Multiple sequence alignment - TraesCS6A01G358900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G358900 chr6A 100.000 2711 0 0 1 2711 589193314 589190604 0.000000e+00 5007
1 TraesCS6A01G358900 chr6A 96.664 2728 72 5 1 2711 589174350 589177075 0.000000e+00 4516
2 TraesCS6A01G358900 chr6A 86.228 334 34 8 2381 2711 589089490 589089814 4.290000e-93 351
3 TraesCS6A01G358900 chr6A 85.629 334 36 8 2381 2711 589130604 589130928 9.300000e-90 340
4 TraesCS6A01G358900 chr6D 92.593 2700 150 18 52 2711 441396753 441399442 0.000000e+00 3832
5 TraesCS6A01G358900 chr6D 91.648 2275 167 9 1 2259 441315869 441318136 0.000000e+00 3127
6 TraesCS6A01G358900 chr6D 92.366 1978 120 15 1 1954 441290380 441292350 0.000000e+00 2787
7 TraesCS6A01G358900 chr6D 85.723 1653 135 46 1111 2711 441100601 441102204 0.000000e+00 1652
8 TraesCS6A01G358900 chr6D 95.170 559 23 4 2003 2558 441292348 441292905 0.000000e+00 880
9 TraesCS6A01G358900 chr6D 94.064 438 23 3 2275 2711 441325679 441326114 0.000000e+00 662
10 TraesCS6A01G358900 chr6D 94.400 250 11 2 866 1115 441098632 441098878 5.480000e-102 381
11 TraesCS6A01G358900 chr6D 88.430 121 13 1 1 121 441098517 441098636 7.820000e-31 145
12 TraesCS6A01G358900 chr6B 87.065 2412 255 31 15 2377 666219090 666221493 0.000000e+00 2673
13 TraesCS6A01G358900 chr6B 86.351 2176 232 35 15 2143 666274187 666276344 0.000000e+00 2313
14 TraesCS6A01G358900 chr6B 86.351 2176 232 31 15 2143 666306312 666308469 0.000000e+00 2313
15 TraesCS6A01G358900 chr6B 87.356 1558 159 15 855 2377 666176384 666177938 0.000000e+00 1751
16 TraesCS6A01G358900 chr6B 84.856 1149 122 25 1101 2232 666092776 666093889 0.000000e+00 1110
17 TraesCS6A01G358900 chr6B 87.613 775 81 11 1941 2711 666276355 666277118 0.000000e+00 885
18 TraesCS6A01G358900 chr6B 87.613 775 81 11 1941 2711 666308480 666309243 0.000000e+00 885
19 TraesCS6A01G358900 chr6B 83.947 679 94 13 264 933 666051199 666051871 1.060000e-178 636
20 TraesCS6A01G358900 chrUn 86.391 1161 120 22 1007 2143 349101524 349100378 0.000000e+00 1234
21 TraesCS6A01G358900 chrUn 87.613 775 81 11 1941 2711 349100367 349099604 0.000000e+00 885


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G358900 chr6A 589190604 589193314 2710 True 5007.0 5007 100.000000 1 2711 1 chr6A.!!$R1 2710
1 TraesCS6A01G358900 chr6A 589174350 589177075 2725 False 4516.0 4516 96.664000 1 2711 1 chr6A.!!$F3 2710
2 TraesCS6A01G358900 chr6D 441396753 441399442 2689 False 3832.0 3832 92.593000 52 2711 1 chr6D.!!$F3 2659
3 TraesCS6A01G358900 chr6D 441315869 441318136 2267 False 3127.0 3127 91.648000 1 2259 1 chr6D.!!$F1 2258
4 TraesCS6A01G358900 chr6D 441290380 441292905 2525 False 1833.5 2787 93.768000 1 2558 2 chr6D.!!$F5 2557
5 TraesCS6A01G358900 chr6D 441098517 441102204 3687 False 726.0 1652 89.517667 1 2711 3 chr6D.!!$F4 2710
6 TraesCS6A01G358900 chr6B 666219090 666221493 2403 False 2673.0 2673 87.065000 15 2377 1 chr6B.!!$F4 2362
7 TraesCS6A01G358900 chr6B 666176384 666177938 1554 False 1751.0 1751 87.356000 855 2377 1 chr6B.!!$F3 1522
8 TraesCS6A01G358900 chr6B 666274187 666277118 2931 False 1599.0 2313 86.982000 15 2711 2 chr6B.!!$F5 2696
9 TraesCS6A01G358900 chr6B 666306312 666309243 2931 False 1599.0 2313 86.982000 15 2711 2 chr6B.!!$F6 2696
10 TraesCS6A01G358900 chr6B 666092776 666093889 1113 False 1110.0 1110 84.856000 1101 2232 1 chr6B.!!$F2 1131
11 TraesCS6A01G358900 chr6B 666051199 666051871 672 False 636.0 636 83.947000 264 933 1 chr6B.!!$F1 669
12 TraesCS6A01G358900 chrUn 349099604 349101524 1920 True 1059.5 1234 87.002000 1007 2711 2 chrUn.!!$R1 1704

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
166 183 1.473278 ACGGCGTTTCTTGTTTGGAAA 59.527 42.857 6.77 0.0 0.0 3.13 F
1282 3074 1.913951 ATTCCTCACCCAGCGCATCA 61.914 55.000 11.47 0.0 0.0 3.07 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1414 3206 1.002134 CGTCCACCTTCCAGCCAAT 60.002 57.895 0.0 0.0 0.0 3.16 R
2397 4468 0.179034 GCATGGGAAGCAGAGGGTAG 60.179 60.000 0.0 0.0 0.0 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
150 164 1.949257 CTGGTGAAGGAAACACGGC 59.051 57.895 0.00 0.00 38.90 5.68
166 183 1.473278 ACGGCGTTTCTTGTTTGGAAA 59.527 42.857 6.77 0.00 0.00 3.13
1282 3074 1.913951 ATTCCTCACCCAGCGCATCA 61.914 55.000 11.47 0.00 0.00 3.07
1396 3188 2.659610 GCCTCGTTGACCTCAGCT 59.340 61.111 0.00 0.00 0.00 4.24
1616 3409 4.742201 CGTCGGCACCCAGGTCTG 62.742 72.222 0.00 0.00 0.00 3.51
1654 3462 1.134521 ACAACGGCGGTGATATGATGT 60.135 47.619 34.02 2.60 0.00 3.06
2043 4108 8.896744 GCCTGATATATAATTGCTGCTTGATTA 58.103 33.333 0.00 3.95 0.00 1.75
2130 4196 8.658609 CCTTTAATTTCATGCTATTTTGGTGTG 58.341 33.333 0.00 0.00 0.00 3.82
2333 4404 0.036010 GCTCTGCTTGGTTGGAGCTA 60.036 55.000 6.55 0.00 45.15 3.32
2394 4465 2.607811 CTGGCCCACAGGAGTATCA 58.392 57.895 0.00 0.00 43.70 2.15
2397 4468 0.466124 GGCCCACAGGAGTATCACTC 59.534 60.000 0.00 0.00 44.32 3.51
2398 4469 1.490574 GCCCACAGGAGTATCACTCT 58.509 55.000 6.30 0.00 44.46 3.24
2428 4500 1.228063 CCCATGCCCTCGATCTTGG 60.228 63.158 0.00 0.00 0.00 3.61
2512 4585 6.558771 TCCATGTTGTGTTGACTATTCTTG 57.441 37.500 0.00 0.00 0.00 3.02
2554 4627 2.430465 AGCTGCAACAAGTGACCTATG 58.570 47.619 1.02 0.00 0.00 2.23
2604 4678 9.918630 ACAAATTCCATGCTATGATAATAAAGC 57.081 29.630 0.00 0.00 35.51 3.51
2662 4736 0.874390 TTAGCTTGGCAACGAAGCAG 59.126 50.000 15.21 0.00 46.46 4.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
150 164 4.102649 GACCACTTTCCAAACAAGAAACG 58.897 43.478 0.00 0.00 0.00 3.60
166 183 4.265856 TGTAGGAGACCATATGACCACT 57.734 45.455 3.65 0.00 0.00 4.00
1282 3074 3.322466 CTGGTCCCGGAGCTTGGT 61.322 66.667 17.39 0.00 0.00 3.67
1414 3206 1.002134 CGTCCACCTTCCAGCCAAT 60.002 57.895 0.00 0.00 0.00 3.16
1449 3241 3.565910 TTTTGCCATGCGTTCGCCC 62.566 57.895 14.44 1.76 0.00 6.13
1636 3429 1.939934 CAACATCATATCACCGCCGTT 59.060 47.619 0.00 0.00 0.00 4.44
1982 4044 5.682862 GCAAGTAATGTCAGACAAAACACAG 59.317 40.000 7.50 4.48 0.00 3.66
2043 4108 1.140312 TTCTTTGAGGCCCTGACAGT 58.860 50.000 0.00 0.00 0.00 3.55
2130 4196 9.498176 TCTACCACAGAAAAGGTAAAATTCTAC 57.502 33.333 0.00 0.00 39.72 2.59
2391 4462 2.393646 GGAAGCAGAGGGTAGAGTGAT 58.606 52.381 0.00 0.00 0.00 3.06
2394 4465 0.413832 TGGGAAGCAGAGGGTAGAGT 59.586 55.000 0.00 0.00 0.00 3.24
2397 4468 0.179034 GCATGGGAAGCAGAGGGTAG 60.179 60.000 0.00 0.00 0.00 3.18
2398 4469 1.635817 GGCATGGGAAGCAGAGGGTA 61.636 60.000 0.00 0.00 0.00 3.69
2428 4500 0.243095 GTCAGTGGGGTGACGTAGAC 59.757 60.000 0.00 0.00 37.69 2.59
2512 4585 3.770666 TGTAGAGTTCATCGCTAGCAAC 58.229 45.455 16.45 11.35 0.00 4.17
2554 4627 8.139989 TGTAGGAACGCTATAATTTAAGTCCTC 58.860 37.037 0.00 0.00 0.00 3.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.