
3161 3331 1.408422 GATGAAAACAACCACTGCGC 58.592 50.000 0.00 0.00 0.00 6.09
3165 3335 2.878406 CAGGACGATGAAAACAACCACT 59.122 45.455 0.00 0.00 0.00 4.00
3174 3344 0.610174 AGAGCAGCAGGACGATGAAA 59.390 50.000 0.00 0.00 30.38 2.69
3193 3363 4.505039 GGGGAAGAGAAACTTGAGTGCTAA 60.505 45.833 0.00 0.00 39.13 3.09
3220 3390 4.172512 ATCAGGAGCAGCGGCAGG 62.173 66.667 12.44 0.00 44.61 4.85
3222 3392 4.166888 GGATCAGGAGCAGCGGCA 62.167 66.667 12.44 0.00 44.61 5.69
3224 3394 1.964608 TTCAGGATCAGGAGCAGCGG 61.965 60.000 0.00 0.00 0.00 5.52
3226 3396 0.814812 GCTTCAGGATCAGGAGCAGC 60.815 60.000 11.64 3.98 0.00 5.25
3230 3400 2.289882 TGTGTTGCTTCAGGATCAGGAG 60.290 50.000 0.00 0.00 0.00 3.69
3231 3401 1.699083 TGTGTTGCTTCAGGATCAGGA 59.301 47.619 0.00 0.00 0.00 3.86
3232 3402 2.082231 CTGTGTTGCTTCAGGATCAGG 58.918 52.381 0.00 0.00 0.00 3.86
3233 3403 1.467734 GCTGTGTTGCTTCAGGATCAG 59.532 52.381 0.00 0.00 32.94 2.90
3234 3404 1.527034 GCTGTGTTGCTTCAGGATCA 58.473 50.000 0.00 0.00 32.94 2.92
3235 3405 0.807496 GGCTGTGTTGCTTCAGGATC 59.193 55.000 0.00 0.00 32.94 3.36
3239 3409 1.285023 GCAGGCTGTGTTGCTTCAG 59.715 57.895 17.16 0.00 37.35 3.02
3242 3412 1.900498 GAGGCAGGCTGTGTTGCTT 60.900 57.895 17.16 0.00 40.15 3.91
3243 3413 2.282040 GAGGCAGGCTGTGTTGCT 60.282 61.111 17.16 0.00 40.15 3.91
3244 3414 3.368571 GGAGGCAGGCTGTGTTGC 61.369 66.667 17.16 1.14 39.56 4.17
3245 3415 3.052082 CGGAGGCAGGCTGTGTTG 61.052 66.667 17.16 0.00 0.00 3.33
3246 3416 3.120086 AACGGAGGCAGGCTGTGTT 62.120 57.895 17.16 10.29 0.00 3.32
3248 3418 3.052082 CAACGGAGGCAGGCTGTG 61.052 66.667 17.16 0.06 0.00 3.66
3250 3420 4.711949 AGCAACGGAGGCAGGCTG 62.712 66.667 10.94 10.94 32.76 4.85
3251 3421 4.400961 GAGCAACGGAGGCAGGCT 62.401 66.667 0.00 0.00 37.56 4.58
3253 3423 3.710722 AGGAGCAACGGAGGCAGG 61.711 66.667 0.00 0.00 0.00 4.85
3254 3424 2.435586 CAGGAGCAACGGAGGCAG 60.436 66.667 0.00 0.00 0.00 4.85
3266 3436 2.031333 GCTGTTGTTTCTTGCTCAGGAG 60.031 50.000 0.00 0.00 0.00 3.69
3267 3437 1.949525 GCTGTTGTTTCTTGCTCAGGA 59.050 47.619 0.00 0.00 0.00 3.86
3268 3438 1.334419 CGCTGTTGTTTCTTGCTCAGG 60.334 52.381 0.00 0.00 0.00 3.86
3269 3439 1.923316 GCGCTGTTGTTTCTTGCTCAG 60.923 52.381 0.00 0.00 0.00 3.35
3270 3440 0.029300 GCGCTGTTGTTTCTTGCTCA 59.971 50.000 0.00 0.00 0.00 4.26
3271 3441 0.661483 GGCGCTGTTGTTTCTTGCTC 60.661 55.000 7.64 0.00 0.00 4.26
3273 3443 0.936297 CAGGCGCTGTTGTTTCTTGC 60.936 55.000 7.64 0.00 0.00 4.01
3275 3445 1.360192 GCAGGCGCTGTTGTTTCTT 59.640 52.632 7.64 0.00 33.43 2.52
3278 3448 2.832661 TGGCAGGCGCTGTTGTTT 60.833 55.556 7.64 0.00 38.60 2.83
3291 3461 2.369633 ATCAGGATCAGCGGTGGCA 61.370 57.895 15.67 0.00 43.41 4.92
3295 3465 0.745845 GTTGCATCAGGATCAGCGGT 60.746 55.000 0.00 0.00 0.00 5.68
3297 3467 0.376152 GTGTTGCATCAGGATCAGCG 59.624 55.000 0.00 0.00 0.00 5.18
3300 3470 1.456296 GCTGTGTTGCATCAGGATCA 58.544 50.000 13.31 2.16 32.94 2.92
3301 3471 0.737219 GGCTGTGTTGCATCAGGATC 59.263 55.000 13.31 0.00 32.94 3.36
3302 3472 0.330604 AGGCTGTGTTGCATCAGGAT 59.669 50.000 13.31 0.00 32.94 3.24
3304 3474 1.880894 CAGGCTGTGTTGCATCAGG 59.119 57.895 6.28 5.22 32.94 3.86
3305 3475 1.211969 GCAGGCTGTGTTGCATCAG 59.788 57.895 17.16 3.90 40.02 2.90
3306 3476 2.270257 GGCAGGCTGTGTTGCATCA 61.270 57.895 17.16 0.00 42.02 3.07
3307 3477 2.270257 TGGCAGGCTGTGTTGCATC 61.270 57.895 17.16 0.00 42.02 3.91
3308 3478 2.203523 TGGCAGGCTGTGTTGCAT 60.204 55.556 17.16 0.00 42.02 3.96
3309 3479 3.218470 GTGGCAGGCTGTGTTGCA 61.218 61.111 17.16 0.00 42.02 4.08
3310 3480 3.982241 GGTGGCAGGCTGTGTTGC 61.982 66.667 17.16 1.14 39.56 4.17
3311 3481 3.663176 CGGTGGCAGGCTGTGTTG 61.663 66.667 17.16 0.00 0.00 3.33
3312 3482 3.714487 AACGGTGGCAGGCTGTGTT 62.714 57.895 17.16 10.29 0.00 3.32
3314 3484 3.663176 CAACGGTGGCAGGCTGTG 61.663 66.667 17.16 0.06 0.00 3.66
3320 3490 3.052082 CAGGAGCAACGGTGGCAG 61.052 66.667 10.66 0.00 0.00 4.85
3322 3492 2.743928 CTCAGGAGCAACGGTGGC 60.744 66.667 0.90 0.00 0.00 5.01
3332 3502 2.031333 GCTGTTGTTTCTTGCTCAGGAG 60.031 50.000 0.00 0.00 0.00 3.69
3333 3503 1.949525 GCTGTTGTTTCTTGCTCAGGA 59.050 47.619 0.00 0.00 0.00 3.86
3334 3504 1.334419 CGCTGTTGTTTCTTGCTCAGG 60.334 52.381 0.00 0.00 0.00 3.86
3336 3506 0.029300 GCGCTGTTGTTTCTTGCTCA 59.971 50.000 0.00 0.00 0.00 4.26
3337 3507 0.661483 GGCGCTGTTGTTTCTTGCTC 60.661 55.000 7.64 0.00 0.00 4.26
3338 3508 1.103398 AGGCGCTGTTGTTTCTTGCT 61.103 50.000 7.64 0.00 0.00 3.91
3341 3589 1.360192 GCAGGCGCTGTTGTTTCTT 59.640 52.632 7.64 0.00 33.43 2.52
3344 3592 3.605664 GGGCAGGCGCTGTTGTTT 61.606 61.111 7.64 0.00 38.60 2.83
3363 3611 2.356173 TTTCTTGCCCAGGAGCAGCA 62.356 55.000 0.00 0.00 45.13 4.41
3366 3614 0.106268 TTGTTTCTTGCCCAGGAGCA 60.106 50.000 0.00 0.00 42.17 4.26
3367 3615 1.260544 ATTGTTTCTTGCCCAGGAGC 58.739 50.000 0.00 0.00 0.00 4.70
3369 3617 2.432444 CGTATTGTTTCTTGCCCAGGA 58.568 47.619 0.00 0.00 0.00 3.86
3370 3618 1.472480 CCGTATTGTTTCTTGCCCAGG 59.528 52.381 0.00 0.00 0.00 4.45
3371 3619 1.135402 GCCGTATTGTTTCTTGCCCAG 60.135 52.381 0.00 0.00 0.00 4.45
3372 3620 0.885196 GCCGTATTGTTTCTTGCCCA 59.115 50.000 0.00 0.00 0.00 5.36
3373 3621 0.172578 GGCCGTATTGTTTCTTGCCC 59.827 55.000 0.00 0.00 0.00 5.36
3374 3622 1.135402 CAGGCCGTATTGTTTCTTGCC 60.135 52.381 0.00 0.00 37.68 4.52
3375 3623 1.732405 GCAGGCCGTATTGTTTCTTGC 60.732 52.381 0.00 0.00 0.00 4.01
3376 3624 1.135402 GGCAGGCCGTATTGTTTCTTG 60.135 52.381 0.00 0.00 0.00 3.02
3377 3625 1.173913 GGCAGGCCGTATTGTTTCTT 58.826 50.000 0.00 0.00 0.00 2.52
3379 3627 1.663379 GGGGCAGGCCGTATTGTTTC 61.663 60.000 6.98 0.00 36.85 2.78
3380 3628 1.680989 GGGGCAGGCCGTATTGTTT 60.681 57.895 6.98 0.00 36.85 2.83
3381 3629 2.044352 GGGGCAGGCCGTATTGTT 60.044 61.111 6.98 0.00 36.85 2.83
3398 3646 2.668212 TTTGTCCTTCAGCGGCGG 60.668 61.111 9.78 0.00 0.00 6.13
3399 3647 2.556287 GTTTGTCCTTCAGCGGCG 59.444 61.111 0.51 0.51 0.00 6.46
3400 3648 2.556287 CGTTTGTCCTTCAGCGGC 59.444 61.111 0.00 0.00 0.00 6.53
3401 3649 0.673644 ATCCGTTTGTCCTTCAGCGG 60.674 55.000 0.00 0.00 42.89 5.52
3402 3650 2.004583 TATCCGTTTGTCCTTCAGCG 57.995 50.000 0.00 0.00 0.00 5.18
3403 3651 3.335579 ACTTATCCGTTTGTCCTTCAGC 58.664 45.455 0.00 0.00 0.00 4.26
3404 3652 5.347907 GTGTACTTATCCGTTTGTCCTTCAG 59.652 44.000 0.00 0.00 0.00 3.02
3405 3653 5.232463 GTGTACTTATCCGTTTGTCCTTCA 58.768 41.667 0.00 0.00 0.00 3.02
3406 3654 4.628766 GGTGTACTTATCCGTTTGTCCTTC 59.371 45.833 0.00 0.00 0.00 3.46
3407 3655 4.040706 TGGTGTACTTATCCGTTTGTCCTT 59.959 41.667 0.00 0.00 0.00 3.36
3408 3656 3.579586 TGGTGTACTTATCCGTTTGTCCT 59.420 43.478 0.00 0.00 0.00 3.85
3409 3657 3.929094 TGGTGTACTTATCCGTTTGTCC 58.071 45.455 0.00 0.00 0.00 4.02
3412 3660 2.676342 GCCTGGTGTACTTATCCGTTTG 59.324 50.000 0.00 0.00 0.00 2.93
3417 3665 0.177141 TGCGCCTGGTGTACTTATCC 59.823 55.000 4.18 0.00 0.00 2.59
3419 3667 1.278127 ACTTGCGCCTGGTGTACTTAT 59.722 47.619 4.18 0.00 0.00 1.73
3422 3670 1.301716 CACTTGCGCCTGGTGTACT 60.302 57.895 4.18 0.00 0.00 2.73
3423 3671 2.966309 GCACTTGCGCCTGGTGTAC 61.966 63.158 19.95 6.43 33.96 2.90
3448 3696 1.077930 CCACCAGGATGCTCACCAG 60.078 63.158 0.00 0.00 36.89 4.00
3510 3758 4.451150 TCGATGCTGTCCGGCCAC 62.451 66.667 2.24 0.00 0.00 5.01
3552 3812 0.110644 GCTTGTTGCTGTCGTGTAGC 60.111 55.000 0.00 0.00 41.49 3.58
3645 3905 1.076906 ACCCAGTAGCTCGTCCAGT 59.923 57.895 0.00 0.00 0.00 4.00
3687 4010 3.315142 GATGGAGGACTGCGCCACA 62.315 63.158 4.18 0.00 33.93 4.17
3792 4115 1.514443 GTAGAGCAGCACGACGACC 60.514 63.158 0.00 0.00 0.00 4.79
3850 4173 0.035056 GCACTGGGGTTATGTGAGCT 60.035 55.000 0.00 0.00 33.95 4.09
3851 4174 0.035056 AGCACTGGGGTTATGTGAGC 60.035 55.000 0.00 0.00 33.95 4.26
3853 4176 1.003118 GTCAGCACTGGGGTTATGTGA 59.997 52.381 0.00 0.00 33.95 3.58
3855 4178 1.003580 CTGTCAGCACTGGGGTTATGT 59.996 52.381 0.00 0.00 0.00 2.29
3857 4180 0.620556 CCTGTCAGCACTGGGGTTAT 59.379 55.000 0.00 0.00 37.85 1.89
3866 4189 1.739067 GGTTATGGACCTGTCAGCAC 58.261 55.000 0.00 0.00 45.55 4.40
3876 4199 0.464452 CCCTCTCACGGGTTATGGAC 59.536 60.000 0.00 0.00 39.51 4.02
3877 4200 2.910579 CCCTCTCACGGGTTATGGA 58.089 57.895 0.00 0.00 39.51 3.41
3894 4217 1.542187 AAGCGTCAGTGGGGAGTACC 61.542 60.000 0.00 0.00 39.11 3.34
3895 4218 1.180029 TAAGCGTCAGTGGGGAGTAC 58.820 55.000 0.00 0.00 0.00 2.73
3896 4219 2.029623 GATAAGCGTCAGTGGGGAGTA 58.970 52.381 0.00 0.00 0.00 2.59
3897 4220 0.824759 GATAAGCGTCAGTGGGGAGT 59.175 55.000 0.00 0.00 0.00 3.85
3898 4221 0.824109 TGATAAGCGTCAGTGGGGAG 59.176 55.000 0.00 0.00 0.00 4.30
3899 4222 0.824109 CTGATAAGCGTCAGTGGGGA 59.176 55.000 8.17 0.00 40.54 4.81
3900 4223 0.179073 CCTGATAAGCGTCAGTGGGG 60.179 60.000 13.32 0.00 43.22 4.96
3901 4224 0.824109 TCCTGATAAGCGTCAGTGGG 59.176 55.000 13.32 2.95 43.22 4.61
3902 4225 2.271800 GTTCCTGATAAGCGTCAGTGG 58.728 52.381 13.32 3.50 43.22 4.00
3903 4226 2.271800 GGTTCCTGATAAGCGTCAGTG 58.728 52.381 13.32 7.21 43.22 3.66
3909 4232 3.185246 ACTGATGGTTCCTGATAAGCG 57.815 47.619 0.00 0.00 0.00 4.68
3911 4234 5.011533 CCTCCTACTGATGGTTCCTGATAAG 59.988 48.000 0.00 0.00 0.00 1.73
3914 4237 3.312890 CCTCCTACTGATGGTTCCTGAT 58.687 50.000 0.00 0.00 0.00 2.90
3924 4247 1.043816 CCGACATGCCTCCTACTGAT 58.956 55.000 0.00 0.00 0.00 2.90
3926 4249 0.179100 CACCGACATGCCTCCTACTG 60.179 60.000 0.00 0.00 0.00 2.74
3932 4255 1.448540 CTCACCACCGACATGCCTC 60.449 63.158 0.00 0.00 0.00 4.70
3933 4256 2.217038 ACTCACCACCGACATGCCT 61.217 57.895 0.00 0.00 0.00 4.75
3935 4258 2.034879 CCACTCACCACCGACATGC 61.035 63.158 0.00 0.00 0.00 4.06
3936 4259 0.950555 CACCACTCACCACCGACATG 60.951 60.000 0.00 0.00 0.00 3.21
3937 4260 1.118965 TCACCACTCACCACCGACAT 61.119 55.000 0.00 0.00 0.00 3.06
3938 4261 1.758906 TCACCACTCACCACCGACA 60.759 57.895 0.00 0.00 0.00 4.35
3939 4262 1.300697 GTCACCACTCACCACCGAC 60.301 63.158 0.00 0.00 0.00 4.79
3940 4263 0.178984 TAGTCACCACTCACCACCGA 60.179 55.000 0.00 0.00 33.62 4.69
3942 4265 2.922740 TTTAGTCACCACTCACCACC 57.077 50.000 0.00 0.00 33.62 4.61
3943 4266 4.002906 TGATTTAGTCACCACTCACCAC 57.997 45.455 0.00 0.00 33.62 4.16
3967 4316 1.137086 CCACCCGTGATTGGAGACTAG 59.863 57.143 0.00 0.00 34.46 2.57
3973 4322 0.830648 GATCTCCACCCGTGATTGGA 59.169 55.000 0.00 0.00 39.72 3.53
3977 4326 2.588620 GTAGAGATCTCCACCCGTGAT 58.411 52.381 19.30 0.00 0.00 3.06
3979 4328 1.033574 GGTAGAGATCTCCACCCGTG 58.966 60.000 25.12 0.00 35.71 4.94
3981 4330 1.173444 CCGGTAGAGATCTCCACCCG 61.173 65.000 28.03 27.19 37.99 5.28
3994 4343 4.624015 TCAAACTCAACACTAACCGGTAG 58.376 43.478 8.00 8.57 35.75 3.18
4034 4385 1.683011 GCATGGCTGTAATGGTGGTCT 60.683 52.381 0.00 0.00 0.00 3.85
4070 4421 7.998964 ACTCCTGAATTATTGGAACCGAATTAT 59.001 33.333 0.00 0.00 0.00 1.28
4074 4425 5.174037 ACTCCTGAATTATTGGAACCGAA 57.826 39.130 0.00 0.00 0.00 4.30
4076 4427 7.568199 AATAACTCCTGAATTATTGGAACCG 57.432 36.000 0.00 0.00 31.34 4.44
4091 4442 9.367444 CAAGTACGAAATTCAGTAATAACTCCT 57.633 33.333 0.00 0.00 31.97 3.69
4097 4448 7.707893 GGCTACCAAGTACGAAATTCAGTAATA 59.292 37.037 0.00 0.00 0.00 0.98
4098 4449 6.537660 GGCTACCAAGTACGAAATTCAGTAAT 59.462 38.462 0.00 0.00 0.00 1.89
4103 4454 4.546829 AGGCTACCAAGTACGAAATTCA 57.453 40.909 0.00 0.00 0.00 2.57
4110 4461 5.924825 GGTATATGAAAGGCTACCAAGTACG 59.075 44.000 0.00 0.00 34.91 3.67
4121 4473 2.553247 GCCCTGAGGGTATATGAAAGGC 60.553 54.545 20.64 0.00 46.51 4.35
4123 4475 3.744660 GTGCCCTGAGGGTATATGAAAG 58.255 50.000 20.64 0.00 46.51 2.62
4124 4476 2.104111 CGTGCCCTGAGGGTATATGAAA 59.896 50.000 20.64 0.00 46.51 2.69
4126 4478 1.338107 CGTGCCCTGAGGGTATATGA 58.662 55.000 20.64 0.00 46.51 2.15
4136 4488 1.754621 TTTTTGTGCCGTGCCCTGA 60.755 52.632 0.00 0.00 0.00 3.86
4219 4574 6.100004 TCATACAGACTTAGGAAGCTTTTCG 58.900 40.000 0.00 0.00 0.00 3.46
4226 4581 4.363999 CGCCTTCATACAGACTTAGGAAG 58.636 47.826 0.00 9.92 38.85 3.46
4229 4584 2.803492 GCCGCCTTCATACAGACTTAGG 60.803 54.545 0.00 0.00 0.00 2.69
4248 4603 5.643379 TTTCAACATAGACTTCATTGGCC 57.357 39.130 0.00 0.00 0.00 5.36
4277 4643 2.230508 CCGGCAAGAATATACGCTAGGA 59.769 50.000 0.00 0.00 0.00 2.94
4282 4648 1.000506 TCTCCCGGCAAGAATATACGC 59.999 52.381 0.00 0.00 0.00 4.42
4283 4649 3.005472 TCTTCTCCCGGCAAGAATATACG 59.995 47.826 15.45 6.40 32.56 3.06
4288 4654 1.839994 TGATCTTCTCCCGGCAAGAAT 59.160 47.619 15.45 4.76 32.40 2.40
4295 4661 8.798859 AAATGATTTATATGATCTTCTCCCGG 57.201 34.615 0.00 0.00 0.00 5.73
4320 4686 6.199531 GCGGAGATAATATTTGTCACGTGTTA 59.800 38.462 16.51 5.23 0.00 2.41
4334 4700 8.946085 GGTTCATAAATTGATGCGGAGATAATA 58.054 33.333 0.00 0.00 33.34 0.98
4337 4703 6.533730 AGGTTCATAAATTGATGCGGAGATA 58.466 36.000 0.00 0.00 33.34 1.98
4343 4709 7.425577 TCATCTAGGTTCATAAATTGATGCG 57.574 36.000 0.00 0.00 33.34 4.73
4391 4761 8.425703 TGACATAGTTCCAAATAATACATCCGA 58.574 33.333 0.00 0.00 0.00 4.55
4392 4762 8.601845 TGACATAGTTCCAAATAATACATCCG 57.398 34.615 0.00 0.00 0.00 4.18
4441 4811 3.936372 TGGAAAACAACAAAACCACGA 57.064 38.095 0.00 0.00 0.00 4.35
4442 4812 3.929610 ACATGGAAAACAACAAAACCACG 59.070 39.130 0.00 0.00 0.00 4.94
4451 4821 9.271738 CACAACATTTTTAACATGGAAAACAAC 57.728 29.630 7.15 0.00 0.00 3.32
4452 4822 9.003658 ACACAACATTTTTAACATGGAAAACAA 57.996 25.926 7.15 0.00 0.00 2.83
4453 4823 8.553459 ACACAACATTTTTAACATGGAAAACA 57.447 26.923 7.15 0.00 0.00 2.83
4454 4824 9.909043 GTACACAACATTTTTAACATGGAAAAC 57.091 29.630 7.15 0.00 0.00 2.43
4455 4825 9.877178 AGTACACAACATTTTTAACATGGAAAA 57.123 25.926 0.00 0.46 0.00 2.29
4456 4826 9.877178 AAGTACACAACATTTTTAACATGGAAA 57.123 25.926 0.00 0.00 0.00 3.13
4457 4827 9.307121 CAAGTACACAACATTTTTAACATGGAA 57.693 29.630 0.00 0.00 0.00 3.53
4458 4828 8.470805 ACAAGTACACAACATTTTTAACATGGA 58.529 29.630 0.00 0.00 0.00 3.41
4473 4843 3.185594 GCAACATCGCTACAAGTACACAA 59.814 43.478 0.00 0.00 0.00 3.33
4497 4867 4.861196 TCAGTACCTCTCTAATCTGCAGT 58.139 43.478 14.67 0.00 0.00 4.40
4504 4874 7.785028 TGTATTGGTCATCAGTACCTCTCTAAT 59.215 37.037 0.00 0.00 37.65 1.73
4511 4881 7.069986 AGATAGTGTATTGGTCATCAGTACCT 58.930 38.462 0.00 0.00 37.65 3.08
4515 4885 7.472100 GCCTAAGATAGTGTATTGGTCATCAGT 60.472 40.741 0.00 0.00 0.00 3.41
4518 4888 6.998802 AGCCTAAGATAGTGTATTGGTCATC 58.001 40.000 0.00 0.00 0.00 2.92
4528 4898 5.876357 TCAAAACCAAGCCTAAGATAGTGT 58.124 37.500 0.00 0.00 0.00 3.55
4541 4911 5.299279 TGGAGAAAAGTAGCTCAAAACCAAG 59.701 40.000 0.00 0.00 32.83 3.61
4542 4912 5.197451 TGGAGAAAAGTAGCTCAAAACCAA 58.803 37.500 0.00 0.00 32.83 3.67
4555 4925 7.056006 TGCATCACACATATATGGAGAAAAGT 58.944 34.615 16.96 1.63 0.00 2.66
4583 4953 9.393249 GATCATTGTTCGTTATGAAAGAAAACA 57.607 29.630 0.00 0.00 38.60 2.83
4584 4954 9.612620 AGATCATTGTTCGTTATGAAAGAAAAC 57.387 29.630 0.00 0.00 38.60 2.43
4589 4959 9.270576 CTCAAAGATCATTGTTCGTTATGAAAG 57.729 33.333 10.27 0.00 38.60 2.62
4592 4962 7.905604 ACTCAAAGATCATTGTTCGTTATGA 57.094 32.000 10.27 0.00 35.43 2.15
4593 4963 9.694520 CTAACTCAAAGATCATTGTTCGTTATG 57.305 33.333 10.27 7.45 0.00 1.90
4594 4964 9.436957 ACTAACTCAAAGATCATTGTTCGTTAT 57.563 29.630 10.27 5.58 0.00 1.89
4595 4965 8.827177 ACTAACTCAAAGATCATTGTTCGTTA 57.173 30.769 10.27 13.38 0.00 3.18
4596 4966 7.730364 ACTAACTCAAAGATCATTGTTCGTT 57.270 32.000 10.27 13.04 0.00 3.85
4597 4967 8.304596 TCTACTAACTCAAAGATCATTGTTCGT 58.695 33.333 10.27 4.16 0.00 3.85
4598 4968 8.587950 GTCTACTAACTCAAAGATCATTGTTCG 58.412 37.037 10.27 3.88 0.00 3.95
4599 4969 9.424319 TGTCTACTAACTCAAAGATCATTGTTC 57.576 33.333 10.27 0.00 0.00 3.18
4600 4970 9.778741 TTGTCTACTAACTCAAAGATCATTGTT 57.221 29.630 10.27 1.86 0.00 2.83
4601 4971 9.429359 CTTGTCTACTAACTCAAAGATCATTGT 57.571 33.333 10.27 0.00 0.00 2.71
4602 4972 9.429359 ACTTGTCTACTAACTCAAAGATCATTG 57.571 33.333 4.27 4.27 0.00 2.82
4603 4973 9.429359 CACTTGTCTACTAACTCAAAGATCATT 57.571 33.333 0.00 0.00 0.00 2.57
4604 4974 8.037758 CCACTTGTCTACTAACTCAAAGATCAT 58.962 37.037 0.00 0.00 0.00 2.45
4605 4975 7.378966 CCACTTGTCTACTAACTCAAAGATCA 58.621 38.462 0.00 0.00 0.00 2.92
4606 4976 6.311690 GCCACTTGTCTACTAACTCAAAGATC 59.688 42.308 0.00 0.00 0.00 2.75
4607 4977 6.166982 GCCACTTGTCTACTAACTCAAAGAT 58.833 40.000 0.00 0.00 0.00 2.40
4608 4978 5.539048 GCCACTTGTCTACTAACTCAAAGA 58.461 41.667 0.00 0.00 0.00 2.52
4609 4979 4.386049 CGCCACTTGTCTACTAACTCAAAG 59.614 45.833 0.00 0.00 0.00 2.77
4610 4980 4.304110 CGCCACTTGTCTACTAACTCAAA 58.696 43.478 0.00 0.00 0.00 2.69
4611 4981 3.859627 GCGCCACTTGTCTACTAACTCAA 60.860 47.826 0.00 0.00 0.00 3.02
4612 4982 2.352421 GCGCCACTTGTCTACTAACTCA 60.352 50.000 0.00 0.00 0.00 3.41
4613 4983 2.094649 AGCGCCACTTGTCTACTAACTC 60.095 50.000 2.29 0.00 0.00 3.01
4614 4984 1.893801 AGCGCCACTTGTCTACTAACT 59.106 47.619 2.29 0.00 0.00 2.24
4615 4985 1.993370 CAGCGCCACTTGTCTACTAAC 59.007 52.381 2.29 0.00 0.00 2.34
4616 4986 1.890489 TCAGCGCCACTTGTCTACTAA 59.110 47.619 2.29 0.00 0.00 2.24
4617 4987 1.541379 TCAGCGCCACTTGTCTACTA 58.459 50.000 2.29 0.00 0.00 1.82
4618 4988 0.679505 TTCAGCGCCACTTGTCTACT 59.320 50.000 2.29 0.00 0.00 2.57
4619 4989 1.726853 ATTCAGCGCCACTTGTCTAC 58.273 50.000 2.29 0.00 0.00 2.59
4620 4990 2.472695 AATTCAGCGCCACTTGTCTA 57.527 45.000 2.29 0.00 0.00 2.59
4621 4991 2.472695 TAATTCAGCGCCACTTGTCT 57.527 45.000 2.29 0.00 0.00 3.41
4622 4992 3.764885 ATTAATTCAGCGCCACTTGTC 57.235 42.857 2.29 0.00 0.00 3.18
4623 4993 3.758554 AGAATTAATTCAGCGCCACTTGT 59.241 39.130 26.02 2.29 39.23 3.16
4624 4994 4.095483 AGAGAATTAATTCAGCGCCACTTG 59.905 41.667 26.02 0.00 39.23 3.16
4625 4995 4.095483 CAGAGAATTAATTCAGCGCCACTT 59.905 41.667 26.02 5.85 39.23 3.16
4626 4996 3.624861 CAGAGAATTAATTCAGCGCCACT 59.375 43.478 26.02 12.22 39.23 4.00
4627 4997 3.375299 ACAGAGAATTAATTCAGCGCCAC 59.625 43.478 26.02 10.61 39.23 5.01
4628 4998 3.609853 ACAGAGAATTAATTCAGCGCCA 58.390 40.909 26.02 0.00 39.23 5.69
4629 4999 4.496507 GGAACAGAGAATTAATTCAGCGCC 60.497 45.833 26.02 16.19 39.23 6.53
4630 5000 4.094887 TGGAACAGAGAATTAATTCAGCGC 59.905 41.667 26.02 14.04 39.23 5.92
4631 5001 5.801350 TGGAACAGAGAATTAATTCAGCG 57.199 39.130 26.02 16.61 39.23 5.18
4650 5020 9.993454 CTGATAGTGATCTAAAATCTCAATGGA 57.007 33.333 0.00 0.00 32.79 3.41
4651 5021 9.775854 ACTGATAGTGATCTAAAATCTCAATGG 57.224 33.333 0.00 0.00 32.79 3.16
4657 5027 9.950496 ACACAAACTGATAGTGATCTAAAATCT 57.050 29.630 0.00 0.00 37.05 2.40
4663 5033 9.337396 ACAAAAACACAAACTGATAGTGATCTA 57.663 29.630 0.00 0.00 37.05 1.98
4664 5034 8.131100 CACAAAAACACAAACTGATAGTGATCT 58.869 33.333 0.00 0.00 37.05 2.75
4665 5035 7.915397 ACACAAAAACACAAACTGATAGTGATC 59.085 33.333 0.00 0.00 37.05 2.92
4666 5036 7.771183 ACACAAAAACACAAACTGATAGTGAT 58.229 30.769 0.00 0.00 37.05 3.06
4667 5037 7.151999 ACACAAAAACACAAACTGATAGTGA 57.848 32.000 0.00 0.00 37.05 3.41
4668 5038 7.810766 AACACAAAAACACAAACTGATAGTG 57.189 32.000 0.00 0.00 39.12 2.74
4672 5042 8.878769 GGAATTAACACAAAAACACAAACTGAT 58.121 29.630 0.00 0.00 0.00 2.90
4673 5043 8.091449 AGGAATTAACACAAAAACACAAACTGA 58.909 29.630 0.00 0.00 0.00 3.41
4674 5044 8.250538 AGGAATTAACACAAAAACACAAACTG 57.749 30.769 0.00 0.00 0.00 3.16
4675 5045 8.840833 AAGGAATTAACACAAAAACACAAACT 57.159 26.923 0.00 0.00 0.00 2.66
4678 5048 9.706691 TGTTAAGGAATTAACACAAAAACACAA 57.293 25.926 8.99 0.00 41.06 3.33
4679 5049 9.877178 ATGTTAAGGAATTAACACAAAAACACA 57.123 25.926 13.98 0.00 46.35 3.72
4683 5053 9.331282 CCCAATGTTAAGGAATTAACACAAAAA 57.669 29.630 13.98 0.00 46.35 1.94
4684 5054 7.442666 GCCCAATGTTAAGGAATTAACACAAAA 59.557 33.333 13.98 0.00 46.35 2.44
4685 5055 6.931840 GCCCAATGTTAAGGAATTAACACAAA 59.068 34.615 13.98 0.00 46.35 2.83
4686 5056 6.268847 AGCCCAATGTTAAGGAATTAACACAA 59.731 34.615 13.98 0.00 46.35 3.33
4687 5057 5.777732 AGCCCAATGTTAAGGAATTAACACA 59.222 36.000 13.98 0.00 46.35 3.72
4688 5058 6.280855 AGCCCAATGTTAAGGAATTAACAC 57.719 37.500 13.98 3.87 46.35 3.32
4700 5070 9.969001 GGGTATCTTTATAATAGCCCAATGTTA 57.031 33.333 2.60 0.00 40.03 2.41
4701 5071 8.678798 AGGGTATCTTTATAATAGCCCAATGTT 58.321 33.333 8.53 0.00 44.67 2.71
4702 5072 8.232098 AGGGTATCTTTATAATAGCCCAATGT 57.768 34.615 8.53 0.00 44.67 2.71
4705 5075 8.316214 CGTAAGGGTATCTTTATAATAGCCCAA 58.684 37.037 8.53 0.00 44.67 4.12
4706 5076 7.580109 GCGTAAGGGTATCTTTATAATAGCCCA 60.580 40.741 8.53 0.00 44.67 5.36
4707 5077 6.760298 GCGTAAGGGTATCTTTATAATAGCCC 59.240 42.308 8.53 6.24 44.67 5.19
4708 5078 6.760298 GGCGTAAGGGTATCTTTATAATAGCC 59.240 42.308 5.13 5.13 44.17 3.93
4709 5079 7.554211 AGGCGTAAGGGTATCTTTATAATAGC 58.446 38.462 0.00 0.00 36.93 2.97
4712 5082 7.985752 GCATAGGCGTAAGGGTATCTTTATAAT 59.014 37.037 0.00 0.00 36.93 1.28
4713 5083 7.038870 TGCATAGGCGTAAGGGTATCTTTATAA 60.039 37.037 0.00 0.00 45.35 0.98
4714 5084 6.438108 TGCATAGGCGTAAGGGTATCTTTATA 59.562 38.462 0.00 0.00 45.35 0.98
4715 5085 5.247564 TGCATAGGCGTAAGGGTATCTTTAT 59.752 40.000 0.00 0.00 45.35 1.40
4716 5086 4.589798 TGCATAGGCGTAAGGGTATCTTTA 59.410 41.667 0.00 0.00 45.35 1.85
4717 5087 3.389983 TGCATAGGCGTAAGGGTATCTTT 59.610 43.478 0.00 0.00 45.35 2.52
4718 5088 2.969950 TGCATAGGCGTAAGGGTATCTT 59.030 45.455 0.00 0.00 45.35 2.40
4719 5089 2.299297 GTGCATAGGCGTAAGGGTATCT 59.701 50.000 0.00 0.00 45.35 1.98
4720 5090 2.036733 TGTGCATAGGCGTAAGGGTATC 59.963 50.000 0.00 0.00 45.35 2.24
4721 5091 2.043992 TGTGCATAGGCGTAAGGGTAT 58.956 47.619 0.00 0.00 45.35 2.73
4722 5092 1.487300 TGTGCATAGGCGTAAGGGTA 58.513 50.000 0.00 0.00 45.35 3.69
4723 5093 0.837272 ATGTGCATAGGCGTAAGGGT 59.163 50.000 0.00 0.00 45.35 4.34
4724 5094 1.229428 CATGTGCATAGGCGTAAGGG 58.771 55.000 0.00 0.00 45.35 3.95
4725 5095 1.953559 ACATGTGCATAGGCGTAAGG 58.046 50.000 0.00 0.00 45.35 2.69
4726 5096 5.007626 ACAAATACATGTGCATAGGCGTAAG 59.992 40.000 9.11 0.00 45.35 2.34
4727 5097 4.878971 ACAAATACATGTGCATAGGCGTAA 59.121 37.500 9.11 0.00 45.35 3.18
4728 5098 4.447290 ACAAATACATGTGCATAGGCGTA 58.553 39.130 9.11 0.00 45.35 4.42
4729 5099 3.278574 ACAAATACATGTGCATAGGCGT 58.721 40.909 9.11 0.00 45.35 5.68
4730 5100 3.969117 ACAAATACATGTGCATAGGCG 57.031 42.857 9.11 0.00 45.35 5.52
4731 5101 6.642131 CCAATAACAAATACATGTGCATAGGC 59.358 38.462 9.11 0.00 41.68 3.93
4732 5102 7.648908 CACCAATAACAAATACATGTGCATAGG 59.351 37.037 9.11 0.00 32.81 2.57
4733 5103 8.190122 ACACCAATAACAAATACATGTGCATAG 58.810 33.333 9.11 0.00 32.81 2.23
4734 5104 8.060931 ACACCAATAACAAATACATGTGCATA 57.939 30.769 9.11 0.00 32.81 3.14
4735 5105 6.934056 ACACCAATAACAAATACATGTGCAT 58.066 32.000 9.11 0.00 32.81 3.96
4736 5106 6.338214 ACACCAATAACAAATACATGTGCA 57.662 33.333 9.11 0.00 32.81 4.57
4737 5107 8.925161 ATAACACCAATAACAAATACATGTGC 57.075 30.769 9.11 0.00 32.81 4.57
4786 5156 9.529823 TCTCTACAGAGGTTGTTTCTATAAGAA 57.470 33.333 6.41 0.00 42.30 2.52
4787 5157 9.702253 ATCTCTACAGAGGTTGTTTCTATAAGA 57.298 33.333 6.41 0.00 42.30 2.10
4791 5161 9.349713 CTCTATCTCTACAGAGGTTGTTTCTAT 57.650 37.037 6.41 0.00 42.30 1.98
4792 5162 7.283580 GCTCTATCTCTACAGAGGTTGTTTCTA 59.716 40.741 6.41 0.00 42.30 2.10
4793 5163 6.096282 GCTCTATCTCTACAGAGGTTGTTTCT 59.904 42.308 6.41 0.00 42.30 2.52
4794 5164 6.127591 TGCTCTATCTCTACAGAGGTTGTTTC 60.128 42.308 6.41 0.00 42.30 2.78
4795 5165 5.717178 TGCTCTATCTCTACAGAGGTTGTTT 59.283 40.000 6.41 0.00 42.30 2.83
4796 5166 5.126384 GTGCTCTATCTCTACAGAGGTTGTT 59.874 44.000 6.41 0.00 42.30 2.83
4797 5167 4.642885 GTGCTCTATCTCTACAGAGGTTGT 59.357 45.833 6.41 0.00 42.30 3.32
4798 5168 4.260990 CGTGCTCTATCTCTACAGAGGTTG 60.261 50.000 6.41 0.80 42.30 3.77
4799 5169 3.880490 CGTGCTCTATCTCTACAGAGGTT 59.120 47.826 6.41 0.00 42.30 3.50
4800 5170 3.472652 CGTGCTCTATCTCTACAGAGGT 58.527 50.000 6.41 1.75 42.30 3.85
4801 5171 2.811431 CCGTGCTCTATCTCTACAGAGG 59.189 54.545 6.41 0.00 42.30 3.69
4802 5172 3.734463 TCCGTGCTCTATCTCTACAGAG 58.266 50.000 0.00 0.00 43.36 3.35
4803 5173 3.840124 TCCGTGCTCTATCTCTACAGA 57.160 47.619 0.00 0.00 0.00 3.41
4804 5174 4.902443 TTTCCGTGCTCTATCTCTACAG 57.098 45.455 0.00 0.00 0.00 2.74
4805 5175 5.854010 ATTTTCCGTGCTCTATCTCTACA 57.146 39.130 0.00 0.00 0.00 2.74
4806 5176 7.868415 ACATAATTTTCCGTGCTCTATCTCTAC 59.132 37.037 0.00 0.00 0.00 2.59
4807 5177 7.952671 ACATAATTTTCCGTGCTCTATCTCTA 58.047 34.615 0.00 0.00 0.00 2.43
4808 5178 6.821388 ACATAATTTTCCGTGCTCTATCTCT 58.179 36.000 0.00 0.00 0.00 3.10
4809 5179 8.651588 CATACATAATTTTCCGTGCTCTATCTC 58.348 37.037 0.00 0.00 0.00 2.75
4810 5180 8.150945 ACATACATAATTTTCCGTGCTCTATCT 58.849 33.333 0.00 0.00 0.00 1.98
4811 5181 8.311650 ACATACATAATTTTCCGTGCTCTATC 57.688 34.615 0.00 0.00 0.00 2.08
4812 5182 8.677148 AACATACATAATTTTCCGTGCTCTAT 57.323 30.769 0.00 0.00 0.00 1.98
4813 5183 8.394877 CAAACATACATAATTTTCCGTGCTCTA 58.605 33.333 0.00 0.00 0.00 2.43
4814 5184 7.250569 CAAACATACATAATTTTCCGTGCTCT 58.749 34.615 0.00 0.00 0.00 4.09
4815 5185 6.472163 CCAAACATACATAATTTTCCGTGCTC 59.528 38.462 0.00 0.00 0.00 4.26
4816 5186 6.329496 CCAAACATACATAATTTTCCGTGCT 58.671 36.000 0.00 0.00 0.00 4.40
4817 5187 5.518487 CCCAAACATACATAATTTTCCGTGC 59.482 40.000 0.00 0.00 0.00 5.34
4818 5188 6.039616 CCCCAAACATACATAATTTTCCGTG 58.960 40.000 0.00 0.00 0.00 4.94
4819 5189 5.128008 CCCCCAAACATACATAATTTTCCGT 59.872 40.000 0.00 0.00 0.00 4.69
4820 5190 5.596845 CCCCCAAACATACATAATTTTCCG 58.403 41.667 0.00 0.00 0.00 4.30
4821 5191 5.104735 TGCCCCCAAACATACATAATTTTCC 60.105 40.000 0.00 0.00 0.00 3.13
4822 5192 5.983540 TGCCCCCAAACATACATAATTTTC 58.016 37.500 0.00 0.00 0.00 2.29
4823 5193 6.409120 GGATGCCCCCAAACATACATAATTTT 60.409 38.462 0.00 0.00 0.00 1.82
4824 5194 5.071653 GGATGCCCCCAAACATACATAATTT 59.928 40.000 0.00 0.00 0.00 1.82
4825 5195 4.592778 GGATGCCCCCAAACATACATAATT 59.407 41.667 0.00 0.00 0.00 1.40
4826 5196 4.140710 AGGATGCCCCCAAACATACATAAT 60.141 41.667 0.00 0.00 34.66 1.28
4827 5197 3.206412 AGGATGCCCCCAAACATACATAA 59.794 43.478 0.00 0.00 34.66 1.90
4828 5198 2.788807 AGGATGCCCCCAAACATACATA 59.211 45.455 0.00 0.00 34.66 2.29
4829 5199 1.575304 AGGATGCCCCCAAACATACAT 59.425 47.619 0.00 0.00 34.66 2.29
4830 5200 1.006813 AGGATGCCCCCAAACATACA 58.993 50.000 0.00 0.00 34.66 2.29
4831 5201 2.956333 GTTAGGATGCCCCCAAACATAC 59.044 50.000 0.00 0.00 33.65 2.39
4832 5202 2.583101 TGTTAGGATGCCCCCAAACATA 59.417 45.455 6.65 0.00 36.77 2.29
4833 5203 1.360852 TGTTAGGATGCCCCCAAACAT 59.639 47.619 6.65 0.00 36.77 2.71
4834 5204 0.780637 TGTTAGGATGCCCCCAAACA 59.219 50.000 6.65 6.65 38.35 2.83
4835 5205 1.931635 TTGTTAGGATGCCCCCAAAC 58.068 50.000 0.00 0.00 33.91 2.93
4836 5206 2.745968 GATTGTTAGGATGCCCCCAAA 58.254 47.619 0.00 0.00 34.66 3.28
4837 5207 1.409521 CGATTGTTAGGATGCCCCCAA 60.410 52.381 0.00 0.00 34.66 4.12
4838 5208 0.182537 CGATTGTTAGGATGCCCCCA 59.817 55.000 0.00 0.00 34.66 4.96
4839 5209 0.537371 CCGATTGTTAGGATGCCCCC 60.537 60.000 0.00 0.00 34.66 5.40
4840 5210 0.537371 CCCGATTGTTAGGATGCCCC 60.537 60.000 0.00 0.00 0.00 5.80
4841 5211 0.537371 CCCCGATTGTTAGGATGCCC 60.537 60.000 0.00 0.00 0.00 5.36
4842 5212 0.182775 ACCCCGATTGTTAGGATGCC 59.817 55.000 0.00 0.00 0.00 4.40
4843 5213 1.308998 CACCCCGATTGTTAGGATGC 58.691 55.000 0.00 0.00 0.00 3.91
4844 5214 1.134098 AGCACCCCGATTGTTAGGATG 60.134 52.381 0.00 0.00 0.00 3.51
4845 5215 1.134098 CAGCACCCCGATTGTTAGGAT 60.134 52.381 0.00 0.00 0.00 3.24
4846 5216 0.251916 CAGCACCCCGATTGTTAGGA 59.748 55.000 0.00 0.00 0.00 2.94
4847 5217 1.376609 GCAGCACCCCGATTGTTAGG 61.377 60.000 0.00 0.00 0.00 2.69
4848 5218 1.705337 CGCAGCACCCCGATTGTTAG 61.705 60.000 0.00 0.00 0.00 2.34
4849 5219 1.743623 CGCAGCACCCCGATTGTTA 60.744 57.895 0.00 0.00 0.00 2.41
4850 5220 3.055719 CGCAGCACCCCGATTGTT 61.056 61.111 0.00 0.00 0.00 2.83
4851 5221 2.457743 TAACGCAGCACCCCGATTGT 62.458 55.000 0.00 0.00 0.00 2.71
4852 5222 1.743623 TAACGCAGCACCCCGATTG 60.744 57.895 0.00 0.00 0.00 2.67
4853 5223 1.743995 GTAACGCAGCACCCCGATT 60.744 57.895 0.00 0.00 0.00 3.34
4854 5224 2.125269 GTAACGCAGCACCCCGAT 60.125 61.111 0.00 0.00 0.00 4.18
4855 5225 3.617735 TGTAACGCAGCACCCCGA 61.618 61.111 0.00 0.00 0.00 5.14
4856 5226 2.495366 TAGTGTAACGCAGCACCCCG 62.495 60.000 0.00 0.00 45.86 5.73
4857 5227 0.739813 CTAGTGTAACGCAGCACCCC 60.740 60.000 0.00 0.00 45.86 4.95
4858 5228 0.037605 ACTAGTGTAACGCAGCACCC 60.038 55.000 0.00 0.00 45.86 4.61
4859 5229 1.068474 CACTAGTGTAACGCAGCACC 58.932 55.000 15.06 0.00 45.86 5.01
4860 5230 1.986378 CTCACTAGTGTAACGCAGCAC 59.014 52.381 21.99 0.00 45.86 4.40
4861 5231 1.883926 TCTCACTAGTGTAACGCAGCA 59.116 47.619 21.99 0.00 45.86 4.41
4862 5232 2.161808 TCTCTCACTAGTGTAACGCAGC 59.838 50.000 21.99 0.00 45.86 5.25
4863 5233 4.624336 ATCTCTCACTAGTGTAACGCAG 57.376 45.455 21.99 11.22 45.86 5.18
4864 5234 5.161358 CAAATCTCTCACTAGTGTAACGCA 58.839 41.667 21.99 1.12 45.86 5.24
4865 5235 5.061064 CACAAATCTCTCACTAGTGTAACGC 59.939 44.000 21.99 0.00 45.86 4.84
4866 5236 5.061064 GCACAAATCTCTCACTAGTGTAACG 59.939 44.000 21.99 9.71 45.86 3.18
4867 5237 5.926542 TGCACAAATCTCTCACTAGTGTAAC 59.073 40.000 21.99 1.91 0.00 2.50
4868 5238 6.096673 TGCACAAATCTCTCACTAGTGTAA 57.903 37.500 21.99 10.68 0.00 2.41
4869 5239 5.722021 TGCACAAATCTCTCACTAGTGTA 57.278 39.130 21.99 11.01 0.00 2.90
4870 5240 4.607293 TGCACAAATCTCTCACTAGTGT 57.393 40.909 21.99 0.00 0.00 3.55
4871 5241 6.591448 TGTAATGCACAAATCTCTCACTAGTG 59.409 38.462 17.17 17.17 32.95 2.74
4872 5242 6.701340 TGTAATGCACAAATCTCTCACTAGT 58.299 36.000 0.00 0.00 32.95 2.57
4873 5243 7.601073 TTGTAATGCACAAATCTCTCACTAG 57.399 36.000 0.00 0.00 44.20 2.57
4885 5255 9.571810 CTTAGCAATAGAATTTGTAATGCACAA 57.428 29.630 14.02 7.87 45.49 3.33
4886 5256 7.701924 GCTTAGCAATAGAATTTGTAATGCACA 59.298 33.333 14.02 1.60 34.89 4.57
4887 5257 7.168135 GGCTTAGCAATAGAATTTGTAATGCAC 59.832 37.037 14.02 3.24 34.89 4.57
4888 5258 7.202526 GGCTTAGCAATAGAATTTGTAATGCA 58.797 34.615 14.02 0.00 34.89 3.96
4889 5259 6.360681 CGGCTTAGCAATAGAATTTGTAATGC 59.639 38.462 6.53 5.67 0.00 3.56
4890 5260 6.360681 GCGGCTTAGCAATAGAATTTGTAATG 59.639 38.462 6.53 0.00 37.05 1.90
4891 5261 6.438763 GCGGCTTAGCAATAGAATTTGTAAT 58.561 36.000 6.53 0.00 37.05 1.89
4892 5262 5.220970 GGCGGCTTAGCAATAGAATTTGTAA 60.221 40.000 6.53 0.00 39.27 2.41
4893 5263 4.274950 GGCGGCTTAGCAATAGAATTTGTA 59.725 41.667 6.53 0.00 39.27 2.41
4894 5264 3.066760 GGCGGCTTAGCAATAGAATTTGT 59.933 43.478 6.53 0.00 39.27 2.83
4895 5265 3.066621 TGGCGGCTTAGCAATAGAATTTG 59.933 43.478 11.43 0.00 39.27 2.32
4896 5266 3.066760 GTGGCGGCTTAGCAATAGAATTT 59.933 43.478 11.43 0.00 39.27 1.82
4897 5267 2.618709 GTGGCGGCTTAGCAATAGAATT 59.381 45.455 11.43 0.00 39.27 2.17
4898 5268 2.222027 GTGGCGGCTTAGCAATAGAAT 58.778 47.619 11.43 0.00 39.27 2.40
4899 5269 1.663695 GTGGCGGCTTAGCAATAGAA 58.336 50.000 11.43 0.00 39.27 2.10
4900 5270 0.179056 GGTGGCGGCTTAGCAATAGA 60.179 55.000 11.43 0.00 39.27 1.98
4901 5271 1.166531 GGGTGGCGGCTTAGCAATAG 61.167 60.000 11.43 0.00 39.27 1.73
4902 5272 1.153046 GGGTGGCGGCTTAGCAATA 60.153 57.895 11.43 0.00 39.27 1.90
4903 5273 2.440247 GGGTGGCGGCTTAGCAAT 60.440 61.111 11.43 0.00 39.27 3.56
4904 5274 2.985539 TTTGGGTGGCGGCTTAGCAA 62.986 55.000 11.43 0.00 39.27 3.91
4905 5275 3.499461 TTTGGGTGGCGGCTTAGCA 62.499 57.895 11.43 0.00 39.27 3.49
4906 5276 2.675075 TTTGGGTGGCGGCTTAGC 60.675 61.111 11.43 0.00 0.00 3.09
4907 5277 2.340328 GGTTTGGGTGGCGGCTTAG 61.340 63.158 11.43 0.00 0.00 2.18
4908 5278 2.282603 GGTTTGGGTGGCGGCTTA 60.283 61.111 11.43 0.00 0.00 3.09
4909 5279 4.218686 AGGTTTGGGTGGCGGCTT 62.219 61.111 11.43 0.00 0.00 4.35
4910 5280 4.974721 CAGGTTTGGGTGGCGGCT 62.975 66.667 11.43 0.00 0.00 5.52
4912 5282 2.131067 AAACAGGTTTGGGTGGCGG 61.131 57.895 0.00 0.00 0.00 6.13
4913 5283 1.067250 CAAACAGGTTTGGGTGGCG 59.933 57.895 15.37 0.00 44.47 5.69
4921 5291 3.951775 TGTGCTTTGTCAAACAGGTTT 57.048 38.095 0.00 0.00 0.00 3.27
4922 5292 3.701040 AGATGTGCTTTGTCAAACAGGTT 59.299 39.130 0.00 0.00 0.00 3.50
4923 5293 3.290710 AGATGTGCTTTGTCAAACAGGT 58.709 40.909 0.00 0.00 0.00 4.00
4924 5294 3.996150 AGATGTGCTTTGTCAAACAGG 57.004 42.857 0.00 0.00 0.00 4.00
4925 5295 9.630098 AAATTATAGATGTGCTTTGTCAAACAG 57.370 29.630 0.00 0.00 0.00 3.16
4926 5296 9.979578 AAAATTATAGATGTGCTTTGTCAAACA 57.020 25.926 0.00 0.00 0.00 2.83
4973 5343 9.781834 CAAATATAGTTGCATTCCTACGAAAAA 57.218 29.630 0.00 0.00 0.00 1.94
4984 5354 9.034361 GGAGGTCCAAGCAAATATAGTTGCATT 62.034 40.741 32.30 22.10 44.98 3.56
4985 5355 7.638476 GGAGGTCCAAGCAAATATAGTTGCAT