Multiple sequence alignment - TraesCS6A01G288700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G288700 chr6A 100.000 3564 0 0 1 3564 520816626 520820189 0.000000e+00 6582
1 TraesCS6A01G288700 chr6A 99.215 3566 26 2 1 3564 520804058 520807623 0.000000e+00 6429
2 TraesCS6A01G288700 chr6A 99.214 3563 26 2 3 3564 520791493 520795054 0.000000e+00 6423
3 TraesCS6A01G288700 chr6A 98.310 2603 29 2 977 3564 520771381 520773983 0.000000e+00 4549
4 TraesCS6A01G288700 chr6A 99.460 1852 9 1 1 1851 520829193 520831044 0.000000e+00 3363
5 TraesCS6A01G288700 chr6A 99.662 1183 4 0 1800 2982 520831044 520832226 0.000000e+00 2163
6 TraesCS6A01G288700 chr6A 91.238 1107 88 6 1740 2843 520837478 520838578 0.000000e+00 1498
7 TraesCS6A01G288700 chr6A 92.632 665 46 2 977 1638 520836830 520837494 0.000000e+00 953
8 TraesCS6A01G288700 chr6A 97.798 545 8 1 3024 3564 520832589 520833133 0.000000e+00 937
9 TraesCS6A01G288700 chr6A 84.848 165 21 3 3386 3546 3759638 3759474 2.850000e-36 163
10 TraesCS6A01G288700 chr6B 91.922 1535 102 12 1740 3262 566299415 566300939 0.000000e+00 2128
11 TraesCS6A01G288700 chr6B 90.168 1129 84 13 1740 2843 566309372 566310498 0.000000e+00 1445
12 TraesCS6A01G288700 chr6B 87.966 831 57 19 842 1642 566304640 566305457 0.000000e+00 941
13 TraesCS6A01G288700 chr6B 86.737 852 104 4 1740 2591 566305437 566306279 0.000000e+00 939
14 TraesCS6A01G288700 chr6B 91.480 669 54 2 977 1642 566298767 566299435 0.000000e+00 917
15 TraesCS6A01G288700 chr6B 90.705 667 57 4 977 1642 566308730 566309392 0.000000e+00 883
16 TraesCS6A01G288700 chr6B 93.458 321 15 3 3249 3564 566303036 566303355 4.160000e-129 472
17 TraesCS6A01G288700 chr6B 80.564 319 43 11 542 854 566304304 566304609 9.950000e-56 228
18 TraesCS6A01G288700 chr6B 90.244 82 6 1 1656 1737 566299082 566299161 4.870000e-19 106
19 TraesCS6A01G288700 chr6D 88.303 1137 106 13 1740 2851 380030985 380029851 0.000000e+00 1338
20 TraesCS6A01G288700 chr6D 86.059 1119 130 11 1743 2851 380036188 380035086 0.000000e+00 1179
21 TraesCS6A01G288700 chr6D 92.042 666 49 3 977 1638 380031634 380030969 0.000000e+00 933
22 TraesCS6A01G288700 chr5A 97.043 541 15 1 1 540 674209859 674210399 0.000000e+00 909
23 TraesCS6A01G288700 chr5A 84.118 170 19 7 3382 3546 594135147 594135313 1.320000e-34 158
24 TraesCS6A01G288700 chr2A 96.118 541 20 1 1 540 499774055 499774595 0.000000e+00 881
25 TraesCS6A01G288700 chr2A 91.522 519 38 4 1 517 622382722 622383236 0.000000e+00 710
26 TraesCS6A01G288700 chr1B 91.908 519 36 4 1 517 681831138 681831652 0.000000e+00 721
27 TraesCS6A01G288700 chr1B 90.751 519 42 4 1 517 332581155 332581669 0.000000e+00 688
28 TraesCS6A01G288700 chr7A 88.368 533 61 1 11 542 696007457 696007989 1.080000e-179 640
29 TraesCS6A01G288700 chr1D 85.542 166 19 4 3385 3547 348800750 348800587 6.120000e-38 169
30 TraesCS6A01G288700 chr2D 85.350 157 19 3 3386 3538 488381923 488381767 3.680000e-35 159


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G288700 chr6A 520816626 520820189 3563 False 6582.000000 6582 100.000000 1 3564 1 chr6A.!!$F4 3563
1 TraesCS6A01G288700 chr6A 520804058 520807623 3565 False 6429.000000 6429 99.215000 1 3564 1 chr6A.!!$F3 3563
2 TraesCS6A01G288700 chr6A 520791493 520795054 3561 False 6423.000000 6423 99.214000 3 3564 1 chr6A.!!$F2 3561
3 TraesCS6A01G288700 chr6A 520771381 520773983 2602 False 4549.000000 4549 98.310000 977 3564 1 chr6A.!!$F1 2587
4 TraesCS6A01G288700 chr6A 520829193 520838578 9385 False 1782.800000 3363 96.158000 1 3564 5 chr6A.!!$F5 3563
5 TraesCS6A01G288700 chr6B 566298767 566310498 11731 False 895.444444 2128 89.249333 542 3564 9 chr6B.!!$F1 3022
6 TraesCS6A01G288700 chr6D 380029851 380036188 6337 True 1150.000000 1338 88.801333 977 2851 3 chr6D.!!$R1 1874
7 TraesCS6A01G288700 chr5A 674209859 674210399 540 False 909.000000 909 97.043000 1 540 1 chr5A.!!$F2 539
8 TraesCS6A01G288700 chr2A 499774055 499774595 540 False 881.000000 881 96.118000 1 540 1 chr2A.!!$F1 539
9 TraesCS6A01G288700 chr2A 622382722 622383236 514 False 710.000000 710 91.522000 1 517 1 chr2A.!!$F2 516
10 TraesCS6A01G288700 chr1B 681831138 681831652 514 False 721.000000 721 91.908000 1 517 1 chr1B.!!$F2 516
11 TraesCS6A01G288700 chr1B 332581155 332581669 514 False 688.000000 688 90.751000 1 517 1 chr1B.!!$F1 516
12 TraesCS6A01G288700 chr7A 696007457 696007989 532 False 640.000000 640 88.368000 11 542 1 chr7A.!!$F1 531

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1124 4704 3.733337 AGAGGCTACAACAACTCTTGTG 58.267 45.455 0.0 0.0 44.59 3.33 F
1143 4723 0.031721 GGAGAGTTCACACGGTCGTT 59.968 55.000 0.0 0.0 0.00 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2015 5650 3.053842 AGGTACCTGTACTCCTCGAATGA 60.054 47.826 15.42 0.0 36.36 2.57 R
3130 7121 1.175983 TGCCGGGTTTTAAGCACTGG 61.176 55.000 2.18 0.0 0.00 4.00 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1124 4704 3.733337 AGAGGCTACAACAACTCTTGTG 58.267 45.455 0.0 0.0 44.59 3.33
1143 4723 0.031721 GGAGAGTTCACACGGTCGTT 59.968 55.000 0.0 0.0 0.00 3.85
1700 5284 1.098869 TCCTTTCAAACGTGCTTGCA 58.901 45.000 0.0 0.0 0.00 4.08
1844 5479 3.750371 ACAGACCATGAAATTCCGTCAA 58.250 40.909 0.0 0.0 0.00 3.18
3065 7054 6.349363 CCTTTTGTCCTGCTAAACCTGATAAC 60.349 42.308 0.0 0.0 0.00 1.89
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1124 4704 0.031721 AACGACCGTGTGAACTCTCC 59.968 55.000 0.00 0.0 0.00 3.71
1798 5382 1.198637 CTCGTAAGACCGTCTCCGTTT 59.801 52.381 15.97 0.0 45.01 3.60
1844 5479 2.249139 GACAACTACCAGTGTCCTCCT 58.751 52.381 0.00 0.0 0.00 3.69
2015 5650 3.053842 AGGTACCTGTACTCCTCGAATGA 60.054 47.826 15.42 0.0 36.36 2.57
3130 7121 1.175983 TGCCGGGTTTTAAGCACTGG 61.176 55.000 2.18 0.0 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.