Multiple sequence alignment - TraesCS6A01G403100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G403100 chr6A 100.000 3246 0 0 1 3246 610603950 610607195 0 5995
1 TraesCS6A01G403100 chr6A 97.391 3258 67 8 1 3246 24913687 24910436 0 5529
2 TraesCS6A01G403100 chr6A 98.551 1449 21 0 915 2363 29906064 29904616 0 2560
3 TraesCS6A01G403100 chr6A 93.459 902 37 6 2361 3246 29904690 29903795 0 1319
4 TraesCS6A01G403100 chr1A 96.922 3281 62 12 1 3246 9662409 9665685 0 5463
5 TraesCS6A01G403100 chr1A 96.537 1646 45 3 751 2384 12275676 12277321 0 2713
6 TraesCS6A01G403100 chr1A 93.579 1495 48 9 856 2336 1472931 1471471 0 2185
7 TraesCS6A01G403100 chr1A 93.566 1492 51 8 856 2336 1433104 1431647 0 2182
8 TraesCS6A01G403100 chr1A 96.543 405 12 2 2842 3246 1565381 1564979 0 669
9 TraesCS6A01G403100 chr1A 96.296 405 15 0 2842 3246 12277766 12278170 0 665
10 TraesCS6A01G403100 chrUn 96.193 3257 72 18 1 3246 197746720 197743505 0 5280
11 TraesCS6A01G403100 chrUn 95.918 2425 58 7 1 2384 264694251 264696675 0 3892
12 TraesCS6A01G403100 chrUn 95.043 928 29 10 2335 3246 273110849 273109923 0 1443
13 TraesCS6A01G403100 chr3B 97.403 2387 54 2 1 2384 766123664 766121283 0 4058
14 TraesCS6A01G403100 chr3B 97.656 512 10 2 2335 2845 766121380 766120870 0 878
15 TraesCS6A01G403100 chr6B 96.913 2397 56 3 1 2384 37733465 37735856 0 4000
16 TraesCS6A01G403100 chr6B 96.754 2403 56 6 1 2384 716417504 716415105 0 3986
17 TraesCS6A01G403100 chr4B 96.800 2406 53 5 1 2384 664138262 664140665 0 3995
18 TraesCS6A01G403100 chr4A 96.717 2406 53 6 1 2384 701547939 701545538 0 3982
19 TraesCS6A01G403100 chr4A 96.342 2406 63 5 1 2384 718590788 718588386 0 3932
20 TraesCS6A01G403100 chr4A 96.113 1518 46 2 1 1505 635792426 635793943 0 2464
21 TraesCS6A01G403100 chr4A 97.656 512 10 2 2335 2845 701545635 701545125 0 878
22 TraesCS6A01G403100 chr4A 96.790 405 13 0 2842 3246 631532712 631532308 0 676
23 TraesCS6A01G403100 chr7A 96.012 2407 71 10 1 2384 724220296 724217892 0 3890
24 TraesCS6A01G403100 chr7A 90.051 1970 98 29 531 2408 538319569 538321532 0 2462
25 TraesCS6A01G403100 chr7A 96.543 405 14 0 2842 3246 724217448 724217044 0 671
26 TraesCS6A01G403100 chr2A 95.776 2415 58 5 1 2384 3028668 3026267 0 3855
27 TraesCS6A01G403100 chr2A 94.606 1687 49 7 778 2432 18597422 18599098 0 2573
28 TraesCS6A01G403100 chr2A 96.882 1315 38 1 1073 2384 765305681 765306995 0 2198
29 TraesCS6A01G403100 chr2A 97.852 512 9 2 2335 2845 32428671 32428161 0 883
30 TraesCS6A01G403100 chr5B 97.656 512 10 2 2335 2845 708890477 708890987 0 878
31 TraesCS6A01G403100 chr7B 96.790 405 13 0 2842 3246 643689917 643689513 0 676


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G403100 chr6A 610603950 610607195 3245 False 5995.0 5995 100.0000 1 3246 1 chr6A.!!$F1 3245
1 TraesCS6A01G403100 chr6A 24910436 24913687 3251 True 5529.0 5529 97.3910 1 3246 1 chr6A.!!$R1 3245
2 TraesCS6A01G403100 chr6A 29903795 29906064 2269 True 1939.5 2560 96.0050 915 3246 2 chr6A.!!$R2 2331
3 TraesCS6A01G403100 chr1A 9662409 9665685 3276 False 5463.0 5463 96.9220 1 3246 1 chr1A.!!$F1 3245
4 TraesCS6A01G403100 chr1A 1471471 1472931 1460 True 2185.0 2185 93.5790 856 2336 1 chr1A.!!$R2 1480
5 TraesCS6A01G403100 chr1A 1431647 1433104 1457 True 2182.0 2182 93.5660 856 2336 1 chr1A.!!$R1 1480
6 TraesCS6A01G403100 chr1A 12275676 12278170 2494 False 1689.0 2713 96.4165 751 3246 2 chr1A.!!$F2 2495
7 TraesCS6A01G403100 chrUn 197743505 197746720 3215 True 5280.0 5280 96.1930 1 3246 1 chrUn.!!$R1 3245
8 TraesCS6A01G403100 chrUn 264694251 264696675 2424 False 3892.0 3892 95.9180 1 2384 1 chrUn.!!$F1 2383
9 TraesCS6A01G403100 chrUn 273109923 273110849 926 True 1443.0 1443 95.0430 2335 3246 1 chrUn.!!$R2 911
10 TraesCS6A01G403100 chr3B 766120870 766123664 2794 True 2468.0 4058 97.5295 1 2845 2 chr3B.!!$R1 2844
11 TraesCS6A01G403100 chr6B 37733465 37735856 2391 False 4000.0 4000 96.9130 1 2384 1 chr6B.!!$F1 2383
12 TraesCS6A01G403100 chr6B 716415105 716417504 2399 True 3986.0 3986 96.7540 1 2384 1 chr6B.!!$R1 2383
13 TraesCS6A01G403100 chr4B 664138262 664140665 2403 False 3995.0 3995 96.8000 1 2384 1 chr4B.!!$F1 2383
14 TraesCS6A01G403100 chr4A 718588386 718590788 2402 True 3932.0 3932 96.3420 1 2384 1 chr4A.!!$R2 2383
15 TraesCS6A01G403100 chr4A 635792426 635793943 1517 False 2464.0 2464 96.1130 1 1505 1 chr4A.!!$F1 1504
16 TraesCS6A01G403100 chr4A 701545125 701547939 2814 True 2430.0 3982 97.1865 1 2845 2 chr4A.!!$R3 2844
17 TraesCS6A01G403100 chr7A 538319569 538321532 1963 False 2462.0 2462 90.0510 531 2408 1 chr7A.!!$F1 1877
18 TraesCS6A01G403100 chr7A 724217044 724220296 3252 True 2280.5 3890 96.2775 1 3246 2 chr7A.!!$R1 3245
19 TraesCS6A01G403100 chr2A 3026267 3028668 2401 True 3855.0 3855 95.7760 1 2384 1 chr2A.!!$R1 2383
20 TraesCS6A01G403100 chr2A 18597422 18599098 1676 False 2573.0 2573 94.6060 778 2432 1 chr2A.!!$F1 1654
21 TraesCS6A01G403100 chr2A 765305681 765306995 1314 False 2198.0 2198 96.8820 1073 2384 1 chr2A.!!$F2 1311
22 TraesCS6A01G403100 chr2A 32428161 32428671 510 True 883.0 883 97.8520 2335 2845 1 chr2A.!!$R2 510
23 TraesCS6A01G403100 chr5B 708890477 708890987 510 False 878.0 878 97.6560 2335 2845 1 chr5B.!!$F1 510

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
698 719 1.007387 CAAACCAAAGGGCTCACGC 60.007 57.895 0.0 0.0 37.9 5.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2682 3100 2.684374 CGAATTGGATGCATTCAGGTCA 59.316 45.455 7.94 0.0 31.07 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
168 169 7.283625 AGCCAAACAACAGACAATACATAAA 57.716 32.000 0.00 0.00 0.00 1.40
256 257 6.931838 TGGTCCTAGTAATAAATAGCATCGG 58.068 40.000 0.00 0.00 0.00 4.18
298 299 5.308825 ACTGTCCAAACCAAAGAGACATAG 58.691 41.667 0.00 0.00 36.89 2.23
433 434 2.093021 TCCTGATGGTCATGAAATCGCA 60.093 45.455 0.00 0.00 34.23 5.10
529 530 3.885484 ACGATCGATGGATGCATTTTC 57.115 42.857 24.34 0.00 31.51 2.29
693 714 2.159179 ACAAGACAAACCAAAGGGCT 57.841 45.000 0.00 0.00 37.90 5.19
698 719 1.007387 CAAACCAAAGGGCTCACGC 60.007 57.895 0.00 0.00 37.90 5.34
1713 2057 9.587772 GAAGTTCTGAAGTAGATGCAATACTAA 57.412 33.333 13.58 6.52 34.80 2.24
2388 2804 8.628882 ACAAGTTAGCTTTTGTTATGTTGAAC 57.371 30.769 0.00 0.00 34.00 3.18
2515 2931 6.331369 TCCTTCAACTTTTGGTGATCATTC 57.669 37.500 0.00 0.00 46.73 2.67
2526 2942 5.947228 TGGTGATCATTCAGTTCAAGTTC 57.053 39.130 0.00 0.00 30.85 3.01
2542 2958 6.550938 TCAAGTTCTGGTCAGATCATACAT 57.449 37.500 10.52 0.00 37.29 2.29
2976 3429 0.465705 GATCTGGCCGATCCTGTTCA 59.534 55.000 20.37 0.00 42.24 3.18
3102 3557 1.880941 GAGGGGAATAGGTGGAGTGT 58.119 55.000 0.00 0.00 0.00 3.55
3166 3651 2.355837 GCCGTCTCGTTGTCTGCA 60.356 61.111 0.00 0.00 0.00 4.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
209 210 8.408601 ACCATGAATTGTGCTATTAATGTCTTC 58.591 33.333 0.00 0.00 28.16 2.87
256 257 7.596248 TGGACAGTCGTTAAACTTAGATGTAAC 59.404 37.037 0.00 0.00 0.00 2.50
529 530 2.223876 ACAACATCAGCCAAAACAGCAG 60.224 45.455 0.00 0.00 0.00 4.24
677 698 1.692411 GTGAGCCCTTTGGTTTGTCT 58.308 50.000 0.00 0.00 0.00 3.41
693 714 2.822643 AATCTGGAGGGGAGGCGTGA 62.823 60.000 0.00 0.00 0.00 4.35
698 719 1.559682 TCGAAAAATCTGGAGGGGAGG 59.440 52.381 0.00 0.00 0.00 4.30
1549 1815 6.705302 TGCATCTACTTCAGAACTTCAGAAT 58.295 36.000 0.00 0.00 36.67 2.40
1713 2057 5.188555 TGCATCTACTCCAGAACTTCAGAAT 59.811 40.000 0.00 0.00 36.67 2.40
2388 2804 7.224362 TGTTCATCATTACAAAAGCAAACTTGG 59.776 33.333 0.00 0.00 35.85 3.61
2515 2931 4.635223 TGATCTGACCAGAACTTGAACTG 58.365 43.478 3.62 0.00 41.36 3.16
2526 2942 7.930325 AGACAACATTATGTATGATCTGACCAG 59.070 37.037 0.00 0.00 37.69 4.00
2589 3007 7.867909 GCTTTTTCAGTTATAGTGAAAGGCTTT 59.132 33.333 13.25 13.25 45.16 3.51
2682 3100 2.684374 CGAATTGGATGCATTCAGGTCA 59.316 45.455 7.94 0.00 31.07 4.02
3102 3557 1.286305 GGCCATTAGAACCCTCCCCA 61.286 60.000 0.00 0.00 0.00 4.96


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.