Multiple sequence alignment - TraesCS6A01G263300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G263300 chr6A 100.000 2273 0 0 1 2273 486382694 486384966 0.000000e+00 4198
1 TraesCS6A01G263300 chr6A 93.388 1089 65 3 217 1301 29171000 29169915 0.000000e+00 1605
2 TraesCS6A01G263300 chr6A 96.502 972 33 1 1302 2273 509914845 509915815 0.000000e+00 1605
3 TraesCS6A01G263300 chr6A 94.521 219 12 0 1 219 29180109 29179891 2.800000e-89 339
4 TraesCS6A01G263300 chr3A 97.705 1307 26 1 1 1303 456805011 456806317 0.000000e+00 2244
5 TraesCS6A01G263300 chr3A 96.095 973 36 2 1302 2273 54430158 54429187 0.000000e+00 1585
6 TraesCS6A01G263300 chr3A 96.095 973 36 2 1302 2273 215925464 215926435 0.000000e+00 1585
7 TraesCS6A01G263300 chr4A 95.451 1275 45 7 37 1299 632313208 632314481 0.000000e+00 2021
8 TraesCS6A01G263300 chr4A 90.980 1031 87 3 282 1308 552270593 552271621 0.000000e+00 1384
9 TraesCS6A01G263300 chr7B 93.870 1305 76 2 1 1301 493222265 493223569 0.000000e+00 1964
10 TraesCS6A01G263300 chr1B 93.972 1294 74 2 1 1290 477489547 477490840 0.000000e+00 1954
11 TraesCS6A01G263300 chr5B 93.650 1307 79 2 1 1303 94082416 94083722 0.000000e+00 1951
12 TraesCS6A01G263300 chr5D 96.000 1150 41 3 157 1302 440927001 440925853 0.000000e+00 1864
13 TraesCS6A01G263300 chr6B 89.602 1308 130 3 1 1302 133347226 133348533 0.000000e+00 1657
14 TraesCS6A01G263300 chr5A 96.506 973 32 2 1302 2273 573547641 573546670 0.000000e+00 1607
15 TraesCS6A01G263300 chr1A 96.399 972 35 0 1302 2273 61828072 61827101 0.000000e+00 1602
16 TraesCS6A01G263300 chr2A 96.091 972 38 0 1302 2273 119222795 119221824 0.000000e+00 1585
17 TraesCS6A01G263300 chr2A 96.091 972 38 0 1302 2273 322936984 322937955 0.000000e+00 1585
18 TraesCS6A01G263300 chr7A 95.992 973 37 2 1302 2273 126004802 126005773 0.000000e+00 1580
19 TraesCS6A01G263300 chr7A 95.988 972 39 0 1302 2273 485861144 485860173 0.000000e+00 1580
20 TraesCS6A01G263300 chr3B 95.292 977 41 2 1 973 683516794 683517769 0.000000e+00 1544


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G263300 chr6A 486382694 486384966 2272 False 4198 4198 100.000 1 2273 1 chr6A.!!$F1 2272
1 TraesCS6A01G263300 chr6A 29169915 29171000 1085 True 1605 1605 93.388 217 1301 1 chr6A.!!$R1 1084
2 TraesCS6A01G263300 chr6A 509914845 509915815 970 False 1605 1605 96.502 1302 2273 1 chr6A.!!$F2 971
3 TraesCS6A01G263300 chr3A 456805011 456806317 1306 False 2244 2244 97.705 1 1303 1 chr3A.!!$F2 1302
4 TraesCS6A01G263300 chr3A 54429187 54430158 971 True 1585 1585 96.095 1302 2273 1 chr3A.!!$R1 971
5 TraesCS6A01G263300 chr3A 215925464 215926435 971 False 1585 1585 96.095 1302 2273 1 chr3A.!!$F1 971
6 TraesCS6A01G263300 chr4A 632313208 632314481 1273 False 2021 2021 95.451 37 1299 1 chr4A.!!$F2 1262
7 TraesCS6A01G263300 chr4A 552270593 552271621 1028 False 1384 1384 90.980 282 1308 1 chr4A.!!$F1 1026
8 TraesCS6A01G263300 chr7B 493222265 493223569 1304 False 1964 1964 93.870 1 1301 1 chr7B.!!$F1 1300
9 TraesCS6A01G263300 chr1B 477489547 477490840 1293 False 1954 1954 93.972 1 1290 1 chr1B.!!$F1 1289
10 TraesCS6A01G263300 chr5B 94082416 94083722 1306 False 1951 1951 93.650 1 1303 1 chr5B.!!$F1 1302
11 TraesCS6A01G263300 chr5D 440925853 440927001 1148 True 1864 1864 96.000 157 1302 1 chr5D.!!$R1 1145
12 TraesCS6A01G263300 chr6B 133347226 133348533 1307 False 1657 1657 89.602 1 1302 1 chr6B.!!$F1 1301
13 TraesCS6A01G263300 chr5A 573546670 573547641 971 True 1607 1607 96.506 1302 2273 1 chr5A.!!$R1 971
14 TraesCS6A01G263300 chr1A 61827101 61828072 971 True 1602 1602 96.399 1302 2273 1 chr1A.!!$R1 971
15 TraesCS6A01G263300 chr2A 119221824 119222795 971 True 1585 1585 96.091 1302 2273 1 chr2A.!!$R1 971
16 TraesCS6A01G263300 chr2A 322936984 322937955 971 False 1585 1585 96.091 1302 2273 1 chr2A.!!$F1 971
17 TraesCS6A01G263300 chr7A 126004802 126005773 971 False 1580 1580 95.992 1302 2273 1 chr7A.!!$F1 971
18 TraesCS6A01G263300 chr7A 485860173 485861144 971 True 1580 1580 95.988 1302 2273 1 chr7A.!!$R1 971
19 TraesCS6A01G263300 chr3B 683516794 683517769 975 False 1544 1544 95.292 1 973 1 chr3B.!!$F1 972

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
470 475 2.030628 GCCTAGCTACAGACGAGGATTC 60.031 54.545 0.42 0.0 0.0 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1833 1848 1.740025 GCTCACAAAGTCCCTATGCAC 59.26 52.381 0.0 0.0 0.0 4.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
60 61 4.518970 GGTTGGAAGTGACACATTACACAT 59.481 41.667 8.59 0.0 39.18 3.21
64 65 7.234661 TGGAAGTGACACATTACACATAGTA 57.765 36.000 8.59 0.0 39.18 1.82
67 68 8.198109 GGAAGTGACACATTACACATAGTATCT 58.802 37.037 8.59 0.0 39.18 1.98
80 81 7.366513 ACACATAGTATCTGATCTCATTGACG 58.633 38.462 0.00 0.0 0.00 4.35
165 166 7.361116 CGATGCTATATTGAACATACCATTGCA 60.361 37.037 0.00 0.0 0.00 4.08
470 475 2.030628 GCCTAGCTACAGACGAGGATTC 60.031 54.545 0.42 0.0 0.00 2.52
690 695 6.469782 ACACATGACAAGGAAAGTTCAAAT 57.530 33.333 0.00 0.0 0.00 2.32
1083 1097 2.224305 GGTAGCGCCAGTTCTATTGGAT 60.224 50.000 2.29 0.0 37.96 3.41
1761 1776 9.692749 GATGATTTCAATGATGCTCACATAAAT 57.307 29.630 0.00 0.0 36.35 1.40
1833 1848 6.149474 CACATTTAAGTCTAACCCACTTCCTG 59.851 42.308 0.00 0.0 35.63 3.86
1844 1859 1.407437 CCACTTCCTGTGCATAGGGAC 60.407 57.143 27.24 0.0 44.92 4.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
60 61 6.017026 GTCACCGTCAATGAGATCAGATACTA 60.017 42.308 0.00 0.00 0.00 1.82
64 65 3.703556 AGTCACCGTCAATGAGATCAGAT 59.296 43.478 0.00 0.00 0.00 2.90
67 68 3.092301 AGAGTCACCGTCAATGAGATCA 58.908 45.455 0.00 0.00 0.00 2.92
80 81 3.009143 ACCTTCCATAACCAAGAGTCACC 59.991 47.826 0.00 0.00 0.00 4.02
165 166 2.612115 CCTCACCTCCCCCTTGCT 60.612 66.667 0.00 0.00 0.00 3.91
470 475 1.262417 ACTTAATCAGCGCATGCATCG 59.738 47.619 19.57 12.35 46.23 3.84
690 695 5.970317 TCGTTCTCATAAACTGTACTGGA 57.030 39.130 4.66 0.00 0.00 3.86
1833 1848 1.740025 GCTCACAAAGTCCCTATGCAC 59.260 52.381 0.00 0.00 0.00 4.57
1844 1859 3.613737 CCACAAGTTGTTTGCTCACAAAG 59.386 43.478 5.57 0.00 46.17 2.77
2005 2020 6.751888 GGTGCTGGTTATATTGTTGAATTCAC 59.248 38.462 7.89 4.45 0.00 3.18
2234 2249 8.689061 AGCAAATTTACTATGATGAAAGCATGA 58.311 29.630 0.00 0.00 46.13 3.07


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.