Multiple sequence alignment - TraesCS6A01G376800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G376800 chr6A 100.000 2555 0 0 1 2555 598328063 598325509 0.000000e+00 4719.0
1 TraesCS6A01G376800 chr6A 98.906 2559 21 3 1 2555 598254779 598252224 0.000000e+00 4564.0
2 TraesCS6A01G376800 chr6A 98.679 2573 16 1 1 2555 598462165 598459593 0.000000e+00 4547.0
3 TraesCS6A01G376800 chr6A 98.894 1899 20 1 658 2555 598569209 598567311 0.000000e+00 3389.0
4 TraesCS6A01G376800 chr6A 99.250 1867 13 1 690 2555 598521389 598519523 0.000000e+00 3369.0
5 TraesCS6A01G376800 chr6A 99.031 1032 10 0 1524 2555 598386926 598385895 0.000000e+00 1851.0
6 TraesCS6A01G376800 chr6A 98.955 861 9 0 1 861 598387787 598386927 0.000000e+00 1541.0
7 TraesCS6A01G376800 chr6A 98.942 567 6 0 1 567 598571115 598570549 0.000000e+00 1014.0
8 TraesCS6A01G376800 chr6A 86.599 888 57 20 1000 1861 598576284 598575433 0.000000e+00 924.0
9 TraesCS6A01G376800 chr6A 90.521 211 15 3 2215 2423 598574110 598573903 9.010000e-70 274.0
10 TraesCS6A01G376800 chr6A 84.615 130 15 3 661 790 598213186 598213062 9.600000e-25 124.0
11 TraesCS6A01G376800 chrUn 100.000 1354 0 0 1 1354 341386515 341387868 0.000000e+00 2501.0
12 TraesCS6A01G376800 chr6B 78.925 1414 205 55 1071 2430 687413529 687412155 0.000000e+00 874.0
13 TraesCS6A01G376800 chr6B 82.282 745 65 24 896 1580 687367318 687366581 1.320000e-162 582.0
14 TraesCS6A01G376800 chr6B 80.804 448 38 16 1664 2089 687371913 687371492 8.880000e-80 307.0
15 TraesCS6A01G376800 chr6B 77.106 546 78 21 1285 1797 687108628 687109159 3.240000e-69 272.0
16 TraesCS6A01G376800 chr6B 79.553 313 33 10 1285 1580 687317799 687317501 7.210000e-46 195.0
17 TraesCS6A01G376800 chr6B 83.249 197 10 4 1916 2089 687366206 687366010 2.630000e-35 159.0
18 TraesCS6A01G376800 chr6B 91.304 115 10 0 1623 1737 687366388 687366274 9.460000e-35 158.0
19 TraesCS6A01G376800 chr6B 93.939 66 4 0 786 851 687318432 687318367 1.620000e-17 100.0
20 TraesCS6A01G376800 chr6D 78.252 1407 181 64 1071 2430 452709767 452708439 0.000000e+00 787.0
21 TraesCS6A01G376800 chr6D 84.298 484 42 14 1285 1735 452641702 452641220 2.330000e-120 442.0
22 TraesCS6A01G376800 chr6D 91.093 247 22 0 1623 1869 452641234 452640988 4.070000e-88 335.0
23 TraesCS6A01G376800 chr6D 96.552 58 2 0 794 851 452642177 452642120 2.090000e-16 97.1
24 TraesCS6A01G376800 chr6D 92.424 66 5 0 786 851 452593440 452593375 7.530000e-16 95.3
25 TraesCS6A01G376800 chr6D 84.536 97 7 3 2001 2089 452640039 452639943 3.500000e-14 89.8
26 TraesCS6A01G376800 chr2A 77.137 468 99 7 41 503 637700977 637700513 5.420000e-67 265.0
27 TraesCS6A01G376800 chr7D 71.313 495 129 12 87 573 509245638 509245149 5.780000e-22 115.0
28 TraesCS6A01G376800 chr3D 71.111 495 127 15 87 573 110269685 110270171 9.670000e-20 108.0
29 TraesCS6A01G376800 chr2D 71.531 418 109 9 87 498 589755093 589755506 1.250000e-18 104.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G376800 chr6A 598325509 598328063 2554 True 4719.000000 4719 100.000000 1 2555 1 chr6A.!!$R3 2554
1 TraesCS6A01G376800 chr6A 598252224 598254779 2555 True 4564.000000 4564 98.906000 1 2555 1 chr6A.!!$R2 2554
2 TraesCS6A01G376800 chr6A 598459593 598462165 2572 True 4547.000000 4547 98.679000 1 2555 1 chr6A.!!$R4 2554
3 TraesCS6A01G376800 chr6A 598519523 598521389 1866 True 3369.000000 3369 99.250000 690 2555 1 chr6A.!!$R5 1865
4 TraesCS6A01G376800 chr6A 598385895 598387787 1892 True 1696.000000 1851 98.993000 1 2555 2 chr6A.!!$R6 2554
5 TraesCS6A01G376800 chr6A 598567311 598576284 8973 True 1400.250000 3389 93.739000 1 2555 4 chr6A.!!$R7 2554
6 TraesCS6A01G376800 chrUn 341386515 341387868 1353 False 2501.000000 2501 100.000000 1 1354 1 chrUn.!!$F1 1353
7 TraesCS6A01G376800 chr6B 687412155 687413529 1374 True 874.000000 874 78.925000 1071 2430 1 chr6B.!!$R2 1359
8 TraesCS6A01G376800 chr6B 687366010 687367318 1308 True 299.666667 582 85.611667 896 2089 3 chr6B.!!$R4 1193
9 TraesCS6A01G376800 chr6B 687108628 687109159 531 False 272.000000 272 77.106000 1285 1797 1 chr6B.!!$F1 512
10 TraesCS6A01G376800 chr6D 452708439 452709767 1328 True 787.000000 787 78.252000 1071 2430 1 chr6D.!!$R2 1359
11 TraesCS6A01G376800 chr6D 452639943 452642177 2234 True 240.975000 442 89.119750 794 2089 4 chr6D.!!$R3 1295

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
861 7280 8.147058 CCTTTCATATGCTACAAGATACTGACT 58.853 37.037 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2439 10082 3.774066 TCTAGACTGCGATGACATGTTG 58.226 45.455 0.0 0.0 0.0 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
861 7280 8.147058 CCTTTCATATGCTACAAGATACTGACT 58.853 37.037 0.0 0.0 0.00 3.41
862 7281 9.190858 CTTTCATATGCTACAAGATACTGACTC 57.809 37.037 0.0 0.0 0.00 3.36
2021 9646 1.024046 ATGCCGTGCGATAGTTTGCA 61.024 50.000 0.0 0.0 40.04 4.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
861 7280 8.180165 AGTATCTTGTAGGATATGAATGGAGGA 58.820 37.037 0.0 0.0 31.89 3.71
862 7281 8.256605 CAGTATCTTGTAGGATATGAATGGAGG 58.743 40.741 0.0 0.0 31.89 4.30
1643 8348 4.398044 GTGAAGTCCCAACTTTCTCAACAA 59.602 41.667 0.0 0.0 45.80 2.83
2021 9646 8.139989 GCTAAAATGGATCAGCACAGAAAATAT 58.860 33.333 0.0 0.0 34.13 1.28
2439 10082 3.774066 TCTAGACTGCGATGACATGTTG 58.226 45.455 0.0 0.0 0.00 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.