Multiple sequence alignment - TraesCS6A01G262700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G262700 chr6A 100.000 2573 0 0 1 2573 485773726 485776298 0.000000e+00 4752
1 TraesCS6A01G262700 chr6A 97.029 976 21 5 1598 2573 615286336 615287303 0.000000e+00 1635
2 TraesCS6A01G262700 chr2B 99.501 1602 7 1 1 1602 72967292 72965692 0.000000e+00 2913
3 TraesCS6A01G262700 chr2B 97.593 997 23 1 604 1600 168676600 168675605 0.000000e+00 1707
4 TraesCS6A01G262700 chr2B 92.945 978 55 11 1598 2573 23779711 23778746 0.000000e+00 1411
5 TraesCS6A01G262700 chr2B 82.298 1593 257 23 21 1601 758136885 758138464 0.000000e+00 1356
6 TraesCS6A01G262700 chr1B 99.189 1602 11 2 1 1602 492790168 492791767 0.000000e+00 2885
7 TraesCS6A01G262700 chr3A 98.813 1601 15 2 1 1601 728250366 728251962 0.000000e+00 2848
8 TraesCS6A01G262700 chr3A 84.069 929 143 5 1 927 158535963 158535038 0.000000e+00 891
9 TraesCS6A01G262700 chr3A 86.228 334 39 4 1598 1929 458234400 458234072 3.150000e-94 355
10 TraesCS6A01G262700 chr5B 92.815 1197 78 6 1 1196 281372930 281371741 0.000000e+00 1727
11 TraesCS6A01G262700 chr5B 93.857 407 19 3 1194 1599 281366282 281365881 2.190000e-170 608
12 TraesCS6A01G262700 chr4B 93.846 975 38 12 1600 2573 159564817 159563864 0.000000e+00 1448
13 TraesCS6A01G262700 chr4B 86.102 295 30 4 1637 1929 577215512 577215797 8.940000e-80 307
14 TraesCS6A01G262700 chr7B 93.184 983 54 10 1598 2573 426338727 426337751 0.000000e+00 1432
15 TraesCS6A01G262700 chr4A 92.025 978 60 12 1598 2573 343879279 343878318 0.000000e+00 1358
16 TraesCS6A01G262700 chr4A 80.916 393 61 13 2051 2440 512677064 512677445 5.380000e-77 298
17 TraesCS6A01G262700 chr6B 98.915 645 7 0 961 1605 319823971 319823327 0.000000e+00 1153
18 TraesCS6A01G262700 chr6B 95.606 569 21 4 1032 1600 712654312 712653748 0.000000e+00 909
19 TraesCS6A01G262700 chr6B 82.027 523 68 15 2053 2573 143587664 143588162 3.060000e-114 422
20 TraesCS6A01G262700 chr7A 89.465 617 52 4 967 1575 589434311 589433700 0.000000e+00 767
21 TraesCS6A01G262700 chr7A 92.188 512 39 1 460 971 589436109 589435599 0.000000e+00 723
22 TraesCS6A01G262700 chr7A 91.354 347 29 1 118 464 589450335 589449990 8.330000e-130 473
23 TraesCS6A01G262700 chr7A 86.228 334 39 4 1598 1929 33037431 33037103 3.150000e-94 355
24 TraesCS6A01G262700 chr7A 94.737 133 7 0 1 133 589450479 589450347 9.330000e-50 207
25 TraesCS6A01G262700 chr5D 86.866 335 37 6 1598 1929 418928940 418928610 4.040000e-98 368
26 TraesCS6A01G262700 chr5D 82.776 389 54 11 2054 2440 396938778 396938401 4.100000e-88 335
27 TraesCS6A01G262700 chr1D 82.353 391 53 14 2053 2440 445606191 445606568 2.470000e-85 326
28 TraesCS6A01G262700 chr1D 84.375 224 26 6 1713 1929 418757243 418757464 7.210000e-51 211


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G262700 chr6A 485773726 485776298 2572 False 4752 4752 100.0000 1 2573 1 chr6A.!!$F1 2572
1 TraesCS6A01G262700 chr6A 615286336 615287303 967 False 1635 1635 97.0290 1598 2573 1 chr6A.!!$F2 975
2 TraesCS6A01G262700 chr2B 72965692 72967292 1600 True 2913 2913 99.5010 1 1602 1 chr2B.!!$R2 1601
3 TraesCS6A01G262700 chr2B 168675605 168676600 995 True 1707 1707 97.5930 604 1600 1 chr2B.!!$R3 996
4 TraesCS6A01G262700 chr2B 23778746 23779711 965 True 1411 1411 92.9450 1598 2573 1 chr2B.!!$R1 975
5 TraesCS6A01G262700 chr2B 758136885 758138464 1579 False 1356 1356 82.2980 21 1601 1 chr2B.!!$F1 1580
6 TraesCS6A01G262700 chr1B 492790168 492791767 1599 False 2885 2885 99.1890 1 1602 1 chr1B.!!$F1 1601
7 TraesCS6A01G262700 chr3A 728250366 728251962 1596 False 2848 2848 98.8130 1 1601 1 chr3A.!!$F1 1600
8 TraesCS6A01G262700 chr3A 158535038 158535963 925 True 891 891 84.0690 1 927 1 chr3A.!!$R1 926
9 TraesCS6A01G262700 chr5B 281371741 281372930 1189 True 1727 1727 92.8150 1 1196 1 chr5B.!!$R2 1195
10 TraesCS6A01G262700 chr4B 159563864 159564817 953 True 1448 1448 93.8460 1600 2573 1 chr4B.!!$R1 973
11 TraesCS6A01G262700 chr7B 426337751 426338727 976 True 1432 1432 93.1840 1598 2573 1 chr7B.!!$R1 975
12 TraesCS6A01G262700 chr4A 343878318 343879279 961 True 1358 1358 92.0250 1598 2573 1 chr4A.!!$R1 975
13 TraesCS6A01G262700 chr6B 319823327 319823971 644 True 1153 1153 98.9150 961 1605 1 chr6B.!!$R1 644
14 TraesCS6A01G262700 chr6B 712653748 712654312 564 True 909 909 95.6060 1032 1600 1 chr6B.!!$R2 568
15 TraesCS6A01G262700 chr7A 589433700 589436109 2409 True 745 767 90.8265 460 1575 2 chr7A.!!$R2 1115

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
798 803 2.171237 CCAGTGAAGCACATATGGAGGA 59.829 50.0 7.8 0.0 39.21 3.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1828 3139 0.972883 GGGCCTCAAGCGAGATATCT 59.027 55.0 4.47 4.47 45.17 1.98 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
592 594 2.301870 CAACAGCTGACCACTTACCCTA 59.698 50.000 23.35 0.00 0.00 3.53
798 803 2.171237 CCAGTGAAGCACATATGGAGGA 59.829 50.000 7.80 0.00 39.21 3.71
1093 2390 4.440112 GGAAACCGCCAGAGGAAAATTATG 60.440 45.833 0.00 0.00 34.73 1.90
1710 3020 1.336517 CGTCGGTTGTAGCTTTCCTGA 60.337 52.381 0.00 0.00 0.00 3.86
1752 3062 1.077716 GGCTGGGTTGCGTAAGGAT 60.078 57.895 0.00 0.00 37.71 3.24
1828 3139 7.037586 AGGTTGTGTGGGAGATATAAGAAAAGA 60.038 37.037 0.00 0.00 0.00 2.52
1890 3202 2.843401 TCCGTGTAAAAAGGCTAGCA 57.157 45.000 18.24 0.00 0.00 3.49
1904 3216 0.247736 CTAGCAAGCAAGGGACGACT 59.752 55.000 0.00 0.00 0.00 4.18
2052 3369 3.635836 AGAGCTAATAGGTGAACGGTACC 59.364 47.826 0.16 0.16 38.52 3.34
2219 3537 7.208777 TGATTGCACATTTGTTCACATTAGTT 58.791 30.769 0.00 0.00 0.00 2.24
2230 3548 6.828788 TGTTCACATTAGTTAGTGTGGGTTA 58.171 36.000 12.85 0.00 42.17 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
592 594 4.446889 GCCTCCATATTTTCTCCCACTCAT 60.447 45.833 0.00 0.00 0.00 2.90
798 803 4.263068 CCTTATATCCTCCATTTGAGCCGT 60.263 45.833 0.00 0.00 39.98 5.68
1093 2390 9.356433 GAAGGCTCCGTCTATATTTATCTTTAC 57.644 37.037 0.00 0.00 0.00 2.01
1710 3020 3.267812 TCCCTTGCTCCTTTCATCATTCT 59.732 43.478 0.00 0.00 0.00 2.40
1752 3062 4.440525 CCTCTTGACTTTTGCTTCTTTGCA 60.441 41.667 0.00 0.00 41.65 4.08
1828 3139 0.972883 GGGCCTCAAGCGAGATATCT 59.027 55.000 4.47 4.47 45.17 1.98
1890 3202 2.032681 GCCAGTCGTCCCTTGCTT 59.967 61.111 0.00 0.00 0.00 3.91
1947 3264 6.946583 CCATGGGAAGATGATAAGTTGATCAT 59.053 38.462 2.85 0.00 46.89 2.45
1998 3315 1.203001 TCATTTCGGTTTCCCAGGCTT 60.203 47.619 0.00 0.00 0.00 4.35
2029 3346 4.823989 GGTACCGTTCACCTATTAGCTCTA 59.176 45.833 0.00 0.00 32.98 2.43
2030 3347 3.635836 GGTACCGTTCACCTATTAGCTCT 59.364 47.826 0.00 0.00 32.98 4.09
2219 3537 5.034200 ACAATATCCCTGTAACCCACACTA 58.966 41.667 0.00 0.00 32.33 2.74
2230 3548 5.178096 TGTCACAATCACAATATCCCTGT 57.822 39.130 0.00 0.00 0.00 4.00
2395 3713 7.062371 CACTACTTTTCTGTTCGGTCTTCATAG 59.938 40.741 0.00 0.00 0.00 2.23
2452 3770 1.801771 CGCACCCGAAACACAAATAGA 59.198 47.619 0.00 0.00 36.29 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.