Multiple sequence alignment - TraesCS6A01G384800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G384800 chr6A 100.000 2662 0 0 1 2662 603054885 603057546 0 4916
1 TraesCS6A01G384800 chr2A 98.572 2661 36 2 3 2662 142696613 142699272 0 4702
2 TraesCS6A01G384800 chr3A 98.122 2663 43 3 1 2662 589830442 589833098 0 4634
3 TraesCS6A01G384800 chr5A 97.899 2666 49 4 1 2662 640916622 640919284 0 4606
4 TraesCS6A01G384800 chr5A 97.790 2036 42 3 628 2662 37147438 37145405 0 3507
5 TraesCS6A01G384800 chr7A 97.784 2663 45 3 1 2662 461944508 461941859 0 4578
6 TraesCS6A01G384800 chr7A 97.635 2664 59 3 1 2662 461933834 461931173 0 4567
7 TraesCS6A01G384800 chr7A 97.485 2664 53 3 1 2662 461939381 461936730 0 4536
8 TraesCS6A01G384800 chr5D 96.565 2067 61 5 1 2066 148237471 148235414 0 3415
9 TraesCS6A01G384800 chr5D 97.659 598 14 0 2065 2662 148234890 148234293 0 1027
10 TraesCS6A01G384800 chr7B 95.638 1192 50 2 876 2066 81406308 81407498 0 1912
11 TraesCS6A01G384800 chr7B 95.863 846 30 2 1 842 81405465 81406309 0 1363
12 TraesCS6A01G384800 chr7B 96.990 598 18 0 2065 2662 81408022 81408619 0 1005
13 TraesCS6A01G384800 chr6D 91.688 770 58 5 1 769 443274116 443273352 0 1062


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G384800 chr6A 603054885 603057546 2661 False 4916.000000 4916 100.000000 1 2662 1 chr6A.!!$F1 2661
1 TraesCS6A01G384800 chr2A 142696613 142699272 2659 False 4702.000000 4702 98.572000 3 2662 1 chr2A.!!$F1 2659
2 TraesCS6A01G384800 chr3A 589830442 589833098 2656 False 4634.000000 4634 98.122000 1 2662 1 chr3A.!!$F1 2661
3 TraesCS6A01G384800 chr5A 640916622 640919284 2662 False 4606.000000 4606 97.899000 1 2662 1 chr5A.!!$F1 2661
4 TraesCS6A01G384800 chr5A 37145405 37147438 2033 True 3507.000000 3507 97.790000 628 2662 1 chr5A.!!$R1 2034
5 TraesCS6A01G384800 chr7A 461931173 461944508 13335 True 4560.333333 4578 97.634667 1 2662 3 chr7A.!!$R1 2661
6 TraesCS6A01G384800 chr5D 148234293 148237471 3178 True 2221.000000 3415 97.112000 1 2662 2 chr5D.!!$R1 2661
7 TraesCS6A01G384800 chr7B 81405465 81408619 3154 False 1426.666667 1912 96.163667 1 2662 3 chr7B.!!$F1 2661
8 TraesCS6A01G384800 chr6D 443273352 443274116 764 True 1062.000000 1062 91.688000 1 769 1 chr6D.!!$R1 768

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
831 837 4.115199 GCAAGGGAGCCGATGGGT 62.115 66.667 0.0 0.0 35.46 4.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1908 1918 2.095617 CGCTGAAACTCATCATGCAACA 60.096 45.455 0.0 0.0 0.0 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
831 837 4.115199 GCAAGGGAGCCGATGGGT 62.115 66.667 0.00 0.0 35.46 4.51
1119 1128 4.891992 TTTTGTTGAACTGTTTTGGGGA 57.108 36.364 0.00 0.0 0.00 4.81
1142 1151 2.645192 GGTTTGGGGGCGATGTTGG 61.645 63.158 0.00 0.0 0.00 3.77
1424 1433 3.570912 TCTCAACTTTTCTTTCCCCGT 57.429 42.857 0.00 0.0 0.00 5.28
1449 1458 0.533755 GCATTGACCATAGAGGCGCT 60.534 55.000 7.64 0.0 43.14 5.92
1476 1485 1.229625 TCCATCCAGGACCTGCACT 60.230 57.895 16.72 0.0 43.07 4.40
1678 1688 5.273944 GTGCTAGCAAATATAGTGCCAAAC 58.726 41.667 21.29 0.0 43.27 2.93
1908 1918 5.764192 CGTGCTAAACTATAGTACTCCCTCT 59.236 44.000 5.65 0.0 0.00 3.69
2317 2864 5.589855 TGTATATGTTTGGAGCAATGAGGTG 59.410 40.000 0.00 0.0 0.00 4.00
2361 2908 9.696917 TTTCTTTCTCTTGCATTTCCTAATTTC 57.303 29.630 0.00 0.0 0.00 2.17
2468 3015 1.999648 TTGGAGGCATTGAGCTTTGT 58.000 45.000 0.00 0.0 44.79 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1119 1128 0.612744 CATCGCCCCCAAACCAAAAT 59.387 50.000 0.0 0.0 0.00 1.82
1142 1151 2.618709 CCCCTTCCTCGAACAATAATGC 59.381 50.000 0.0 0.0 0.00 3.56
1424 1433 3.745480 GCCTCTATGGTCAATGCAAGCTA 60.745 47.826 0.0 0.0 38.35 3.32
1449 1458 2.268796 TCCTGGATGGATTCTGTGGA 57.731 50.000 0.0 0.0 40.56 4.02
1476 1485 5.420725 TTTCTTCATCTTCGGATTCAGGA 57.579 39.130 0.0 0.0 31.35 3.86
1678 1688 4.701765 CTCCACCCTTTCTCATCACTATG 58.298 47.826 0.0 0.0 0.00 2.23
1720 1730 9.635404 AAAAGAACATACGGGGAATAATCATAA 57.365 29.630 0.0 0.0 0.00 1.90
1908 1918 2.095617 CGCTGAAACTCATCATGCAACA 60.096 45.455 0.0 0.0 0.00 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.