Multiple sequence alignment - TraesCS6A01G327200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G327200 chr6A 100.000 2522 0 0 1 2522 560477995 560480516 0.000000e+00 4658.0
1 TraesCS6A01G327200 chr6A 99.180 1829 14 1 658 2485 560406885 560408713 0.000000e+00 3293.0
2 TraesCS6A01G327200 chr6A 99.418 1202 7 0 1 1202 560522536 560523737 0.000000e+00 2182.0
3 TraesCS6A01G327200 chr6A 97.068 955 17 2 1204 2147 560523980 560524934 0.000000e+00 1598.0
4 TraesCS6A01G327200 chr6A 99.747 790 2 0 658 1447 560358899 560359688 0.000000e+00 1448.0
5 TraesCS6A01G327200 chr6A 99.747 790 2 0 658 1447 560400265 560401054 0.000000e+00 1448.0
6 TraesCS6A01G327200 chr6A 90.323 1023 56 24 857 1864 560544349 560545343 0.000000e+00 1301.0
7 TraesCS6A01G327200 chr6A 93.390 711 45 1 854 1562 560133094 560132384 0.000000e+00 1051.0
8 TraesCS6A01G327200 chr6A 94.135 665 38 1 1 665 560404748 560405411 0.000000e+00 1011.0
9 TraesCS6A01G327200 chr6A 93.985 665 39 1 1 665 560402550 560403213 0.000000e+00 1005.0
10 TraesCS6A01G327200 chr6A 93.974 614 36 1 52 665 560355205 560355817 0.000000e+00 928.0
11 TraesCS6A01G327200 chr6A 93.974 614 36 1 52 665 560396562 560397174 0.000000e+00 928.0
12 TraesCS6A01G327200 chr6A 88.608 395 29 3 2144 2522 560526667 560527061 1.370000e-127 466.0
13 TraesCS6A01G327200 chr6A 97.500 40 1 0 2483 2522 560423285 560423324 4.500000e-08 69.4
14 TraesCS6A01G327200 chr6A 97.500 40 1 0 2483 2522 560435636 560435675 4.500000e-08 69.4
15 TraesCS6A01G327200 chr6D 94.051 706 37 3 857 1557 417888306 417889011 0.000000e+00 1066.0
16 TraesCS6A01G327200 chr6D 79.611 976 103 47 46 991 417761331 417762240 1.660000e-171 612.0
17 TraesCS6A01G327200 chr6D 79.256 699 65 28 205 842 417716168 417715489 5.020000e-112 414.0
18 TraesCS6A01G327200 chr6D 82.274 299 35 9 2240 2521 69218082 69217785 2.510000e-60 243.0
19 TraesCS6A01G327200 chr6B 91.678 757 46 11 1473 2215 626813939 626814692 0.000000e+00 1033.0
20 TraesCS6A01G327200 chr6B 92.146 713 52 2 854 1562 626808114 626808826 0.000000e+00 1003.0
21 TraesCS6A01G327200 chr6B 85.685 985 89 29 838 1792 626463217 626462255 0.000000e+00 990.0
22 TraesCS6A01G327200 chr6B 91.813 684 53 1 854 1534 626593541 626592858 0.000000e+00 950.0
23 TraesCS6A01G327200 chr2A 84.068 295 31 7 2243 2521 764779168 764778874 1.150000e-68 270.0
24 TraesCS6A01G327200 chr4D 83.986 281 32 7 2252 2520 469196435 469196156 8.950000e-65 257.0
25 TraesCS6A01G327200 chr4D 87.766 188 21 2 2243 2429 483167733 483167919 4.220000e-53 219.0
26 TraesCS6A01G327200 chr3B 82.310 277 30 10 2262 2521 312167252 312167526 3.270000e-54 222.0
27 TraesCS6A01G327200 chr4B 79.931 289 38 11 2250 2521 372009883 372009598 7.120000e-46 195.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G327200 chr6A 560477995 560480516 2521 False 4658.000000 4658 100.000000 1 2522 1 chr6A.!!$F3 2521
1 TraesCS6A01G327200 chr6A 560396562 560408713 12151 False 1537.000000 3293 96.204200 1 2485 5 chr6A.!!$F6 2484
2 TraesCS6A01G327200 chr6A 560522536 560527061 4525 False 1415.333333 2182 95.031333 1 2522 3 chr6A.!!$F7 2521
3 TraesCS6A01G327200 chr6A 560544349 560545343 994 False 1301.000000 1301 90.323000 857 1864 1 chr6A.!!$F4 1007
4 TraesCS6A01G327200 chr6A 560355205 560359688 4483 False 1188.000000 1448 96.860500 52 1447 2 chr6A.!!$F5 1395
5 TraesCS6A01G327200 chr6A 560132384 560133094 710 True 1051.000000 1051 93.390000 854 1562 1 chr6A.!!$R1 708
6 TraesCS6A01G327200 chr6D 417888306 417889011 705 False 1066.000000 1066 94.051000 857 1557 1 chr6D.!!$F2 700
7 TraesCS6A01G327200 chr6D 417761331 417762240 909 False 612.000000 612 79.611000 46 991 1 chr6D.!!$F1 945
8 TraesCS6A01G327200 chr6D 417715489 417716168 679 True 414.000000 414 79.256000 205 842 1 chr6D.!!$R2 637
9 TraesCS6A01G327200 chr6B 626813939 626814692 753 False 1033.000000 1033 91.678000 1473 2215 1 chr6B.!!$F2 742
10 TraesCS6A01G327200 chr6B 626808114 626808826 712 False 1003.000000 1003 92.146000 854 1562 1 chr6B.!!$F1 708
11 TraesCS6A01G327200 chr6B 626462255 626463217 962 True 990.000000 990 85.685000 838 1792 1 chr6B.!!$R1 954
12 TraesCS6A01G327200 chr6B 626592858 626593541 683 True 950.000000 950 91.813000 854 1534 1 chr6B.!!$R2 680

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
481 8673 1.544724 TGGTCTAGGCCATTTTGCAC 58.455 50.0 13.4 0.0 32.81 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2198 17066 0.888619 TCGAGTAGTGACTTGGCAGG 59.111 55.0 0.0 0.0 37.64 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
78 8265 4.563140 AGAAAGGAGCCGGTTATTTGTA 57.437 40.909 1.90 0.0 0.00 2.41
348 8535 4.336889 TGTTGTTGTTGTTGGGTCAAAA 57.663 36.364 0.00 0.0 0.00 2.44
481 8673 1.544724 TGGTCTAGGCCATTTTGCAC 58.455 50.000 13.40 0.0 32.81 4.57
1724 14830 7.966204 GCGAGGACAAATTTATTAGCTTGTTTA 59.034 33.333 0.00 0.0 32.31 2.01
1931 15051 1.919600 AAGTCCCATCCAGCCAGAGC 61.920 60.000 0.00 0.0 40.32 4.09
2486 17370 1.286501 GAGTGTGACAGCAACGACAA 58.713 50.000 0.00 0.0 0.00 3.18
2491 17375 1.157257 TGACAGCAACGACAACGCAT 61.157 50.000 0.00 0.0 43.96 4.73
2496 17380 1.010238 CAACGACAACGCATGTGCA 60.010 52.632 6.08 0.0 44.12 4.57
2502 17386 0.250038 ACAACGCATGTGCACTCTCT 60.250 50.000 19.41 0.0 41.93 3.10
2504 17388 0.033920 AACGCATGTGCACTCTCTCA 59.966 50.000 19.41 0.0 42.21 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
78 8265 4.271696 TCGTTTGGTGATCACAGAAGAT 57.728 40.909 26.47 0.0 0.00 2.40
348 8535 5.693961 AGAAAAGGAAAAATGCCCAATGTT 58.306 33.333 0.00 0.0 0.00 2.71
523 8738 1.591619 GGCGTACTAATCGAACTTGCC 59.408 52.381 0.00 0.0 0.00 4.52
1724 14830 6.599638 GGGAGTAGAAACAATTGCACTTCTAT 59.400 38.462 19.88 13.0 34.01 1.98
1931 15051 1.654105 GTGTATGTTTCTCGTCTGGCG 59.346 52.381 0.00 0.0 43.01 5.69
2198 17066 0.888619 TCGAGTAGTGACTTGGCAGG 59.111 55.000 0.00 0.0 37.64 4.85
2284 17152 4.547367 GGGCTGCCGGCGTAGATT 62.547 66.667 23.90 0.0 42.94 2.40
2476 17360 1.279539 CACATGCGTTGTCGTTGCT 59.720 52.632 0.00 0.0 36.00 3.91
2486 17370 0.389556 CTGAGAGAGTGCACATGCGT 60.390 55.000 21.04 0.0 45.83 5.24
2502 17386 2.587247 GGTGCTCCTCAGCCACTGA 61.587 63.158 0.00 0.0 46.26 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.