Multiple sequence alignment - TraesCS6A01G246500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G246500 chr6A 100.000 2441 0 0 1 2441 457598092 457600532 0.000000e+00 4508
1 TraesCS6A01G246500 chr6A 96.206 2451 82 6 1 2441 457590302 457592751 0.000000e+00 4000
2 TraesCS6A01G246500 chr6A 96.283 861 32 0 1 861 457607706 457608566 0.000000e+00 1413
3 TraesCS6A01G246500 chr6A 87.287 1054 100 28 1409 2441 228425254 228426294 0.000000e+00 1173
4 TraesCS6A01G246500 chr6A 84.815 731 93 15 1 720 234049552 234050275 0.000000e+00 719
5 TraesCS6A01G246500 chr6A 85.030 668 87 10 1 659 286467448 286466785 0.000000e+00 667
6 TraesCS6A01G246500 chr6A 85.030 668 87 10 1 659 286482671 286482008 0.000000e+00 667
7 TraesCS6A01G246500 chr4A 88.454 2451 222 47 15 2438 152040284 152042700 0.000000e+00 2902
8 TraesCS6A01G246500 chr4A 87.008 2363 218 53 15 2349 152048263 152050564 0.000000e+00 2580
9 TraesCS6A01G246500 chr4A 85.797 1211 121 38 1252 2438 152050564 152051747 0.000000e+00 1236
10 TraesCS6A01G246500 chr4A 87.619 735 76 13 1714 2441 612879606 612878880 0.000000e+00 839
11 TraesCS6A01G246500 chr4A 78.482 962 148 47 1517 2441 422036300 422037239 2.100000e-160 575
12 TraesCS6A01G246500 chr7A 90.736 1738 143 17 1 1728 400982692 400980963 0.000000e+00 2302
13 TraesCS6A01G246500 chr7A 90.642 1667 124 24 1 1659 400990631 400988989 0.000000e+00 2185
14 TraesCS6A01G246500 chr7A 87.214 1267 144 16 1 1255 592141069 592142329 0.000000e+00 1426
15 TraesCS6A01G246500 chr7A 87.390 1253 132 23 1 1238 592149413 592150654 0.000000e+00 1415
16 TraesCS6A01G246500 chr7A 89.344 732 66 11 1714 2441 309999732 310000455 0.000000e+00 909
17 TraesCS6A01G246500 chr7A 88.540 733 72 11 1714 2441 309991761 309992486 0.000000e+00 878
18 TraesCS6A01G246500 chr7A 80.887 947 134 39 1522 2441 400849156 400850082 0.000000e+00 702
19 TraesCS6A01G246500 chr1A 86.153 1271 147 16 1 1255 505952011 505950754 0.000000e+00 1345
20 TraesCS6A01G246500 chr1A 86.122 735 86 15 1714 2441 510335650 510334925 0.000000e+00 778
21 TraesCS6A01G246500 chr3A 91.132 733 56 9 1714 2441 291156267 291156995 0.000000e+00 985
22 TraesCS6A01G246500 chr3A 90.859 733 58 9 1714 2441 291164012 291164740 0.000000e+00 974
23 TraesCS6A01G246500 chr3A 90.685 730 58 9 1714 2438 273664249 273663525 0.000000e+00 963
24 TraesCS6A01G246500 chr3A 87.685 609 62 13 1 601 178716335 178716938 0.000000e+00 697
25 TraesCS6A01G246500 chr3A 87.521 609 63 13 1 601 178724041 178724644 0.000000e+00 691
26 TraesCS6A01G246500 chr5A 84.058 690 90 19 1 680 295918395 295917716 0.000000e+00 647
27 TraesCS6A01G246500 chr4D 87.636 550 55 12 681 1221 247935545 247936090 5.730000e-176 627
28 TraesCS6A01G246500 chr4D 92.395 263 18 2 1240 1501 260939757 260940018 8.240000e-100 374
29 TraesCS6A01G246500 chr6D 92.308 260 18 2 1243 1501 127810255 127809997 3.830000e-98 368
30 TraesCS6A01G246500 chr6D 91.923 260 19 2 1243 1501 127855894 127855636 1.780000e-96 363


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G246500 chr6A 457598092 457600532 2440 False 4508 4508 100.0000 1 2441 1 chr6A.!!$F4 2440
1 TraesCS6A01G246500 chr6A 457590302 457592751 2449 False 4000 4000 96.2060 1 2441 1 chr6A.!!$F3 2440
2 TraesCS6A01G246500 chr6A 457607706 457608566 860 False 1413 1413 96.2830 1 861 1 chr6A.!!$F5 860
3 TraesCS6A01G246500 chr6A 228425254 228426294 1040 False 1173 1173 87.2870 1409 2441 1 chr6A.!!$F1 1032
4 TraesCS6A01G246500 chr6A 234049552 234050275 723 False 719 719 84.8150 1 720 1 chr6A.!!$F2 719
5 TraesCS6A01G246500 chr6A 286466785 286467448 663 True 667 667 85.0300 1 659 1 chr6A.!!$R1 658
6 TraesCS6A01G246500 chr6A 286482008 286482671 663 True 667 667 85.0300 1 659 1 chr6A.!!$R2 658
7 TraesCS6A01G246500 chr4A 152040284 152042700 2416 False 2902 2902 88.4540 15 2438 1 chr4A.!!$F1 2423
8 TraesCS6A01G246500 chr4A 152048263 152051747 3484 False 1908 2580 86.4025 15 2438 2 chr4A.!!$F3 2423
9 TraesCS6A01G246500 chr4A 612878880 612879606 726 True 839 839 87.6190 1714 2441 1 chr4A.!!$R1 727
10 TraesCS6A01G246500 chr4A 422036300 422037239 939 False 575 575 78.4820 1517 2441 1 chr4A.!!$F2 924
11 TraesCS6A01G246500 chr7A 400980963 400982692 1729 True 2302 2302 90.7360 1 1728 1 chr7A.!!$R1 1727
12 TraesCS6A01G246500 chr7A 400988989 400990631 1642 True 2185 2185 90.6420 1 1659 1 chr7A.!!$R2 1658
13 TraesCS6A01G246500 chr7A 592141069 592142329 1260 False 1426 1426 87.2140 1 1255 1 chr7A.!!$F4 1254
14 TraesCS6A01G246500 chr7A 592149413 592150654 1241 False 1415 1415 87.3900 1 1238 1 chr7A.!!$F5 1237
15 TraesCS6A01G246500 chr7A 309999732 310000455 723 False 909 909 89.3440 1714 2441 1 chr7A.!!$F2 727
16 TraesCS6A01G246500 chr7A 309991761 309992486 725 False 878 878 88.5400 1714 2441 1 chr7A.!!$F1 727
17 TraesCS6A01G246500 chr7A 400849156 400850082 926 False 702 702 80.8870 1522 2441 1 chr7A.!!$F3 919
18 TraesCS6A01G246500 chr1A 505950754 505952011 1257 True 1345 1345 86.1530 1 1255 1 chr1A.!!$R1 1254
19 TraesCS6A01G246500 chr1A 510334925 510335650 725 True 778 778 86.1220 1714 2441 1 chr1A.!!$R2 727
20 TraesCS6A01G246500 chr3A 291156267 291156995 728 False 985 985 91.1320 1714 2441 1 chr3A.!!$F3 727
21 TraesCS6A01G246500 chr3A 291164012 291164740 728 False 974 974 90.8590 1714 2441 1 chr3A.!!$F4 727
22 TraesCS6A01G246500 chr3A 273663525 273664249 724 True 963 963 90.6850 1714 2438 1 chr3A.!!$R1 724
23 TraesCS6A01G246500 chr3A 178716335 178716938 603 False 697 697 87.6850 1 601 1 chr3A.!!$F1 600
24 TraesCS6A01G246500 chr3A 178724041 178724644 603 False 691 691 87.5210 1 601 1 chr3A.!!$F2 600
25 TraesCS6A01G246500 chr5A 295917716 295918395 679 True 647 647 84.0580 1 680 1 chr5A.!!$R1 679
26 TraesCS6A01G246500 chr4D 247935545 247936090 545 False 627 627 87.6360 681 1221 1 chr4D.!!$F1 540

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
820 864 0.623324 TCCCCATCCCGAACCTCATT 60.623 55.0 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2366 3553 1.072806 TGGAGCTCAACATGCAACTCT 59.927 47.619 17.19 0.0 0.0 3.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
256 262 0.788391 AAGTTTCATCGCGTTCGGAC 59.212 50.000 5.77 1.08 36.13 4.79
502 529 1.133823 CATTGGATCCGGATCAACCCA 60.134 52.381 38.29 27.79 39.54 4.51
726 765 3.583882 ATCCCACCTGCCCAAACCG 62.584 63.158 0.00 0.00 0.00 4.44
820 864 0.623324 TCCCCATCCCGAACCTCATT 60.623 55.000 0.00 0.00 0.00 2.57
825 869 0.902531 ATCCCGAACCTCATTGTCGT 59.097 50.000 0.00 0.00 0.00 4.34
870 915 1.301623 CGGGGCCATTTCCACACTA 59.698 57.895 4.39 0.00 0.00 2.74
921 967 2.109774 CTCCTGCATCTCACTCCTCTT 58.890 52.381 0.00 0.00 0.00 2.85
938 992 3.117550 CCTCTTCTCATCTCTCTCTCCCA 60.118 52.174 0.00 0.00 0.00 4.37
1095 1151 2.948720 GCACCAAGTCCTCCTCGCT 61.949 63.158 0.00 0.00 0.00 4.93
1117 1173 2.043652 CGACCCCGTCCCCTTCTA 60.044 66.667 0.00 0.00 0.00 2.10
1174 1230 1.228862 ACTTGCTCCCCGCCAAATT 60.229 52.632 0.00 0.00 38.05 1.82
1340 1397 4.537433 GCAGCAGGTCCGGGCTAG 62.537 72.222 5.77 0.00 38.56 3.42
1353 1410 1.152368 GGCTAGCCCATGCCTCATT 59.848 57.895 24.19 0.00 45.26 2.57
1622 2787 1.654137 GCGCCGAACTGTTGTGTTG 60.654 57.895 0.00 0.00 0.00 3.33
1848 3022 4.337274 TCGTCTATTATTCCAGAGAACGCA 59.663 41.667 0.00 0.00 33.97 5.24
2137 3314 6.398234 AACATGGTGTACTTGTTTTGCATA 57.602 33.333 0.00 0.00 42.74 3.14
2199 3377 9.899661 GTACCAAACCTAATATATGCATATGGA 57.100 33.333 26.21 10.25 0.00 3.41
2366 3553 3.565902 TGGTGTTTCGTCAATATGCAACA 59.434 39.130 0.00 0.00 0.00 3.33
2438 3626 3.117794 CCATGCCATGCTTCATTAAACG 58.882 45.455 0.00 0.00 0.00 3.60
2440 3628 2.441410 TGCCATGCTTCATTAAACGGA 58.559 42.857 0.00 0.00 0.00 4.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
167 172 4.148838 ACCCATTCCGAGAACATTTTTCA 58.851 39.130 0.00 0.00 0.00 2.69
256 262 1.883021 GTTGGGGCATCAAACGGAG 59.117 57.895 0.00 0.00 0.00 4.63
301 308 3.184541 CCGAAAACGTCCGACATTAGAT 58.815 45.455 6.54 0.00 0.00 1.98
726 765 3.682292 AAGGGAAGATGGCGGCGAC 62.682 63.158 12.98 9.31 0.00 5.19
806 850 0.902531 ACGACAATGAGGTTCGGGAT 59.097 50.000 0.00 0.00 0.00 3.85
870 915 0.326264 GACTGGCCTGGTGTTCATCT 59.674 55.000 14.82 0.00 0.00 2.90
938 992 1.009429 AGGAGGGGATTTGAGAGCTCT 59.991 52.381 18.28 18.28 0.00 4.09
1117 1173 0.798771 GCTTGACGCTCGAGACGAAT 60.799 55.000 27.66 12.38 34.74 3.34
1174 1230 3.755628 GGTGCTACGAGCCACCGA 61.756 66.667 7.21 0.00 41.51 4.69
1339 1396 1.075748 GGGAAATGAGGCATGGGCT 60.076 57.895 0.00 0.00 42.48 5.19
1340 1397 0.688749 AAGGGAAATGAGGCATGGGC 60.689 55.000 0.00 0.00 40.13 5.36
1353 1410 2.682494 CGGGGAGACGGAAGGGAA 60.682 66.667 0.00 0.00 0.00 3.97
1445 1502 1.668101 GAGAAGAGGTCGCGGATGGT 61.668 60.000 6.13 0.00 0.00 3.55
1615 2780 2.615447 CTGAAGAAGCAGAGCAACACAA 59.385 45.455 0.00 0.00 38.14 3.33
1622 2787 2.736192 GTTCTGACTGAAGAAGCAGAGC 59.264 50.000 0.00 0.00 39.01 4.09
1848 3022 2.375146 AGGGACTTTTCTGCAAAACGT 58.625 42.857 0.00 0.00 27.25 3.99
2199 3377 4.758165 ACGAACAACAATTCCGGTAAATCT 59.242 37.500 0.00 0.00 0.00 2.40
2320 3505 8.474025 CCACATGACTTATTTAGTTCTCTCTCT 58.526 37.037 0.00 0.00 37.17 3.10
2366 3553 1.072806 TGGAGCTCAACATGCAACTCT 59.927 47.619 17.19 0.00 0.00 3.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.