Multiple sequence alignment - TraesCS6A01G376900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G376900 chr6A 100.000 2555 0 0 1 2555 598462147 598459593 0.000000e+00 4682.0
1 TraesCS6A01G376900 chr6A 98.669 2555 16 1 1 2555 598328045 598325509 0.000000e+00 4514.0
2 TraesCS6A01G376900 chr6A 98.435 2556 21 3 1 2555 598254761 598252224 0.000000e+00 4481.0
3 TraesCS6A01G376900 chr6A 99.105 1899 16 1 658 2555 598569209 598567311 0.000000e+00 3411.0
4 TraesCS6A01G376900 chr6A 99.464 1867 9 1 690 2555 598521389 598519523 0.000000e+00 3391.0
5 TraesCS6A01G376900 chr6A 99.419 1032 6 0 1524 2555 598386926 598385895 0.000000e+00 1873.0
6 TraesCS6A01G376900 chr6A 96.400 861 13 1 1 861 598387769 598386927 0.000000e+00 1404.0
7 TraesCS6A01G376900 chr6A 98.361 549 9 0 1 549 598571097 598570549 0.000000e+00 965.0
8 TraesCS6A01G376900 chr6A 86.486 888 58 20 1000 1861 598576284 598575433 0.000000e+00 918.0
9 TraesCS6A01G376900 chr6A 90.521 211 15 3 2215 2423 598574110 598573903 9.010000e-70 274.0
10 TraesCS6A01G376900 chr6A 84.615 130 15 3 661 790 598213186 598213062 9.600000e-25 124.0
11 TraesCS6A01G376900 chrUn 98.080 1354 8 1 1 1354 341386533 341387868 0.000000e+00 2340.0
12 TraesCS6A01G376900 chr6B 78.784 1414 207 54 1071 2430 687413529 687412155 0.000000e+00 863.0
13 TraesCS6A01G376900 chr6B 86.422 545 32 12 1078 1580 687367125 687366581 2.220000e-155 558.0
14 TraesCS6A01G376900 chr6B 81.027 448 37 16 1664 2089 687371913 687371492 1.910000e-81 313.0
15 TraesCS6A01G376900 chr6B 77.248 545 79 21 1285 1797 687108628 687109159 6.960000e-71 278.0
16 TraesCS6A01G376900 chr6B 79.553 313 33 10 1285 1580 687317799 687317501 7.210000e-46 195.0
17 TraesCS6A01G376900 chr6B 83.756 197 9 4 1916 2089 687366206 687366010 5.660000e-37 165.0
18 TraesCS6A01G376900 chr6B 91.304 115 10 0 1623 1737 687366388 687366274 9.460000e-35 158.0
19 TraesCS6A01G376900 chr6B 93.939 66 4 0 786 851 687318432 687318367 1.620000e-17 100.0
20 TraesCS6A01G376900 chr6D 78.252 1407 181 65 1071 2430 452709767 452708439 0.000000e+00 787.0
21 TraesCS6A01G376900 chr6D 83.884 484 44 14 1285 1735 452641702 452641220 5.050000e-117 431.0
22 TraesCS6A01G376900 chr6D 91.093 247 22 0 1623 1869 452641234 452640988 4.070000e-88 335.0
23 TraesCS6A01G376900 chr6D 96.552 58 2 0 794 851 452642177 452642120 2.090000e-16 97.1
24 TraesCS6A01G376900 chr6D 92.424 66 5 0 786 851 452593440 452593375 7.530000e-16 95.3
25 TraesCS6A01G376900 chr6D 85.567 97 6 3 2001 2089 452640039 452639943 7.530000e-16 95.3
26 TraesCS6A01G376900 chr2A 76.759 469 99 9 23 485 637700977 637700513 1.170000e-63 254.0
27 TraesCS6A01G376900 chr4D 70.884 498 127 16 69 555 447890544 447891034 1.620000e-17 100.0
28 TraesCS6A01G376900 chr4D 79.200 125 23 3 69 191 425101725 425101602 1.630000e-12 84.2
29 TraesCS6A01G376900 chr4D 79.200 125 23 3 69 191 494019475 494019598 1.630000e-12 84.2
30 TraesCS6A01G376900 chr2D 71.053 418 111 9 69 480 589755093 589755506 2.710000e-15 93.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G376900 chr6A 598459593 598462147 2554 True 4682.000000 4682 100.000000 1 2555 1 chr6A.!!$R4 2554
1 TraesCS6A01G376900 chr6A 598325509 598328045 2536 True 4514.000000 4514 98.669000 1 2555 1 chr6A.!!$R3 2554
2 TraesCS6A01G376900 chr6A 598252224 598254761 2537 True 4481.000000 4481 98.435000 1 2555 1 chr6A.!!$R2 2554
3 TraesCS6A01G376900 chr6A 598519523 598521389 1866 True 3391.000000 3391 99.464000 690 2555 1 chr6A.!!$R5 1865
4 TraesCS6A01G376900 chr6A 598385895 598387769 1874 True 1638.500000 1873 97.909500 1 2555 2 chr6A.!!$R6 2554
5 TraesCS6A01G376900 chr6A 598567311 598576284 8973 True 1392.000000 3411 93.618250 1 2555 4 chr6A.!!$R7 2554
6 TraesCS6A01G376900 chrUn 341386533 341387868 1335 False 2340.000000 2340 98.080000 1 1354 1 chrUn.!!$F1 1353
7 TraesCS6A01G376900 chr6B 687412155 687413529 1374 True 863.000000 863 78.784000 1071 2430 1 chr6B.!!$R2 1359
8 TraesCS6A01G376900 chr6B 687366010 687367125 1115 True 293.666667 558 87.160667 1078 2089 3 chr6B.!!$R4 1011
9 TraesCS6A01G376900 chr6B 687108628 687109159 531 False 278.000000 278 77.248000 1285 1797 1 chr6B.!!$F1 512
10 TraesCS6A01G376900 chr6D 452708439 452709767 1328 True 787.000000 787 78.252000 1071 2430 1 chr6D.!!$R2 1359
11 TraesCS6A01G376900 chr6D 452639943 452642177 2234 True 239.600000 431 89.274000 794 2089 4 chr6D.!!$R3 1295

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
211 5399 6.013466 AGGCAAATAACCATTTTCAGGACATT 60.013 34.615 0.0 0.0 31.82 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1635 8326 6.317893 TCCCAACTTTCTCAACAGTACTTTTC 59.682 38.462 0.0 0.0 0.0 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
38 5226 6.441093 TCTTCATTATGTCAAATGCACTCC 57.559 37.500 0.0 0.0 36.89 3.85
202 5390 8.620416 GTCTTCAAAAAGGCAAATAACCATTTT 58.380 29.630 0.0 0.0 38.30 1.82
211 5399 6.013466 AGGCAAATAACCATTTTCAGGACATT 60.013 34.615 0.0 0.0 31.82 2.71
1635 8326 4.395542 AGCAGAGTACACCGAACTACTAAG 59.604 45.833 0.0 0.0 0.00 2.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
202 5390 2.655090 TGCTTCCACAAATGTCCTGA 57.345 45.000 0.0 0.0 0.00 3.86
211 5399 4.009675 AGAGCGATATTTTGCTTCCACAA 58.990 39.130 0.0 0.0 42.94 3.33
595 5786 1.002502 GGTGTGCTGACTAACCCCC 60.003 63.158 0.0 0.0 0.00 5.40
596 5787 0.605589 GTGGTGTGCTGACTAACCCC 60.606 60.000 0.0 0.0 31.30 4.95
597 5788 0.605589 GGTGGTGTGCTGACTAACCC 60.606 60.000 0.0 0.0 31.30 4.11
598 5789 0.107831 TGGTGGTGTGCTGACTAACC 59.892 55.000 0.0 0.0 0.00 2.85
740 7159 2.494059 GCACAAGTTAGCCAAGTCTGA 58.506 47.619 0.0 0.0 0.00 3.27
1635 8326 6.317893 TCCCAACTTTCTCAACAGTACTTTTC 59.682 38.462 0.0 0.0 0.00 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.