Multiple sequence alignment - TraesCS6A01G253000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G253000 chr6A 100.000 2513 0 0 1 2513 468224301 468226813 0 4641
1 TraesCS6A01G253000 chr5A 97.535 2515 53 8 3 2513 580225350 580222841 0 4292
2 TraesCS6A01G253000 chr5A 97.382 2521 54 10 1 2513 639808008 639810524 0 4279
3 TraesCS6A01G253000 chr5A 97.141 2518 65 6 1 2513 483355599 483353084 0 4244
4 TraesCS6A01G253000 chr1A 97.462 2522 52 11 1 2513 257591379 257588861 0 4292
5 TraesCS6A01G253000 chr1A 97.176 2514 58 7 2 2513 582806012 582808514 0 4237
6 TraesCS6A01G253000 chr3A 97.296 2515 56 10 3 2513 654166983 654169489 0 4257
7 TraesCS6A01G253000 chr4A 97.142 2519 62 9 1 2513 638451823 638449309 0 4244


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G253000 chr6A 468224301 468226813 2512 False 4641 4641 100.000 1 2513 1 chr6A.!!$F1 2512
1 TraesCS6A01G253000 chr5A 580222841 580225350 2509 True 4292 4292 97.535 3 2513 1 chr5A.!!$R2 2510
2 TraesCS6A01G253000 chr5A 639808008 639810524 2516 False 4279 4279 97.382 1 2513 1 chr5A.!!$F1 2512
3 TraesCS6A01G253000 chr5A 483353084 483355599 2515 True 4244 4244 97.141 1 2513 1 chr5A.!!$R1 2512
4 TraesCS6A01G253000 chr1A 257588861 257591379 2518 True 4292 4292 97.462 1 2513 1 chr1A.!!$R1 2512
5 TraesCS6A01G253000 chr1A 582806012 582808514 2502 False 4237 4237 97.176 2 2513 1 chr1A.!!$F1 2511
6 TraesCS6A01G253000 chr3A 654166983 654169489 2506 False 4257 4257 97.296 3 2513 1 chr3A.!!$F1 2510
7 TraesCS6A01G253000 chr4A 638449309 638451823 2514 True 4244 4244 97.142 1 2513 1 chr4A.!!$R1 2512

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
675 685 2.430465 CTGATTGGCTACTGCACTGTT 58.57 47.619 0.0 0.0 41.91 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1850 1865 0.188342 TCTGGGCTTCTTTTTGGGCT 59.812 50.0 0.0 0.0 0.0 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
174 176 6.471015 CCCTAAACCCTCTCTCCCTATTCTAT 60.471 46.154 0.0 0.0 0.00 1.98
225 227 6.268566 AGCTCATTTGTGTGAAGACTTTTTC 58.731 36.000 0.0 0.0 0.00 2.29
675 685 2.430465 CTGATTGGCTACTGCACTGTT 58.570 47.619 0.0 0.0 41.91 3.16
1083 1095 0.112412 AGAATGGGAACTTTGGGCGT 59.888 50.000 0.0 0.0 0.00 5.68
1145 1157 5.344743 AGATCTAAGTTTTCCTCGCATCA 57.655 39.130 0.0 0.0 0.00 3.07
1153 1165 7.396540 AAGTTTTCCTCGCATCATTTATCTT 57.603 32.000 0.0 0.0 0.00 2.40
1478 1490 6.525629 TGATAGCTTTAGGAATACTTGCTCC 58.474 40.000 0.0 0.0 33.39 4.70
1666 1680 3.066203 CGGCAGAAAACAACTACCAGTTT 59.934 43.478 0.0 0.0 36.03 2.66
2296 2316 9.851686 TTTAGAAGGCATCTATAAACACATCAT 57.148 29.630 0.0 0.0 40.32 2.45
2297 2317 9.851686 TTAGAAGGCATCTATAAACACATCATT 57.148 29.630 0.0 0.0 40.32 2.57
2484 2506 7.504911 AGTTTAACCTTACATAGATAGCTCGGA 59.495 37.037 0.0 0.0 0.00 4.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
225 227 4.766891 ACTTGGTGTAGGTCATTTTCATGG 59.233 41.667 0.00 0.0 0.00 3.66
693 704 5.387113 TCATATGTAAAGTGGGGCAGATT 57.613 39.130 1.90 0.0 0.00 2.40
728 739 2.643655 CATGTGGTGGTCATGTGCA 58.356 52.632 0.00 0.0 38.17 4.57
788 800 7.205297 AGCTATATTGACAATTTGCCACATTC 58.795 34.615 5.89 0.0 0.00 2.67
1083 1095 2.328473 CTCTCGCATTTGACGAACTCA 58.672 47.619 0.00 0.0 39.39 3.41
1256 1268 2.269241 CCGACCCTTGAAGCCTCC 59.731 66.667 0.00 0.0 0.00 4.30
1369 1381 5.043903 CGTCTTCAATTCGACATCTACCAT 58.956 41.667 0.00 0.0 0.00 3.55
1384 1396 6.230472 TCATCTTCTTCAATTCCGTCTTCAA 58.770 36.000 0.00 0.0 0.00 2.69
1850 1865 0.188342 TCTGGGCTTCTTTTTGGGCT 59.812 50.000 0.00 0.0 0.00 5.19
1950 1969 6.269538 CCTCAATGAGATAGAAGAGATTGGGA 59.730 42.308 12.53 0.0 0.00 4.37
2036 2055 5.661056 TCGCTAGGCATAATAATACTGCT 57.339 39.130 0.00 0.0 36.18 4.24
2302 2324 6.238511 GCGTGGGAAAAATTAACCAAACAAAT 60.239 34.615 0.00 0.0 34.26 2.32
2484 2506 2.227865 GTGAGTTTGGTGTGTGTGTTGT 59.772 45.455 0.00 0.0 0.00 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.