Multiple sequence alignment - TraesCS6A01G397100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G397100 chr6A 100.000 2816 0 0 1 2816 608874686 608871871 0 5201
1 TraesCS6A01G397100 chr4A 98.544 2816 39 2 1 2816 67568126 67565313 0 4972
2 TraesCS6A01G397100 chr5A 98.474 2817 31 6 1 2816 492847661 492850466 0 4953
3 TraesCS6A01G397100 chr7A 98.261 2817 43 4 1 2816 46410810 46413621 0 4926
4 TraesCS6A01G397100 chr1A 99.242 2111 13 3 1 2109 238117486 238119595 0 3807
5 TraesCS6A01G397100 chr1A 98.352 728 12 0 2089 2816 238124845 238125572 0 1279
6 TraesCS6A01G397100 chrUn 99.194 2110 15 2 1 2109 222680159 222678051 0 3801
7 TraesCS6A01G397100 chrUn 99.100 2110 16 3 1 2109 86449118 86451225 0 3788
8 TraesCS6A01G397100 chrUn 99.099 2109 17 2 1 2109 86455118 86457224 0 3788
9 TraesCS6A01G397100 chrUn 98.767 730 9 0 2087 2816 86458550 86459279 0 1299
10 TraesCS6A01G397100 chrUn 98.489 728 11 0 2089 2816 222676722 222675995 0 1284
11 TraesCS6A01G397100 chrUn 98.485 726 11 0 2091 2816 86452554 86453279 0 1280
12 TraesCS6A01G397100 chr5B 99.147 2110 16 2 1 2109 533066665 533068773 0 3795
13 TraesCS6A01G397100 chr7B 99.054 2115 16 4 1 2112 742925242 742927355 0 3792
14 TraesCS6A01G397100 chr6B 98.898 726 8 0 2091 2816 596632282 596633007 0 1297
15 TraesCS6A01G397100 chr2D 98.489 728 11 0 2089 2816 322914602 322915329 0 1284


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G397100 chr6A 608871871 608874686 2815 True 5201.00 5201 100.00000 1 2816 1 chr6A.!!$R1 2815
1 TraesCS6A01G397100 chr4A 67565313 67568126 2813 True 4972.00 4972 98.54400 1 2816 1 chr4A.!!$R1 2815
2 TraesCS6A01G397100 chr5A 492847661 492850466 2805 False 4953.00 4953 98.47400 1 2816 1 chr5A.!!$F1 2815
3 TraesCS6A01G397100 chr7A 46410810 46413621 2811 False 4926.00 4926 98.26100 1 2816 1 chr7A.!!$F1 2815
4 TraesCS6A01G397100 chr1A 238117486 238119595 2109 False 3807.00 3807 99.24200 1 2109 1 chr1A.!!$F1 2108
5 TraesCS6A01G397100 chr1A 238124845 238125572 727 False 1279.00 1279 98.35200 2089 2816 1 chr1A.!!$F2 727
6 TraesCS6A01G397100 chrUn 222675995 222680159 4164 True 2542.50 3801 98.84150 1 2816 2 chrUn.!!$R1 2815
7 TraesCS6A01G397100 chrUn 86449118 86459279 10161 False 2538.75 3788 98.86275 1 2816 4 chrUn.!!$F1 2815
8 TraesCS6A01G397100 chr5B 533066665 533068773 2108 False 3795.00 3795 99.14700 1 2109 1 chr5B.!!$F1 2108
9 TraesCS6A01G397100 chr7B 742925242 742927355 2113 False 3792.00 3792 99.05400 1 2112 1 chr7B.!!$F1 2111
10 TraesCS6A01G397100 chr6B 596632282 596633007 725 False 1297.00 1297 98.89800 2091 2816 1 chr6B.!!$F1 725
11 TraesCS6A01G397100 chr2D 322914602 322915329 727 False 1284.00 1284 98.48900 2089 2816 1 chr2D.!!$F1 727

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
816 819 1.45945 TTAGCAGGGGATTTTGTCGC 58.541 50.0 0.0 0.0 38.96 5.19 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2620 9974 1.134699 CATTCTTAGGCGAGCAGTGGA 60.135 52.381 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
123 125 3.947196 ACAACACAACTGCTGATTCTTCA 59.053 39.130 0.00 0.0 0.00 3.02
816 819 1.459450 TTAGCAGGGGATTTTGTCGC 58.541 50.000 0.00 0.0 38.96 5.19
824 827 2.036604 GGGGATTTTGTCGCAAAGGAAA 59.963 45.455 5.42 0.0 41.31 3.13
948 951 1.596934 GGTGCGGGATTCTCTGACA 59.403 57.895 0.00 0.0 0.00 3.58
1926 1931 9.495572 CTCAGATAAGAACCTAACAGAAGTTTT 57.504 33.333 0.00 0.0 39.15 2.43
2488 9842 3.885976 TTGGTCCTGGTCCATAAAACA 57.114 42.857 13.46 0.0 34.75 2.83
2571 9925 2.105821 TCGATCAACCTTGGTTTGGTCT 59.894 45.455 1.76 0.0 36.69 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
123 125 3.146847 GGACAAAGGGTTTTCATCTCGT 58.853 45.455 0.0 0.0 0.0 4.18
816 819 6.589907 CCTTTTCCATTTCCGTATTTCCTTTG 59.410 38.462 0.0 0.0 0.0 2.77
824 827 4.586306 AGTCCCTTTTCCATTTCCGTAT 57.414 40.909 0.0 0.0 0.0 3.06
948 951 2.364002 CCGGGACCATTTCTTTGTTTGT 59.636 45.455 0.0 0.0 0.0 2.83
2620 9974 1.134699 CATTCTTAGGCGAGCAGTGGA 60.135 52.381 0.0 0.0 0.0 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.