Multiple sequence alignment - TraesCS6A01G255300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G255300 chr6A 100.000 2222 0 0 1 2222 472969336 472971557 0 4104
1 TraesCS6A01G255300 chr6A 98.378 1541 24 1 1 1541 595511672 595510133 0 2706
2 TraesCS6A01G255300 chr6A 96.788 685 20 2 1538 2222 462052601 462051919 0 1142
3 TraesCS6A01G255300 chr1A 95.977 1566 39 3 1 1542 432523245 432524810 0 2521
4 TraesCS6A01G255300 chr1A 97.778 675 15 0 1 675 20992404 20991730 0 1164
5 TraesCS6A01G255300 chr1A 96.934 685 20 1 1538 2222 24109405 24108722 0 1147
6 TraesCS6A01G255300 chr1A 96.788 685 22 0 1538 2222 351091097 351091781 0 1144
7 TraesCS6A01G255300 chr2A 92.352 1556 107 11 673 2222 661122926 661121377 0 2204
8 TraesCS6A01G255300 chr2A 96.889 675 20 1 1 675 767163798 767163125 0 1129
9 TraesCS6A01G255300 chr7A 95.533 873 35 4 673 1542 677975067 677975938 0 1393
10 TraesCS6A01G255300 chr7A 97.333 675 18 0 1 675 609346756 609347430 0 1147
11 TraesCS6A01G255300 chr5B 95.397 869 39 1 673 1540 492816263 492815395 0 1382
12 TraesCS6A01G255300 chr4B 95.271 867 41 0 673 1539 604143656 604144522 0 1375
13 TraesCS6A01G255300 chr3A 95.161 868 40 2 673 1538 11605247 11604380 0 1369
14 TraesCS6A01G255300 chr3A 94.816 868 43 2 673 1538 11598359 11597492 0 1352
15 TraesCS6A01G255300 chr3A 96.788 685 22 0 1538 2222 611846004 611845320 0 1144
16 TraesCS6A01G255300 chr3A 97.185 675 19 0 1 675 11599228 11598554 0 1142
17 TraesCS6A01G255300 chr3A 97.037 675 20 0 1 675 27580776 27581450 0 1136
18 TraesCS6A01G255300 chr4A 94.810 867 45 0 673 1539 553534728 553535594 0 1352
19 TraesCS6A01G255300 chr4A 96.788 685 21 1 1538 2222 165429236 165428553 0 1142
20 TraesCS6A01G255300 chr5A 97.085 686 17 3 1538 2222 663757167 663756484 0 1153
21 TraesCS6A01G255300 chr5A 96.934 685 20 1 1538 2222 319733350 319732667 0 1147
22 TraesCS6A01G255300 chr5A 95.863 701 28 1 1522 2222 477975520 477976219 0 1133
23 TraesCS6A01G255300 chr5A 96.889 675 21 0 1 675 33882152 33881478 0 1131
24 TraesCS6A01G255300 chr2B 96.893 676 20 1 1 675 721722958 721723633 0 1131


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G255300 chr6A 472969336 472971557 2221 False 4104 4104 100.0000 1 2222 1 chr6A.!!$F1 2221
1 TraesCS6A01G255300 chr6A 595510133 595511672 1539 True 2706 2706 98.3780 1 1541 1 chr6A.!!$R2 1540
2 TraesCS6A01G255300 chr6A 462051919 462052601 682 True 1142 1142 96.7880 1538 2222 1 chr6A.!!$R1 684
3 TraesCS6A01G255300 chr1A 432523245 432524810 1565 False 2521 2521 95.9770 1 1542 1 chr1A.!!$F2 1541
4 TraesCS6A01G255300 chr1A 20991730 20992404 674 True 1164 1164 97.7780 1 675 1 chr1A.!!$R1 674
5 TraesCS6A01G255300 chr1A 24108722 24109405 683 True 1147 1147 96.9340 1538 2222 1 chr1A.!!$R2 684
6 TraesCS6A01G255300 chr1A 351091097 351091781 684 False 1144 1144 96.7880 1538 2222 1 chr1A.!!$F1 684
7 TraesCS6A01G255300 chr2A 661121377 661122926 1549 True 2204 2204 92.3520 673 2222 1 chr2A.!!$R1 1549
8 TraesCS6A01G255300 chr2A 767163125 767163798 673 True 1129 1129 96.8890 1 675 1 chr2A.!!$R2 674
9 TraesCS6A01G255300 chr7A 677975067 677975938 871 False 1393 1393 95.5330 673 1542 1 chr7A.!!$F2 869
10 TraesCS6A01G255300 chr7A 609346756 609347430 674 False 1147 1147 97.3330 1 675 1 chr7A.!!$F1 674
11 TraesCS6A01G255300 chr5B 492815395 492816263 868 True 1382 1382 95.3970 673 1540 1 chr5B.!!$R1 867
12 TraesCS6A01G255300 chr4B 604143656 604144522 866 False 1375 1375 95.2710 673 1539 1 chr4B.!!$F1 866
13 TraesCS6A01G255300 chr3A 11604380 11605247 867 True 1369 1369 95.1610 673 1538 1 chr3A.!!$R1 865
14 TraesCS6A01G255300 chr3A 11597492 11599228 1736 True 1247 1352 96.0005 1 1538 2 chr3A.!!$R3 1537
15 TraesCS6A01G255300 chr3A 611845320 611846004 684 True 1144 1144 96.7880 1538 2222 1 chr3A.!!$R2 684
16 TraesCS6A01G255300 chr3A 27580776 27581450 674 False 1136 1136 97.0370 1 675 1 chr3A.!!$F1 674
17 TraesCS6A01G255300 chr4A 553534728 553535594 866 False 1352 1352 94.8100 673 1539 1 chr4A.!!$F1 866
18 TraesCS6A01G255300 chr4A 165428553 165429236 683 True 1142 1142 96.7880 1538 2222 1 chr4A.!!$R1 684
19 TraesCS6A01G255300 chr5A 663756484 663757167 683 True 1153 1153 97.0850 1538 2222 1 chr5A.!!$R3 684
20 TraesCS6A01G255300 chr5A 319732667 319733350 683 True 1147 1147 96.9340 1538 2222 1 chr5A.!!$R2 684
21 TraesCS6A01G255300 chr5A 477975520 477976219 699 False 1133 1133 95.8630 1522 2222 1 chr5A.!!$F1 700
22 TraesCS6A01G255300 chr5A 33881478 33882152 674 True 1131 1131 96.8890 1 675 1 chr5A.!!$R1 674
23 TraesCS6A01G255300 chr2B 721722958 721723633 675 False 1131 1131 96.8930 1 675 1 chr2B.!!$F1 674

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
565 591 2.231478 CAGTTACGGAGTCATGTGACCT 59.769 50.0 9.41 0.0 45.85 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1947 2177 1.531423 AACTCGTGAGCTCCGTTAGA 58.469 50.0 19.53 8.42 0.0 2.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
565 591 2.231478 CAGTTACGGAGTCATGTGACCT 59.769 50.000 9.41 0.0 45.85 3.85
694 917 7.710676 AAAGTTTAATGCATATGGTGGTACA 57.289 32.000 0.00 0.0 0.00 2.90
1271 1496 8.207350 TGAGATTAGTTTCCTAATAGGATGGG 57.793 38.462 10.21 0.0 45.34 4.00
1749 1979 0.776810 TTGGGGTTCCAGATCTTGCA 59.223 50.000 0.00 0.0 45.04 4.08
1810 2040 5.452302 CAGATTCTGTTTTTCGTGTGTTGTC 59.548 40.000 5.46 0.0 0.00 3.18
1929 2159 7.506114 TGAGTTCATTACAGTACCTTGAAGTT 58.494 34.615 8.06 0.0 31.83 2.66
1947 2177 9.196552 CTTGAAGTTGTCTTTTGTTTTCTTTCT 57.803 29.630 0.00 0.0 33.64 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
541 567 4.056050 GTCACATGACTCCGTAACTGTTT 58.944 43.478 0.00 0.00 41.65 2.83
694 917 2.248248 GGCTTCCTTGGGCTTTACTTT 58.752 47.619 0.00 0.00 0.00 2.66
846 1069 3.688694 AGGTTGCCGATTGTTGTACTA 57.311 42.857 0.00 0.00 0.00 1.82
1179 1403 4.760715 TCTATTAGGAAGCTAATCGCGAGT 59.239 41.667 16.66 16.05 45.59 4.18
1271 1496 6.398918 TCTAGGAAACTAAATCAGAGTGCAC 58.601 40.000 9.40 9.40 43.83 4.57
1749 1979 7.340256 ACAGTCTGTAGTAATCTGTAGCTAGT 58.660 38.462 2.87 0.00 37.55 2.57
1810 2040 7.883217 AGCCATAGATTCATCAAAATAAGCAG 58.117 34.615 0.00 0.00 0.00 4.24
1929 2159 7.334921 TCCGTTAGAGAAAGAAAACAAAAGACA 59.665 33.333 0.00 0.00 0.00 3.41
1947 2177 1.531423 AACTCGTGAGCTCCGTTAGA 58.469 50.000 19.53 8.42 0.00 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.