Multiple sequence alignment - TraesCS6A01G404400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G404400 chr6A 100.000 1921 0 0 1 1921 611003789 611005709 0.000000e+00 3548.0
1 TraesCS6A01G404400 chr6A 99.636 1921 7 0 1 1921 610979702 610981622 0.000000e+00 3509.0
2 TraesCS6A01G404400 chr6A 99.271 1921 13 1 1 1921 611030652 611032571 0.000000e+00 3469.0
3 TraesCS6A01G404400 chr6A 100.000 1371 0 0 2526 3896 611006314 611007684 0.000000e+00 2532.0
4 TraesCS6A01G404400 chr6A 99.562 1371 6 0 2526 3896 610982253 610983623 0.000000e+00 2499.0
5 TraesCS6A01G404400 chr6A 98.843 1124 11 2 800 1921 610988425 610989548 0.000000e+00 2002.0
6 TraesCS6A01G404400 chr6A 98.754 1124 11 3 800 1921 611014511 611015633 0.000000e+00 1995.0
7 TraesCS6A01G404400 chr6A 98.578 1125 12 4 800 1921 610963943 610965066 0.000000e+00 1986.0
8 TraesCS6A01G404400 chr6A 97.509 803 18 2 1 802 26552445 26553246 0.000000e+00 1371.0
9 TraesCS6A01G404400 chr6A 97.136 803 23 0 1 803 609615369 609614567 0.000000e+00 1356.0
10 TraesCS6A01G404400 chr6A 100.000 100 0 0 4024 4123 610983625 610983724 7.040000e-43 185.0
11 TraesCS6A01G404400 chr6A 100.000 100 0 0 4024 4123 611007812 611007911 7.040000e-43 185.0
12 TraesCS6A01G404400 chr6A 98.000 100 2 0 4024 4123 610952807 610952906 1.520000e-39 174.0
13 TraesCS6A01G404400 chr6A 100.000 39 0 0 3858 3896 610952767 610952805 5.720000e-09 73.1
14 TraesCS6A01G404400 chr1A 98.277 1335 23 0 2526 3860 409611493 409612827 0.000000e+00 2338.0
15 TraesCS6A01G404400 chr1A 97.257 802 22 0 1 802 584331032 584330231 0.000000e+00 1360.0
16 TraesCS6A01G404400 chr1A 99.628 269 1 0 1653 1921 409610594 409610862 3.700000e-135 492.0
17 TraesCS6A01G404400 chr2A 97.907 1338 28 0 2526 3863 628645955 628644618 0.000000e+00 2316.0
18 TraesCS6A01G404400 chr2A 97.906 1337 28 0 2526 3862 374485932 374487268 0.000000e+00 2314.0
19 TraesCS6A01G404400 chr2A 97.598 1332 31 1 2526 3857 628572064 628573394 0.000000e+00 2281.0
20 TraesCS6A01G404400 chr2A 97.384 1338 29 2 2526 3863 161529129 161530460 0.000000e+00 2272.0
21 TraesCS6A01G404400 chr2A 97.260 803 21 1 1 802 9308860 9309662 0.000000e+00 1360.0
22 TraesCS6A01G404400 chr2A 97.615 671 14 2 800 1468 628570496 628571166 0.000000e+00 1149.0
23 TraesCS6A01G404400 chr2A 97.478 674 15 2 800 1471 628647523 628646850 0.000000e+00 1149.0
24 TraesCS6A01G404400 chr2A 97.329 674 15 3 800 1471 161527561 161528233 0.000000e+00 1142.0
25 TraesCS6A01G404400 chr2A 100.000 267 0 0 1655 1921 628571168 628571434 1.030000e-135 494.0
26 TraesCS6A01G404400 chr2A 100.000 267 0 0 1655 1921 628646851 628646585 1.030000e-135 494.0
27 TraesCS6A01G404400 chr1B 97.534 1338 33 0 2526 3863 530761866 530760529 0.000000e+00 2289.0
28 TraesCS6A01G404400 chr1B 97.303 1335 33 1 2526 3860 95494299 95495630 0.000000e+00 2263.0
29 TraesCS6A01G404400 chr1B 97.774 674 12 3 800 1471 95492732 95493404 0.000000e+00 1158.0
30 TraesCS6A01G404400 chr1B 100.000 267 0 0 1653 1919 95493401 95493667 1.030000e-135 494.0
31 TraesCS6A01G404400 chr2B 96.536 1299 37 3 2526 3822 424682759 424681467 0.000000e+00 2143.0
32 TraesCS6A01G404400 chr4A 97.516 805 17 2 1 802 598174752 598173948 0.000000e+00 1373.0
33 TraesCS6A01G404400 chr7A 97.277 808 19 1 1 805 703946990 703947797 0.000000e+00 1367.0
34 TraesCS6A01G404400 chr5A 97.260 803 21 1 1 802 475241594 475242396 0.000000e+00 1360.0
35 TraesCS6A01G404400 chr4D 96.842 190 6 0 1466 1655 503922019 503922208 6.650000e-83 318.0
36 TraesCS6A01G404400 chr1D 96.859 191 5 1 1469 1658 176953158 176952968 6.650000e-83 318.0
37 TraesCS6A01G404400 chr5D 95.897 195 8 0 1468 1662 28162080 28162274 2.390000e-82 316.0
38 TraesCS6A01G404400 chr5D 96.373 193 6 1 1468 1660 121102664 121102473 2.390000e-82 316.0
39 TraesCS6A01G404400 chr6D 96.721 61 2 0 4024 4084 464464581 464464641 7.290000e-18 102.0
40 TraesCS6A01G404400 chr6B 97.436 39 1 0 3858 3896 708224955 708224993 2.660000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G404400 chr6A 611003789 611007911 4122 False 2088.333333 3548 100.000000 1 4123 3 chr6A.!!$F8 4122
1 TraesCS6A01G404400 chr6A 611030652 611032571 1919 False 3469.000000 3469 99.271000 1 1921 1 chr6A.!!$F5 1920
2 TraesCS6A01G404400 chr6A 610979702 610983724 4022 False 2064.333333 3509 99.732667 1 4123 3 chr6A.!!$F7 4122
3 TraesCS6A01G404400 chr6A 610988425 610989548 1123 False 2002.000000 2002 98.843000 800 1921 1 chr6A.!!$F3 1121
4 TraesCS6A01G404400 chr6A 611014511 611015633 1122 False 1995.000000 1995 98.754000 800 1921 1 chr6A.!!$F4 1121
5 TraesCS6A01G404400 chr6A 610963943 610965066 1123 False 1986.000000 1986 98.578000 800 1921 1 chr6A.!!$F2 1121
6 TraesCS6A01G404400 chr6A 26552445 26553246 801 False 1371.000000 1371 97.509000 1 802 1 chr6A.!!$F1 801
7 TraesCS6A01G404400 chr6A 609614567 609615369 802 True 1356.000000 1356 97.136000 1 803 1 chr6A.!!$R1 802
8 TraesCS6A01G404400 chr1A 409610594 409612827 2233 False 1415.000000 2338 98.952500 1653 3860 2 chr1A.!!$F1 2207
9 TraesCS6A01G404400 chr1A 584330231 584331032 801 True 1360.000000 1360 97.257000 1 802 1 chr1A.!!$R1 801
10 TraesCS6A01G404400 chr2A 374485932 374487268 1336 False 2314.000000 2314 97.906000 2526 3862 1 chr2A.!!$F2 1336
11 TraesCS6A01G404400 chr2A 161527561 161530460 2899 False 1707.000000 2272 97.356500 800 3863 2 chr2A.!!$F3 3063
12 TraesCS6A01G404400 chr2A 9308860 9309662 802 False 1360.000000 1360 97.260000 1 802 1 chr2A.!!$F1 801
13 TraesCS6A01G404400 chr2A 628644618 628647523 2905 True 1319.666667 2316 98.461667 800 3863 3 chr2A.!!$R1 3063
14 TraesCS6A01G404400 chr2A 628570496 628573394 2898 False 1308.000000 2281 98.404333 800 3857 3 chr2A.!!$F4 3057
15 TraesCS6A01G404400 chr1B 530760529 530761866 1337 True 2289.000000 2289 97.534000 2526 3863 1 chr1B.!!$R1 1337
16 TraesCS6A01G404400 chr1B 95492732 95495630 2898 False 1305.000000 2263 98.359000 800 3860 3 chr1B.!!$F1 3060
17 TraesCS6A01G404400 chr2B 424681467 424682759 1292 True 2143.000000 2143 96.536000 2526 3822 1 chr2B.!!$R1 1296
18 TraesCS6A01G404400 chr4A 598173948 598174752 804 True 1373.000000 1373 97.516000 1 802 1 chr4A.!!$R1 801
19 TraesCS6A01G404400 chr7A 703946990 703947797 807 False 1367.000000 1367 97.277000 1 805 1 chr7A.!!$F1 804
20 TraesCS6A01G404400 chr5A 475241594 475242396 802 False 1360.000000 1360 97.260000 1 802 1 chr5A.!!$F1 801

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
229 230 6.252967 TCTTTACTCGTTCCGTAACACATA 57.747 37.500 0.0 0.0 35.16 2.29 F
1182 1190 2.271800 CGACAACCTTAGAGATGCCAC 58.728 52.381 0.0 0.0 0.00 5.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1182 1190 1.134367 CAGCCCACATTTGATGAGCAG 59.866 52.381 0.0 0.0 0.00 4.24 R
3336 3558 0.954452 AAGCCTTCCACTGAAAAGCG 59.046 50.000 0.0 0.0 35.82 4.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
229 230 6.252967 TCTTTACTCGTTCCGTAACACATA 57.747 37.500 0.0 0.0 35.16 2.29
1182 1190 2.271800 CGACAACCTTAGAGATGCCAC 58.728 52.381 0.0 0.0 0.00 5.01
1458 1468 4.756502 ACTAGCCGTGACTTTATTTCTCC 58.243 43.478 0.0 0.0 0.00 3.71
3336 3558 3.485877 GCGACTTGGATCTATTTGTGTGC 60.486 47.826 0.0 0.0 0.00 4.57
3456 3678 4.564821 CGTGGAAGAATTTGGGAGGAACTA 60.565 45.833 0.0 0.0 41.55 2.24
3474 3696 9.601217 GAGGAACTAATAATTAAGCTCTTGTGA 57.399 33.333 0.0 0.0 41.55 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
229 230 5.045359 TGACCAAGGAGTTGATCATGAGATT 60.045 40.000 0.09 0.0 30.49 2.40
443 447 3.759581 AGACCATGAGATTGTGCAACTT 58.240 40.909 0.00 0.0 38.04 2.66
1182 1190 1.134367 CAGCCCACATTTGATGAGCAG 59.866 52.381 0.00 0.0 0.00 4.24
1458 1468 2.351276 CCCCCAAAGTCCCGACAG 59.649 66.667 0.00 0.0 0.00 3.51
3336 3558 0.954452 AAGCCTTCCACTGAAAAGCG 59.046 50.000 0.00 0.0 35.82 4.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.