Multiple sequence alignment - TraesCS6A01G381600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G381600 chr6A 100.000 2613 0 0 1 2613 601158358 601155746 0.000000e+00 4826
1 TraesCS6A01G381600 chr6A 98.088 2615 44 4 1 2613 447840084 447842694 0.000000e+00 4547
2 TraesCS6A01G381600 chr6A 89.490 314 29 2 1484 1795 20167320 20167631 6.780000e-106 394
3 TraesCS6A01G381600 chr6A 89.474 228 15 6 1981 2199 20168101 20168328 1.980000e-71 279
4 TraesCS6A01G381600 chr5A 97.206 2613 71 1 1 2613 433729603 433726993 0.000000e+00 4420
5 TraesCS6A01G381600 chrUn 96.677 2618 62 7 1 2613 33219332 33216735 0.000000e+00 4329
6 TraesCS6A01G381600 chrUn 85.180 668 55 13 1 633 221036438 221037096 0.000000e+00 645
7 TraesCS6A01G381600 chrUn 92.593 81 2 3 2282 2360 221037141 221037219 2.130000e-21 113
8 TraesCS6A01G381600 chr5B 95.469 1920 61 9 1 1914 387891543 387889644 0.000000e+00 3040
9 TraesCS6A01G381600 chr5B 85.019 781 104 10 661 1434 259727914 259728688 0.000000e+00 782
10 TraesCS6A01G381600 chr3B 92.429 1836 102 12 3 1833 328598079 328599882 0.000000e+00 2586
11 TraesCS6A01G381600 chr3B 95.652 69 3 0 2545 2613 328599883 328599951 7.640000e-21 111
12 TraesCS6A01G381600 chr2B 85.030 668 56 12 1 633 788440918 788441576 7.890000e-180 640
13 TraesCS6A01G381600 chr2B 92.593 81 2 3 2282 2360 788441621 788441699 2.130000e-21 113
14 TraesCS6A01G381600 chr1A 84.877 648 80 8 3 642 373587845 373587208 2.840000e-179 638
15 TraesCS6A01G381600 chr1A 88.745 231 17 6 1981 2202 388526040 388525810 9.210000e-70 274
16 TraesCS6A01G381600 chr1A 91.358 81 3 3 2281 2360 373587173 373587096 9.890000e-20 108
17 TraesCS6A01G381600 chr5D 86.085 539 46 13 1 531 239195363 239195880 1.060000e-153 553
18 TraesCS6A01G381600 chr5D 87.912 91 11 0 529 619 535919781 535919871 9.890000e-20 108
19 TraesCS6A01G381600 chr7B 84.060 596 55 11 1792 2353 704819986 704820575 2.960000e-149 538
20 TraesCS6A01G381600 chr7B 85.526 456 32 14 1937 2360 704889106 704889559 1.850000e-121 446
21 TraesCS6A01G381600 chr4B 87.534 369 42 4 661 1025 429721544 429721176 8.640000e-115 424
22 TraesCS6A01G381600 chr7D 90.476 315 28 2 1484 1797 613791753 613792066 5.200000e-112 414
23 TraesCS6A01G381600 chr7D 89.655 232 22 1 1564 1795 116821915 116821686 7.070000e-76 294
24 TraesCS6A01G381600 chr7D 88.596 228 15 7 1981 2199 87182631 87182856 1.540000e-67 267
25 TraesCS6A01G381600 chr7D 89.683 126 10 2 1795 1920 116821635 116821513 9.680000e-35 158
26 TraesCS6A01G381600 chr4A 88.746 311 32 2 1485 1795 224885153 224884846 6.830000e-101 377
27 TraesCS6A01G381600 chr4A 92.308 130 9 1 1791 1920 553276417 553276289 1.600000e-42 183
28 TraesCS6A01G381600 chr1D 87.879 231 18 7 1981 2202 386406286 386406057 1.990000e-66 263
29 TraesCS6A01G381600 chr1D 90.476 126 9 2 1795 1920 386406712 386406590 2.080000e-36 163
30 TraesCS6A01G381600 chr3A 90.909 176 8 4 177 352 469500439 469500606 2.020000e-56 230
31 TraesCS6A01G381600 chr3A 92.857 126 9 0 6 131 469500320 469500445 1.600000e-42 183


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G381600 chr6A 601155746 601158358 2612 True 4826.0 4826 100.0000 1 2613 1 chr6A.!!$R1 2612
1 TraesCS6A01G381600 chr6A 447840084 447842694 2610 False 4547.0 4547 98.0880 1 2613 1 chr6A.!!$F1 2612
2 TraesCS6A01G381600 chr6A 20167320 20168328 1008 False 336.5 394 89.4820 1484 2199 2 chr6A.!!$F2 715
3 TraesCS6A01G381600 chr5A 433726993 433729603 2610 True 4420.0 4420 97.2060 1 2613 1 chr5A.!!$R1 2612
4 TraesCS6A01G381600 chrUn 33216735 33219332 2597 True 4329.0 4329 96.6770 1 2613 1 chrUn.!!$R1 2612
5 TraesCS6A01G381600 chrUn 221036438 221037219 781 False 379.0 645 88.8865 1 2360 2 chrUn.!!$F1 2359
6 TraesCS6A01G381600 chr5B 387889644 387891543 1899 True 3040.0 3040 95.4690 1 1914 1 chr5B.!!$R1 1913
7 TraesCS6A01G381600 chr5B 259727914 259728688 774 False 782.0 782 85.0190 661 1434 1 chr5B.!!$F1 773
8 TraesCS6A01G381600 chr3B 328598079 328599951 1872 False 1348.5 2586 94.0405 3 2613 2 chr3B.!!$F1 2610
9 TraesCS6A01G381600 chr2B 788440918 788441699 781 False 376.5 640 88.8115 1 2360 2 chr2B.!!$F1 2359
10 TraesCS6A01G381600 chr1A 373587096 373587845 749 True 373.0 638 88.1175 3 2360 2 chr1A.!!$R2 2357
11 TraesCS6A01G381600 chr5D 239195363 239195880 517 False 553.0 553 86.0850 1 531 1 chr5D.!!$F1 530
12 TraesCS6A01G381600 chr7B 704819986 704820575 589 False 538.0 538 84.0600 1792 2353 1 chr7B.!!$F1 561
13 TraesCS6A01G381600 chr1D 386406057 386406712 655 True 213.0 263 89.1775 1795 2202 2 chr1D.!!$R1 407

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
225 237 1.436336 CGGAGGTAGGCGTTCGATT 59.564 57.895 0.0 0.0 33.67 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1635 1701 0.392461 ACCAACAGTGCACAACGAGT 60.392 50.0 21.04 7.82 0.0 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
225 237 1.436336 CGGAGGTAGGCGTTCGATT 59.564 57.895 0.00 0.0 33.67 3.34
338 352 4.564782 TTTTCTGCAGATGAGATCCAGT 57.435 40.909 19.04 0.0 0.00 4.00
1103 1167 2.511600 GGAATCCGGTCAGTGGCG 60.512 66.667 0.00 0.0 0.00 5.69
1165 1229 2.954684 CGCCCAGCTCCCAGTTACA 61.955 63.158 0.00 0.0 0.00 2.41
1280 1344 1.883926 CCCCGTTCGTTGGATCTTTTT 59.116 47.619 0.00 0.0 0.00 1.94
1324 1388 0.953727 GTTTGCTGGCTGATGTCACA 59.046 50.000 0.00 0.0 0.00 3.58
1451 1517 6.183360 CGTTCATGCAATCTTAGTTGACTCAT 60.183 38.462 0.00 0.0 0.00 2.90
1635 1701 4.905269 CGAACATCGTGTCTGTAGTATCA 58.095 43.478 0.00 0.0 34.72 2.15
1639 1705 4.034163 ACATCGTGTCTGTAGTATCACTCG 59.966 45.833 0.00 0.0 0.00 4.18
1680 1749 4.517453 TGTTGTATTACTTCTGCGGCTTTT 59.483 37.500 0.00 0.0 0.00 2.27
1716 1785 9.757227 TTTAACAATGGATTTTTGTGTTAGGAG 57.243 29.630 0.00 0.0 37.38 3.69
2371 2985 1.202830 TGCAGGCCCTCGTTTCTTTTA 60.203 47.619 0.00 0.0 0.00 1.52
2376 2990 1.063616 GCCCTCGTTTCTTTTATCGGC 59.936 52.381 0.00 0.0 0.00 5.54
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
225 237 2.347114 CATCCACACGGACTGGCA 59.653 61.111 0.00 0.00 46.79 4.92
338 352 5.333798 GCTTACTGCTGTTTGTTTATCACGA 60.334 40.000 0.09 0.00 38.95 4.35
904 960 6.377429 ACTTGTAACTCATGTCGAGAAGGATA 59.623 38.462 0.00 0.00 45.45 2.59
1103 1167 5.362263 TCCGTAATCTGTACTTATTTGGCC 58.638 41.667 0.00 0.00 0.00 5.36
1165 1229 1.315257 GGATGTGGGAATTGCAGCGT 61.315 55.000 0.00 0.00 0.00 5.07
1324 1388 3.175710 ACCTGCCTTGGAACGGGT 61.176 61.111 0.00 0.00 40.84 5.28
1451 1517 6.538381 ACACACAACATAAATGATCTATCGCA 59.462 34.615 0.00 0.00 0.00 5.10
1635 1701 0.392461 ACCAACAGTGCACAACGAGT 60.392 50.000 21.04 7.82 0.00 4.18
1639 1705 3.708563 ACATAACCAACAGTGCACAAC 57.291 42.857 21.04 0.00 0.00 3.32
1716 1785 7.656948 AGAATATGAAAGCTAGTGAATCTCAGC 59.343 37.037 0.00 0.00 0.00 4.26
2346 2960 0.532862 AAACGAGGGCCTGCATATCG 60.533 55.000 12.95 10.37 39.22 2.92
2371 2985 9.598517 AATTTCATACAAACAAATATTGCCGAT 57.401 25.926 0.00 0.00 0.00 4.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.