Multiple sequence alignment - TraesCS6A01G291300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G291300 chr6A 100.000 2630 0 0 1 2630 522626821 522629450 0 4857
1 TraesCS6A01G291300 chr6A 98.289 2630 43 1 1 2630 486093679 486096306 0 4606
2 TraesCS6A01G291300 chr6A 94.541 2638 132 10 1 2630 176443256 176440623 0 4063
3 TraesCS6A01G291300 chr6A 98.155 813 14 1 1 813 486100942 486101753 0 1417
4 TraesCS6A01G291300 chr6A 98.037 815 15 1 1 815 522634019 522634832 0 1415
5 TraesCS6A01G291300 chr2A 98.632 2631 33 3 1 2630 724014956 724012328 0 4656
6 TraesCS6A01G291300 chr2A 97.672 816 14 2 1 815 724007685 724006874 0 1397
7 TraesCS6A01G291300 chr2D 93.960 2682 103 20 1 2630 110914133 110916807 0 4000
8 TraesCS6A01G291300 chr2D 95.535 1814 58 4 840 2630 110922299 110924112 0 2880
9 TraesCS6A01G291300 chr4D 93.890 2684 104 26 1 2630 53870716 53873393 0 3993
10 TraesCS6A01G291300 chr5D 93.916 2679 102 19 1 2630 49290405 49287739 0 3988
11 TraesCS6A01G291300 chr6B 94.985 1356 45 3 1296 2630 526881587 526882940 0 2106
12 TraesCS6A01G291300 chr6B 94.543 1356 51 3 1296 2630 526914092 526915445 0 2073
13 TraesCS6A01G291300 chrUn 96.321 1033 36 1 1600 2630 384467267 384466235 0 1696
14 TraesCS6A01G291300 chr4A 89.737 1179 87 13 1 1169 153758483 153757329 0 1476
15 TraesCS6A01G291300 chr5A 97.786 813 17 1 1 813 272865860 272866671 0 1400
16 TraesCS6A01G291300 chr1D 97.033 573 15 2 840 1410 467656173 467655601 0 963


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G291300 chr6A 522626821 522629450 2629 False 4857 4857 100.000 1 2630 1 chr6A.!!$F3 2629
1 TraesCS6A01G291300 chr6A 486093679 486096306 2627 False 4606 4606 98.289 1 2630 1 chr6A.!!$F1 2629
2 TraesCS6A01G291300 chr6A 176440623 176443256 2633 True 4063 4063 94.541 1 2630 1 chr6A.!!$R1 2629
3 TraesCS6A01G291300 chr6A 486100942 486101753 811 False 1417 1417 98.155 1 813 1 chr6A.!!$F2 812
4 TraesCS6A01G291300 chr6A 522634019 522634832 813 False 1415 1415 98.037 1 815 1 chr6A.!!$F4 814
5 TraesCS6A01G291300 chr2A 724012328 724014956 2628 True 4656 4656 98.632 1 2630 1 chr2A.!!$R2 2629
6 TraesCS6A01G291300 chr2A 724006874 724007685 811 True 1397 1397 97.672 1 815 1 chr2A.!!$R1 814
7 TraesCS6A01G291300 chr2D 110914133 110916807 2674 False 4000 4000 93.960 1 2630 1 chr2D.!!$F1 2629
8 TraesCS6A01G291300 chr2D 110922299 110924112 1813 False 2880 2880 95.535 840 2630 1 chr2D.!!$F2 1790
9 TraesCS6A01G291300 chr4D 53870716 53873393 2677 False 3993 3993 93.890 1 2630 1 chr4D.!!$F1 2629
10 TraesCS6A01G291300 chr5D 49287739 49290405 2666 True 3988 3988 93.916 1 2630 1 chr5D.!!$R1 2629
11 TraesCS6A01G291300 chr6B 526881587 526882940 1353 False 2106 2106 94.985 1296 2630 1 chr6B.!!$F1 1334
12 TraesCS6A01G291300 chr6B 526914092 526915445 1353 False 2073 2073 94.543 1296 2630 1 chr6B.!!$F2 1334
13 TraesCS6A01G291300 chrUn 384466235 384467267 1032 True 1696 1696 96.321 1600 2630 1 chrUn.!!$R1 1030
14 TraesCS6A01G291300 chr4A 153757329 153758483 1154 True 1476 1476 89.737 1 1169 1 chr4A.!!$R1 1168
15 TraesCS6A01G291300 chr5A 272865860 272866671 811 False 1400 1400 97.786 1 813 1 chr5A.!!$F1 812
16 TraesCS6A01G291300 chr1D 467655601 467656173 572 True 963 963 97.033 840 1410 1 chr1D.!!$R1 570

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
257 258 0.179029 CGAGTGGTTGGTTCTTGGGT 60.179 55.000 0.0 0.0 0.0 4.51 F
509 519 1.141053 ACTTTTGCCGTGAGAGGTTCT 59.859 47.619 0.0 0.0 0.0 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1510 1555 0.684535 TCCAACTGATCACGCTCCAA 59.315 50.0 0.0 0.0 0.0 3.53 R
1796 1863 0.937441 TCTCCCTCCAGCCACTCTAT 59.063 55.0 0.0 0.0 0.0 1.98 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
153 154 1.548719 CGGTCACAGTTCAGGTATGGA 59.451 52.381 0.00 0.00 0.00 3.41
257 258 0.179029 CGAGTGGTTGGTTCTTGGGT 60.179 55.000 0.00 0.00 0.00 4.51
301 302 1.337447 GCGCCTGTGTGGTTCTAGTTA 60.337 52.381 0.00 0.00 38.35 2.24
305 306 4.638304 GCCTGTGTGGTTCTAGTTAAGAA 58.362 43.478 0.00 0.00 37.87 2.52
509 519 1.141053 ACTTTTGCCGTGAGAGGTTCT 59.859 47.619 0.00 0.00 0.00 3.01
1147 1192 2.430465 CAGTACATTTGCAGCTCACCT 58.570 47.619 0.00 0.00 0.00 4.00
1476 1521 1.201429 AGGACAGGGATCGTTGGCTT 61.201 55.000 1.51 0.00 0.00 4.35
1510 1555 7.331791 AGAACACAAGAGTAAGAAACTGAAGT 58.668 34.615 0.00 0.00 39.07 3.01
1574 1619 7.882271 GGAGAGTAAAATCATGGAGCTAATGAT 59.118 37.037 15.47 15.47 44.73 2.45
1796 1863 6.611785 ACTCTAGCAGTATGGGTGTCTATAA 58.388 40.000 0.00 0.00 35.86 0.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
191 192 2.205074 GATCCATCATCGACACGCTTT 58.795 47.619 0.00 0.00 0.00 3.51
301 302 0.879765 ACTCCGACGTCGACATTCTT 59.120 50.000 37.65 12.30 43.02 2.52
305 306 1.372087 GGGTACTCCGACGTCGACAT 61.372 60.000 37.65 23.23 43.02 3.06
509 519 1.202313 GCAAGCACACGGGTAAAAACA 60.202 47.619 0.00 0.00 0.00 2.83
1510 1555 0.684535 TCCAACTGATCACGCTCCAA 59.315 50.000 0.00 0.00 0.00 3.53
1574 1619 1.819288 CACGGAGGCTTCTGTTCTCTA 59.181 52.381 7.72 0.00 41.01 2.43
1796 1863 0.937441 TCTCCCTCCAGCCACTCTAT 59.063 55.000 0.00 0.00 0.00 1.98
2582 2649 2.484889 GAAGTCCTTGAGCGAAACACT 58.515 47.619 0.00 0.00 0.00 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.