Multiple sequence alignment - TraesCS6A01G336400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G336400 chr6A 100.000 3084 0 0 1 3084 570352693 570355776 0 5696
1 TraesCS6A01G336400 chr6A 97.715 3107 41 10 1 3083 584409910 584413010 0 5317
2 TraesCS6A01G336400 chr6A 99.357 1245 8 0 1 1245 570360970 570362214 0 2255
3 TraesCS6A01G336400 chr1B 99.222 3084 23 1 1 3083 610379018 610382101 0 5561
4 TraesCS6A01G336400 chr4A 99.125 3084 26 1 1 3083 739024063 739020980 0 5544
5 TraesCS6A01G336400 chr4A 98.962 3084 30 2 1 3083 611654844 611657926 0 5517
6 TraesCS6A01G336400 chr4A 99.437 1243 7 0 1 1243 739015783 739014541 0 2257
7 TraesCS6A01G336400 chr4A 99.196 1244 10 0 1 1244 611663124 611664367 0 2242
8 TraesCS6A01G336400 chr7B 98.037 3107 35 10 1 3083 535641698 535644802 0 5376
9 TraesCS6A01G336400 chr6B 92.414 3124 149 30 1 3083 47738042 47734966 0 4375
10 TraesCS6A01G336400 chr6B 92.072 3128 154 31 1 3083 47658993 47655915 0 4316
11 TraesCS6A01G336400 chr6B 91.645 3124 151 37 1 3083 47698930 47695876 0 4222
12 TraesCS6A01G336400 chr2B 99.083 2290 20 1 795 3083 626032645 626034934 0 4111
13 TraesCS6A01G336400 chr2B 99.598 1244 4 1 1 1244 626040131 626041373 0 2268


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G336400 chr6A 570352693 570355776 3083 False 5696 5696 100.000 1 3084 1 chr6A.!!$F1 3083
1 TraesCS6A01G336400 chr6A 584409910 584413010 3100 False 5317 5317 97.715 1 3083 1 chr6A.!!$F3 3082
2 TraesCS6A01G336400 chr6A 570360970 570362214 1244 False 2255 2255 99.357 1 1245 1 chr6A.!!$F2 1244
3 TraesCS6A01G336400 chr1B 610379018 610382101 3083 False 5561 5561 99.222 1 3083 1 chr1B.!!$F1 3082
4 TraesCS6A01G336400 chr4A 739020980 739024063 3083 True 5544 5544 99.125 1 3083 1 chr4A.!!$R2 3082
5 TraesCS6A01G336400 chr4A 611654844 611657926 3082 False 5517 5517 98.962 1 3083 1 chr4A.!!$F1 3082
6 TraesCS6A01G336400 chr4A 739014541 739015783 1242 True 2257 2257 99.437 1 1243 1 chr4A.!!$R1 1242
7 TraesCS6A01G336400 chr4A 611663124 611664367 1243 False 2242 2242 99.196 1 1244 1 chr4A.!!$F2 1243
8 TraesCS6A01G336400 chr7B 535641698 535644802 3104 False 5376 5376 98.037 1 3083 1 chr7B.!!$F1 3082
9 TraesCS6A01G336400 chr6B 47734966 47738042 3076 True 4375 4375 92.414 1 3083 1 chr6B.!!$R3 3082
10 TraesCS6A01G336400 chr6B 47655915 47658993 3078 True 4316 4316 92.072 1 3083 1 chr6B.!!$R1 3082
11 TraesCS6A01G336400 chr6B 47695876 47698930 3054 True 4222 4222 91.645 1 3083 1 chr6B.!!$R2 3082
12 TraesCS6A01G336400 chr2B 626032645 626034934 2289 False 4111 4111 99.083 795 3083 1 chr2B.!!$F1 2288
13 TraesCS6A01G336400 chr2B 626040131 626041373 1242 False 2268 2268 99.598 1 1244 1 chr2B.!!$F2 1243

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1014 1019 8.423906 AAGTCAGTGAAGAATAAGAGGAAGTA 57.576 34.615 0.0 0.0 0.0 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2379 2434 1.972872 ACCAGCTGTTCTTGTGAAGG 58.027 50.0 13.81 0.0 32.15 3.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1014 1019 8.423906 AAGTCAGTGAAGAATAAGAGGAAGTA 57.576 34.615 0.00 0.0 0.00 2.24
1245 1250 1.888215 ACCTTCGAGTCGTGACAGTA 58.112 50.000 13.12 0.0 0.00 2.74
1246 1251 2.224606 ACCTTCGAGTCGTGACAGTAA 58.775 47.619 13.12 0.0 0.00 2.24
2379 2434 5.945155 TGTTTGTTTTGCCGATTACTATCC 58.055 37.500 0.00 0.0 0.00 2.59
2878 2953 8.239038 TGGAAATAATTCGGGCAATACAAATA 57.761 30.769 0.00 0.0 36.36 1.40
2952 3027 4.406456 TCACTAACATTTTGGGCAGACAT 58.594 39.130 0.00 0.0 0.00 3.06
3083 3158 1.936547 GACTGCTAATCCGCTTGAAGG 59.063 52.381 0.00 0.0 0.00 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1233 1238 2.823747 TGCCACTATTACTGTCACGACT 59.176 45.455 0.00 0.00 0.00 4.18
1665 1720 3.693807 TCATAGTACACGTGAGGAACCT 58.306 45.455 25.01 10.11 0.00 3.50
1707 1762 4.399395 CTGCCTGCTCCGCCTCAA 62.399 66.667 0.00 0.00 0.00 3.02
2379 2434 1.972872 ACCAGCTGTTCTTGTGAAGG 58.027 50.000 13.81 0.00 32.15 3.46
2878 2953 5.520748 AGTTCTTGGACCAATAATCCAGT 57.479 39.130 7.54 0.00 46.85 4.00
2952 3027 3.793797 TGACGTTGTTGAGTCTCTTGA 57.206 42.857 0.65 0.00 38.16 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.