Multiple sequence alignment - TraesCS6A01G397300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G397300 chr6A 100.000 2487 0 0 1 2487 608883236 608880750 0 4593
1 TraesCS6A01G397300 chr6A 98.271 1851 23 3 646 2487 84434789 84436639 0 3232
2 TraesCS6A01G397300 chrUn 98.864 1848 15 3 646 2487 282364051 282362204 0 3291
3 TraesCS6A01G397300 chrUn 98.810 1848 16 3 646 2487 86509367 86507520 0 3286
4 TraesCS6A01G397300 chrUn 99.536 646 3 0 1 646 189394120 189394765 0 1177
5 TraesCS6A01G397300 chrUn 99.536 646 3 0 1 646 389303751 389303106 0 1177
6 TraesCS6A01G397300 chr6B 98.864 1849 14 3 646 2487 596620968 596622816 0 3291
7 TraesCS6A01G397300 chr3B 98.753 1845 19 1 646 2486 92318482 92320326 0 3277
8 TraesCS6A01G397300 chr4D 98.644 1843 23 2 646 2487 123424359 123426200 0 3264
9 TraesCS6A01G397300 chr4D 99.226 646 5 0 1 646 123414463 123415108 0 1166
10 TraesCS6A01G397300 chr2B 98.483 1846 21 5 646 2487 30669966 30668124 0 3247
11 TraesCS6A01G397300 chr5B 98.370 1841 29 1 646 2486 567269950 567268111 0 3232
12 TraesCS6A01G397300 chr5B 99.536 646 3 0 1 646 679660478 679661123 0 1177
13 TraesCS6A01G397300 chr3D 98.267 1846 27 3 646 2487 154704315 154702471 0 3227
14 TraesCS6A01G397300 chr5A 99.536 646 3 0 1 646 300074560 300075205 0 1177
15 TraesCS6A01G397300 chr5A 99.226 646 5 0 1 646 600278151 600277506 0 1166
16 TraesCS6A01G397300 chr7D 99.381 646 4 0 1 646 203554765 203554120 0 1171
17 TraesCS6A01G397300 chr7D 99.381 646 4 0 1 646 626696909 626696264 0 1171
18 TraesCS6A01G397300 chr2A 99.226 646 5 0 1 646 618278375 618277730 0 1166


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G397300 chr6A 608880750 608883236 2486 True 4593 4593 100.000 1 2487 1 chr6A.!!$R1 2486
1 TraesCS6A01G397300 chr6A 84434789 84436639 1850 False 3232 3232 98.271 646 2487 1 chr6A.!!$F1 1841
2 TraesCS6A01G397300 chrUn 282362204 282364051 1847 True 3291 3291 98.864 646 2487 1 chrUn.!!$R2 1841
3 TraesCS6A01G397300 chrUn 86507520 86509367 1847 True 3286 3286 98.810 646 2487 1 chrUn.!!$R1 1841
4 TraesCS6A01G397300 chrUn 189394120 189394765 645 False 1177 1177 99.536 1 646 1 chrUn.!!$F1 645
5 TraesCS6A01G397300 chrUn 389303106 389303751 645 True 1177 1177 99.536 1 646 1 chrUn.!!$R3 645
6 TraesCS6A01G397300 chr6B 596620968 596622816 1848 False 3291 3291 98.864 646 2487 1 chr6B.!!$F1 1841
7 TraesCS6A01G397300 chr3B 92318482 92320326 1844 False 3277 3277 98.753 646 2486 1 chr3B.!!$F1 1840
8 TraesCS6A01G397300 chr4D 123424359 123426200 1841 False 3264 3264 98.644 646 2487 1 chr4D.!!$F2 1841
9 TraesCS6A01G397300 chr4D 123414463 123415108 645 False 1166 1166 99.226 1 646 1 chr4D.!!$F1 645
10 TraesCS6A01G397300 chr2B 30668124 30669966 1842 True 3247 3247 98.483 646 2487 1 chr2B.!!$R1 1841
11 TraesCS6A01G397300 chr5B 567268111 567269950 1839 True 3232 3232 98.370 646 2486 1 chr5B.!!$R1 1840
12 TraesCS6A01G397300 chr5B 679660478 679661123 645 False 1177 1177 99.536 1 646 1 chr5B.!!$F1 645
13 TraesCS6A01G397300 chr3D 154702471 154704315 1844 True 3227 3227 98.267 646 2487 1 chr3D.!!$R1 1841
14 TraesCS6A01G397300 chr5A 300074560 300075205 645 False 1177 1177 99.536 1 646 1 chr5A.!!$F1 645
15 TraesCS6A01G397300 chr5A 600277506 600278151 645 True 1166 1166 99.226 1 646 1 chr5A.!!$R1 645
16 TraesCS6A01G397300 chr7D 203554120 203554765 645 True 1171 1171 99.381 1 646 1 chr7D.!!$R1 645
17 TraesCS6A01G397300 chr7D 626696264 626696909 645 True 1171 1171 99.381 1 646 1 chr7D.!!$R2 645
18 TraesCS6A01G397300 chr2A 618277730 618278375 645 True 1166 1166 99.226 1 646 1 chr2A.!!$R1 645

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
706 707 2.54848 GCTTACTCTCAGCCACGTTTTT 59.452 45.455 0.0 0.0 0.0 1.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2143 2155 1.759445 CTCATCCCGATCACAAGGAGT 59.241 52.381 0.0 0.0 31.94 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
680 681 3.583228 TGACTCAACCACTAGGAAAGGA 58.417 45.455 0.00 0.0 38.69 3.36
681 682 4.168101 TGACTCAACCACTAGGAAAGGAT 58.832 43.478 0.00 0.0 38.69 3.24
706 707 2.548480 GCTTACTCTCAGCCACGTTTTT 59.452 45.455 0.00 0.0 0.00 1.94
753 754 5.375417 TCCATTCGAAGTAACGTAACAGA 57.625 39.130 3.35 0.0 34.70 3.41
1016 1017 4.670896 AAGTAATGGCTTTTGTGCAACT 57.329 36.364 0.00 0.0 38.04 3.16
1180 1181 4.329545 GTCTGGTCGCTTGGGCCA 62.330 66.667 0.00 0.0 34.44 5.36
1275 1276 7.441157 TCTTCGCTAGGTGTTTATGGAATAATG 59.559 37.037 0.00 0.0 38.83 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
78 79 3.960102 CCCTGATCTGGATAGATAGCTCC 59.040 52.174 19.59 0.0 43.63 4.70
308 309 6.411376 TGATTCACCCACGTAAATAGACAAT 58.589 36.000 0.00 0.0 0.00 2.71
680 681 3.133003 ACGTGGCTGAGAGTAAGCAATAT 59.867 43.478 0.00 0.0 42.69 1.28
681 682 2.496070 ACGTGGCTGAGAGTAAGCAATA 59.504 45.455 0.00 0.0 42.69 1.90
706 707 4.222810 TCCTCACTTGACTAAGCATAAGCA 59.777 41.667 0.00 0.0 45.49 3.91
753 754 4.023707 CGAGAAGTTTTGAAGATGGTGCTT 60.024 41.667 0.00 0.0 0.00 3.91
1016 1017 3.056107 CACTACATCAGGACCCTTTCGAA 60.056 47.826 0.00 0.0 0.00 3.71
1275 1276 5.505985 CGTCTTACTAGACCAACCTGCTATC 60.506 48.000 0.00 0.0 46.63 2.08
2143 2155 1.759445 CTCATCCCGATCACAAGGAGT 59.241 52.381 0.00 0.0 31.94 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.