Multiple sequence alignment - TraesCS6A01G328000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G328000 chr6A 100.000 3054 0 0 1 3054 561448727 561451780 0.000000e+00 5640
1 TraesCS6A01G328000 chr6A 97.971 3055 60 2 1 3054 561605167 561602114 0.000000e+00 5297
2 TraesCS6A01G328000 chr6A 99.319 2496 17 0 559 3054 561591353 561588858 0.000000e+00 4516
3 TraesCS6A01G328000 chr2D 94.402 2983 112 19 100 3054 564467534 564470489 0.000000e+00 4532
4 TraesCS6A01G328000 chr2D 91.230 1813 132 14 100 1895 556220801 556222603 0.000000e+00 2442
5 TraesCS6A01G328000 chr2D 91.279 516 21 1 1895 2386 556223391 556223906 0.000000e+00 682
6 TraesCS6A01G328000 chr3D 94.828 1740 77 7 965 2699 482837248 482835517 0.000000e+00 2702
7 TraesCS6A01G328000 chr3D 93.525 834 40 3 100 931 482838072 482837251 0.000000e+00 1229
8 TraesCS6A01G328000 chr3D 91.429 105 6 3 2375 2477 135533997 135534100 1.140000e-29 141
9 TraesCS6A01G328000 chr4A 93.137 1763 86 5 963 2699 30775799 30777552 0.000000e+00 2553
10 TraesCS6A01G328000 chr4A 90.264 832 60 2 100 931 30774988 30775798 0.000000e+00 1068
11 TraesCS6A01G328000 chr2A 90.571 1803 149 13 100 1895 695816590 695818378 0.000000e+00 2368
12 TraesCS6A01G328000 chr2A 90.171 1577 127 15 100 1660 695973989 695975553 0.000000e+00 2028
13 TraesCS6A01G328000 chr2A 91.279 516 21 1 1895 2386 695977128 695977643 0.000000e+00 682
14 TraesCS6A01G328000 chr2A 90.891 516 23 1 1895 2386 695819148 695819663 0.000000e+00 671
15 TraesCS6A01G328000 chr2A 83.471 242 23 4 1654 1895 695976132 695976356 3.090000e-50 209
16 TraesCS6A01G328000 chr2A 91.919 99 6 2 2 99 16228071 16227974 1.480000e-28 137
17 TraesCS6A01G328000 chr2A 91.919 99 7 1 2379 2476 407739177 407739275 1.480000e-28 137
18 TraesCS6A01G328000 chr2B 90.247 1825 153 15 102 1915 663336556 663334746 0.000000e+00 2361
19 TraesCS6A01G328000 chr2B 91.176 1700 110 8 243 1936 601729757 601731422 0.000000e+00 2272
20 TraesCS6A01G328000 chr2B 96.113 849 29 1 2080 2924 601732563 601733411 0.000000e+00 1382
21 TraesCS6A01G328000 chr2B 88.178 516 23 5 1895 2386 663333944 663333443 5.680000e-162 580
22 TraesCS6A01G328000 chr2B 95.918 147 6 0 2908 3054 601733533 601733679 3.940000e-59 239
23 TraesCS6A01G328000 chr2B 93.333 150 10 0 100 249 601720973 601721122 3.960000e-54 222
24 TraesCS6A01G328000 chr2B 95.604 91 4 0 2961 3051 675713750 675713840 2.450000e-31 147
25 TraesCS6A01G328000 chr4B 88.042 669 61 10 2211 2862 22448065 22447399 0.000000e+00 774
26 TraesCS6A01G328000 chr4B 98.795 83 1 0 2972 3054 22447592 22447510 6.820000e-32 148
27 TraesCS6A01G328000 chr6D 94.175 103 5 1 1 102 322588929 322588827 4.080000e-34 156
28 TraesCS6A01G328000 chr6B 95.876 97 3 1 1 96 500892106 500892202 4.080000e-34 156
29 TraesCS6A01G328000 chr5B 93.000 100 6 1 1 99 550223216 550223315 8.830000e-31 145
30 TraesCS6A01G328000 chr5B 91.176 102 8 1 1 101 92194094 92193993 1.480000e-28 137
31 TraesCS6A01G328000 chr1B 91.000 100 8 1 1 99 53247069 53247168 1.910000e-27 134
32 TraesCS6A01G328000 chr5D 89.000 100 10 1 1 99 365093352 365093253 4.140000e-24 122
33 TraesCS6A01G328000 chrUn 85.714 105 12 3 1 103 119256026 119255923 1.160000e-19 108


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G328000 chr6A 561448727 561451780 3053 False 5640.000000 5640 100.000000 1 3054 1 chr6A.!!$F1 3053
1 TraesCS6A01G328000 chr6A 561602114 561605167 3053 True 5297.000000 5297 97.971000 1 3054 1 chr6A.!!$R2 3053
2 TraesCS6A01G328000 chr6A 561588858 561591353 2495 True 4516.000000 4516 99.319000 559 3054 1 chr6A.!!$R1 2495
3 TraesCS6A01G328000 chr2D 564467534 564470489 2955 False 4532.000000 4532 94.402000 100 3054 1 chr2D.!!$F1 2954
4 TraesCS6A01G328000 chr2D 556220801 556223906 3105 False 1562.000000 2442 91.254500 100 2386 2 chr2D.!!$F2 2286
5 TraesCS6A01G328000 chr3D 482835517 482838072 2555 True 1965.500000 2702 94.176500 100 2699 2 chr3D.!!$R1 2599
6 TraesCS6A01G328000 chr4A 30774988 30777552 2564 False 1810.500000 2553 91.700500 100 2699 2 chr4A.!!$F1 2599
7 TraesCS6A01G328000 chr2A 695816590 695819663 3073 False 1519.500000 2368 90.731000 100 2386 2 chr2A.!!$F2 2286
8 TraesCS6A01G328000 chr2A 695973989 695977643 3654 False 973.000000 2028 88.307000 100 2386 3 chr2A.!!$F3 2286
9 TraesCS6A01G328000 chr2B 663333443 663336556 3113 True 1470.500000 2361 89.212500 102 2386 2 chr2B.!!$R1 2284
10 TraesCS6A01G328000 chr2B 601729757 601733679 3922 False 1297.666667 2272 94.402333 243 3054 3 chr2B.!!$F3 2811
11 TraesCS6A01G328000 chr4B 22447399 22448065 666 True 461.000000 774 93.418500 2211 3054 2 chr4B.!!$R1 843

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
842 878 0.249868 CGCGGAGATCCAGGCATTAA 60.250 55.000 0.0 0.0 35.14 1.40 F
1215 1262 1.072015 GGGCTACCGAGAGCTAGACTA 59.928 57.143 8.2 0.0 42.43 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1745 2378 2.179427 CCAGAGTACCAGTGATGGTGA 58.821 52.381 10.17 0.0 43.03 4.02 R
2962 5661 7.759886 CCGAACTATCTGAATCAAGTTTGAGTA 59.240 37.037 12.71 0.0 41.08 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
125 128 3.469863 TTGGCGCCTTCAAGGTCGT 62.470 57.895 29.70 0.0 37.80 4.34
365 382 1.819208 TGCAACACTCGCTTGTGCT 60.819 52.632 5.97 0.0 41.30 4.40
842 878 0.249868 CGCGGAGATCCAGGCATTAA 60.250 55.000 0.00 0.0 35.14 1.40
1215 1262 1.072015 GGGCTACCGAGAGCTAGACTA 59.928 57.143 8.20 0.0 42.43 2.59
1745 2378 2.702592 TGGTCACTGACGGTTTTCTT 57.297 45.000 3.04 0.0 32.65 2.52
1959 4001 1.550976 TGCCTTTTCGGTGGTTTGTTT 59.449 42.857 0.00 0.0 34.25 2.83
2300 4821 3.452474 GTCAGATCTTCTCGAATGTGGG 58.548 50.000 0.00 0.0 0.00 4.61
2432 4975 9.530633 AGAGCGTTTAGAATACTAAATTAGTGG 57.469 33.333 15.34 0.0 46.01 4.00
2665 5225 6.420913 AGTGTTAGTTTCATACCACTGTCT 57.579 37.500 0.00 0.0 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 4.160439 CCACTAGCAGTTAATGGAGAGTCA 59.840 45.833 0.00 0.00 31.69 3.41
17 18 5.245531 TCCTTTGACCACTAGCAGTTAATG 58.754 41.667 0.00 0.00 0.00 1.90
125 128 5.074804 CCAGAAGAATGGCAATGATATCCA 58.925 41.667 0.00 0.00 32.48 3.41
365 382 4.051167 CCATCCTGCCACCAGCCA 62.051 66.667 0.00 0.00 42.71 4.75
467 490 3.005539 AGGCAGGCGAGACCACAT 61.006 61.111 0.00 0.00 43.14 3.21
842 878 0.606130 TGACCGCTGCAACATGATGT 60.606 50.000 0.00 0.00 0.00 3.06
1215 1262 4.018597 AGGCTCTTTTTCAGTGATGGAGAT 60.019 41.667 12.95 2.63 0.00 2.75
1745 2378 2.179427 CCAGAGTACCAGTGATGGTGA 58.821 52.381 10.17 0.00 43.03 4.02
1959 4001 2.562298 GGAGGCCAACACAAATGAATCA 59.438 45.455 5.01 0.00 0.00 2.57
2962 5661 7.759886 CCGAACTATCTGAATCAAGTTTGAGTA 59.240 37.037 12.71 0.00 41.08 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.