Multiple sequence alignment - TraesCS6A01G361400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G361400 chr6A 100.000 2663 0 0 1 2663 591843360 591840698 0 4918
1 TraesCS6A01G361400 chr6A 99.061 2663 24 1 1 2663 12690992 12693653 0 4778
2 TraesCS6A01G361400 chr7A 98.986 2663 26 1 1 2663 624756692 624759353 0 4767
3 TraesCS6A01G361400 chr7A 98.425 2667 34 6 1 2663 634132807 634130145 0 4686
4 TraesCS6A01G361400 chr6B 98.836 2664 28 3 1 2663 21362097 21364758 0 4745
5 TraesCS6A01G361400 chr1B 98.722 2660 30 4 4 2663 637616823 637614168 0 4721
6 TraesCS6A01G361400 chr2B 98.611 2663 36 1 1 2663 608457624 608460285 0 4711
7 TraesCS6A01G361400 chr2B 98.162 2666 43 6 1 2663 741912320 741909658 0 4647
8 TraesCS6A01G361400 chr2A 98.462 2666 37 4 1 2663 389206954 389209618 0 4693
9 TraesCS6A01G361400 chr7B 98.461 2664 39 2 1 2663 194130141 194127479 0 4691


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G361400 chr6A 591840698 591843360 2662 True 4918 4918 100.000 1 2663 1 chr6A.!!$R1 2662
1 TraesCS6A01G361400 chr6A 12690992 12693653 2661 False 4778 4778 99.061 1 2663 1 chr6A.!!$F1 2662
2 TraesCS6A01G361400 chr7A 624756692 624759353 2661 False 4767 4767 98.986 1 2663 1 chr7A.!!$F1 2662
3 TraesCS6A01G361400 chr7A 634130145 634132807 2662 True 4686 4686 98.425 1 2663 1 chr7A.!!$R1 2662
4 TraesCS6A01G361400 chr6B 21362097 21364758 2661 False 4745 4745 98.836 1 2663 1 chr6B.!!$F1 2662
5 TraesCS6A01G361400 chr1B 637614168 637616823 2655 True 4721 4721 98.722 4 2663 1 chr1B.!!$R1 2659
6 TraesCS6A01G361400 chr2B 608457624 608460285 2661 False 4711 4711 98.611 1 2663 1 chr2B.!!$F1 2662
7 TraesCS6A01G361400 chr2B 741909658 741912320 2662 True 4647 4647 98.162 1 2663 1 chr2B.!!$R1 2662
8 TraesCS6A01G361400 chr2A 389206954 389209618 2664 False 4693 4693 98.462 1 2663 1 chr2A.!!$F1 2662
9 TraesCS6A01G361400 chr7B 194127479 194130141 2662 True 4691 4691 98.461 1 2663 1 chr7B.!!$R1 2662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
665 667 1.194547 CGCTGTGTTAGTTCACGCATT 59.805 47.619 0.0 0.0 40.74 3.56 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2158 2171 2.317609 CGCACTGCTTAACGCCACT 61.318 57.895 0.0 0.0 38.05 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 2.104622 TGATGTGTTTGAGCTCAGACCA 59.895 45.455 28.79 25.04 30.73 4.02
348 349 2.119671 CAAAGTTTGCGAGTGGTTCC 57.880 50.000 1.96 0.00 0.00 3.62
546 548 2.280308 ATTACCTGCCCCAACTCCTA 57.720 50.000 0.00 0.00 0.00 2.94
665 667 1.194547 CGCTGTGTTAGTTCACGCATT 59.805 47.619 0.00 0.00 40.74 3.56
796 798 1.452651 CGCATGCTCCTCCCAATGT 60.453 57.895 17.13 0.00 0.00 2.71
912 914 4.047834 TGCTCAGTTGCACCGAAG 57.952 55.556 0.00 0.00 38.12 3.79
953 956 6.380995 CATGCTGTGTTAGTTTGAGCATAAA 58.619 36.000 0.00 0.00 46.19 1.40
1573 1582 4.173971 GACGGTACAAATCGGCGT 57.826 55.556 6.85 0.00 0.00 5.68
2158 2171 1.985159 AGTTGGCTACCATTCCACTCA 59.015 47.619 0.00 0.00 31.53 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 3.810310 TTCGCAACAAATTCCTGGTTT 57.190 38.095 0.00 0.00 0.00 3.27
436 438 4.680237 CCCCGTTGCAGCAGTCGA 62.680 66.667 19.16 0.00 0.00 4.20
546 548 8.191534 ACTGAAGTTACACACCTAGTTAGATT 57.808 34.615 0.00 0.00 0.00 2.40
796 798 1.229177 TGAGTGCTGCCTGTAGGGA 60.229 57.895 0.00 0.00 37.23 4.20
912 914 0.105039 ATGCGCAACTAGGTAGCCTC 59.895 55.000 17.11 0.00 34.61 4.70
1338 1347 5.392767 TTTTTGTGCAACTAACTGGTTGA 57.607 34.783 9.84 0.00 46.55 3.18
1573 1582 2.708861 TCTTCTTTGGGTGTAGCTCCAA 59.291 45.455 0.56 0.56 40.85 3.53
2158 2171 2.317609 CGCACTGCTTAACGCCACT 61.318 57.895 0.00 0.00 38.05 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.