Multiple sequence alignment - TraesCS6A01G228300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G228300 chr6A 100.000 2351 0 0 1 2351 430387253 430384903 0.000000e+00 4342
1 TraesCS6A01G228300 chr6A 99.107 2352 20 1 1 2351 430412139 430409788 0.000000e+00 4226
2 TraesCS6A01G228300 chr6A 87.842 329 33 3 1 327 430483349 430483672 1.710000e-101 379
3 TraesCS6A01G228300 chr2A 97.251 764 21 0 1588 2351 155609791 155610554 0.000000e+00 1295
4 TraesCS6A01G228300 chr2A 97.251 764 20 1 1588 2351 143354934 143355696 0.000000e+00 1293
5 TraesCS6A01G228300 chr2A 97.124 765 22 0 1587 2351 84613949 84614713 0.000000e+00 1291
6 TraesCS6A01G228300 chr2A 96.871 767 23 1 1585 2351 603718865 603718100 0.000000e+00 1282
7 TraesCS6A01G228300 chr7A 97.120 764 22 0 1588 2351 725696144 725696907 0.000000e+00 1290
8 TraesCS6A01G228300 chr7A 96.993 765 22 1 1587 2351 481550918 481550155 0.000000e+00 1284
9 TraesCS6A01G228300 chr5A 96.632 772 25 1 1581 2351 239873259 239872488 0.000000e+00 1280
10 TraesCS6A01G228300 chr3A 95.812 788 30 3 1566 2351 437756336 437755550 0.000000e+00 1269
11 TraesCS6A01G228300 chr7D 83.391 861 134 7 734 1587 327147238 327146380 0.000000e+00 789
12 TraesCS6A01G228300 chr7D 82.032 807 133 11 740 1537 348344982 348345785 0.000000e+00 676
13 TraesCS6A01G228300 chr7D 88.000 200 23 1 288 487 327147658 327147460 3.910000e-58 235
14 TraesCS6A01G228300 chr6B 81.244 997 149 18 548 1538 542652165 542653129 0.000000e+00 771
15 TraesCS6A01G228300 chr6B 78.831 496 75 20 1 481 542651508 542651988 8.160000e-80 307
16 TraesCS6A01G228300 chr4B 81.998 861 132 16 563 1408 314898854 314898002 0.000000e+00 710
17 TraesCS6A01G228300 chr2D 81.702 858 140 14 742 1587 356383634 356384486 0.000000e+00 699
18 TraesCS6A01G228300 chr2D 82.609 644 99 11 1 634 356371139 356371779 7.340000e-155 556
19 TraesCS6A01G228300 chr2D 73.501 717 130 45 1 692 231924641 231923960 1.410000e-52 217
20 TraesCS6A01G228300 chr7B 81.404 855 151 8 740 1587 281643533 281642680 0.000000e+00 691
21 TraesCS6A01G228300 chr4D 80.839 882 133 27 547 1412 195167650 195168511 0.000000e+00 660
22 TraesCS6A01G228300 chr4A 77.673 851 168 16 751 1587 245381359 245380517 1.250000e-137 499
23 TraesCS6A01G228300 chr1B 74.673 841 170 28 764 1587 519412088 519411274 1.350000e-87 333


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G228300 chr6A 430384903 430387253 2350 True 4342 4342 100.0000 1 2351 1 chr6A.!!$R1 2350
1 TraesCS6A01G228300 chr6A 430409788 430412139 2351 True 4226 4226 99.1070 1 2351 1 chr6A.!!$R2 2350
2 TraesCS6A01G228300 chr2A 155609791 155610554 763 False 1295 1295 97.2510 1588 2351 1 chr2A.!!$F3 763
3 TraesCS6A01G228300 chr2A 143354934 143355696 762 False 1293 1293 97.2510 1588 2351 1 chr2A.!!$F2 763
4 TraesCS6A01G228300 chr2A 84613949 84614713 764 False 1291 1291 97.1240 1587 2351 1 chr2A.!!$F1 764
5 TraesCS6A01G228300 chr2A 603718100 603718865 765 True 1282 1282 96.8710 1585 2351 1 chr2A.!!$R1 766
6 TraesCS6A01G228300 chr7A 725696144 725696907 763 False 1290 1290 97.1200 1588 2351 1 chr7A.!!$F1 763
7 TraesCS6A01G228300 chr7A 481550155 481550918 763 True 1284 1284 96.9930 1587 2351 1 chr7A.!!$R1 764
8 TraesCS6A01G228300 chr5A 239872488 239873259 771 True 1280 1280 96.6320 1581 2351 1 chr5A.!!$R1 770
9 TraesCS6A01G228300 chr3A 437755550 437756336 786 True 1269 1269 95.8120 1566 2351 1 chr3A.!!$R1 785
10 TraesCS6A01G228300 chr7D 348344982 348345785 803 False 676 676 82.0320 740 1537 1 chr7D.!!$F1 797
11 TraesCS6A01G228300 chr7D 327146380 327147658 1278 True 512 789 85.6955 288 1587 2 chr7D.!!$R1 1299
12 TraesCS6A01G228300 chr6B 542651508 542653129 1621 False 539 771 80.0375 1 1538 2 chr6B.!!$F1 1537
13 TraesCS6A01G228300 chr4B 314898002 314898854 852 True 710 710 81.9980 563 1408 1 chr4B.!!$R1 845
14 TraesCS6A01G228300 chr2D 356383634 356384486 852 False 699 699 81.7020 742 1587 1 chr2D.!!$F2 845
15 TraesCS6A01G228300 chr2D 356371139 356371779 640 False 556 556 82.6090 1 634 1 chr2D.!!$F1 633
16 TraesCS6A01G228300 chr2D 231923960 231924641 681 True 217 217 73.5010 1 692 1 chr2D.!!$R1 691
17 TraesCS6A01G228300 chr7B 281642680 281643533 853 True 691 691 81.4040 740 1587 1 chr7B.!!$R1 847
18 TraesCS6A01G228300 chr4D 195167650 195168511 861 False 660 660 80.8390 547 1412 1 chr4D.!!$F1 865
19 TraesCS6A01G228300 chr4A 245380517 245381359 842 True 499 499 77.6730 751 1587 1 chr4A.!!$R1 836
20 TraesCS6A01G228300 chr1B 519411274 519412088 814 True 333 333 74.6730 764 1587 1 chr1B.!!$R1 823

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
791 972 0.938637 TGCATTTGTTCCTTTGCGCG 60.939 50.0 0.0 0.0 37.92 6.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2294 2496 2.261671 GATGACCAGCGTGTCCGT 59.738 61.111 6.26 0.0 34.25 4.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
551 715 9.255304 GTGTTTGTTGTAAATTACATCCATGTT 57.745 29.630 6.67 0.0 41.97 2.71
791 972 0.938637 TGCATTTGTTCCTTTGCGCG 60.939 50.000 0.00 0.0 37.92 6.86
889 1073 8.768397 AGGTTACTCACTTGATTGACCATTATA 58.232 33.333 11.56 0.0 36.33 0.98
1774 1976 3.494924 CCAAATCACCGATGATCCTAGCA 60.495 47.826 0.00 0.0 45.26 3.49
2294 2496 1.778309 GGGCCTCCAAAACCCCTTA 59.222 57.895 0.84 0.0 37.70 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
551 715 3.304041 TGCAGTTCTCGATGCACAA 57.696 47.368 7.31 0.0 46.97 3.33
759 937 4.685169 ACAAATGCAGTTCACTTATCCG 57.315 40.909 0.00 0.0 0.00 4.18
889 1073 3.706594 ACACCAATGACATCCTCTACGAT 59.293 43.478 0.00 0.0 0.00 3.73
1724 1926 2.818432 ACGAGTACGACTCCATCAACTT 59.182 45.455 8.73 0.0 42.12 2.66
2294 2496 2.261671 GATGACCAGCGTGTCCGT 59.738 61.111 6.26 0.0 34.25 4.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.