Multiple sequence alignment - TraesCS6A01G397200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G397200 chr6A 100.000 2300 0 0 1 2300 608882068 608879769 0 4248
1 TraesCS6A01G397200 chr6A 98.352 2306 27 4 1 2297 84435312 84437615 0 4037
2 TraesCS6A01G397200 chrUn 99.003 2306 17 3 1 2300 86508844 86506539 0 4126
3 TraesCS6A01G397200 chr4D 98.999 2298 21 2 1 2297 123424882 123427178 0 4115
4 TraesCS6A01G397200 chr6B 98.828 2304 20 3 1 2297 596621491 596623794 0 4098
5 TraesCS6A01G397200 chr3B 98.827 2301 23 1 1 2297 92319005 92321305 0 4096
6 TraesCS6A01G397200 chr2B 98.611 2304 26 4 1 2300 30669445 30667144 0 4072
7 TraesCS6A01G397200 chr7A 98.390 2298 34 3 1 2297 563584352 563586647 0 4036
8 TraesCS6A01G397200 chr5B 98.349 2301 35 3 1 2300 567269427 567267129 0 4036
9 TraesCS6A01G397200 chr3A 97.871 2302 43 3 4 2300 694374400 694372100 0 3975


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G397200 chr6A 608879769 608882068 2299 True 4248 4248 100.000 1 2300 1 chr6A.!!$R1 2299
1 TraesCS6A01G397200 chr6A 84435312 84437615 2303 False 4037 4037 98.352 1 2297 1 chr6A.!!$F1 2296
2 TraesCS6A01G397200 chrUn 86506539 86508844 2305 True 4126 4126 99.003 1 2300 1 chrUn.!!$R1 2299
3 TraesCS6A01G397200 chr4D 123424882 123427178 2296 False 4115 4115 98.999 1 2297 1 chr4D.!!$F1 2296
4 TraesCS6A01G397200 chr6B 596621491 596623794 2303 False 4098 4098 98.828 1 2297 1 chr6B.!!$F1 2296
5 TraesCS6A01G397200 chr3B 92319005 92321305 2300 False 4096 4096 98.827 1 2297 1 chr3B.!!$F1 2296
6 TraesCS6A01G397200 chr2B 30667144 30669445 2301 True 4072 4072 98.611 1 2300 1 chr2B.!!$R1 2299
7 TraesCS6A01G397200 chr7A 563584352 563586647 2295 False 4036 4036 98.390 1 2297 1 chr7A.!!$F1 2296
8 TraesCS6A01G397200 chr5B 567267129 567269427 2298 True 4036 4036 98.349 1 2300 1 chr5B.!!$R1 2299
9 TraesCS6A01G397200 chr3A 694372100 694374400 2300 True 3975 3975 97.871 4 2300 1 chr3A.!!$R1 2296

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
107 108 7.441157 TCTTCGCTAGGTGTTTATGGAATAATG 59.559 37.037 0.0 0.0 38.83 1.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1515 1532 6.210584 GCTAGGCAGATAGATAGACTCCTTTT 59.789 42.308 0.0 0.0 0.0 2.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
107 108 7.441157 TCTTCGCTAGGTGTTTATGGAATAATG 59.559 37.037 0.0 0.0 38.83 1.90
403 412 9.520515 TCTCACTATTGGAAATTCTAGCTTTTT 57.479 29.630 0.0 0.0 0.00 1.94
1515 1532 2.427245 GCTCTCCCTTAGCAGCGGA 61.427 63.158 0.0 0.0 39.83 5.54
1598 1615 1.358152 TTCCACGAATCCCTGAGGTT 58.642 50.000 0.0 0.0 0.00 3.50
2297 2315 2.258748 CTTCGGCCCTTCCTCCTTCC 62.259 65.000 0.0 0.0 0.00 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
107 108 5.505985 CGTCTTACTAGACCAACCTGCTATC 60.506 48.000 0.0 0.0 46.63 2.08
403 412 3.208747 AGAAGAAGAGCCGGTGAAAAA 57.791 42.857 1.9 0.0 0.00 1.94
975 986 1.759445 CTCATCCCGATCACAAGGAGT 59.241 52.381 0.0 0.0 31.94 3.85
1515 1532 6.210584 GCTAGGCAGATAGATAGACTCCTTTT 59.789 42.308 0.0 0.0 0.00 2.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.