Multiple sequence alignment - TraesCS6A01G225100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G225100 chr6A 100.000 3599 0 0 1 3599 422937738 422934140 0.000000e+00 6647
1 TraesCS6A01G225100 chr2A 99.861 3599 4 1 1 3599 525633894 525630297 0.000000e+00 6617
2 TraesCS6A01G225100 chr2A 99.928 2794 2 0 1 2794 525618697 525615904 0.000000e+00 5149
3 TraesCS6A01G225100 chr2A 92.453 742 49 6 1 741 49277070 49277805 0.000000e+00 1053
4 TraesCS6A01G225100 chr2A 89.642 811 75 6 2792 3599 657307946 657308750 0.000000e+00 1024
5 TraesCS6A01G225100 chr2B 94.959 1845 76 10 768 2610 460824857 460823028 0.000000e+00 2876
6 TraesCS6A01G225100 chr2B 89.950 806 77 3 2792 3597 425878948 425878147 0.000000e+00 1037
7 TraesCS6A01G225100 chr2B 89.962 797 73 6 2802 3597 263354856 263355646 0.000000e+00 1022
8 TraesCS6A01G225100 chr2B 96.403 139 5 0 2656 2794 460822581 460822443 2.790000e-56 230
9 TraesCS6A01G225100 chr2D 94.501 1273 49 9 768 2039 388832644 388831392 0.000000e+00 1943
10 TraesCS6A01G225100 chr2D 89.052 749 34 19 2090 2794 388831384 388830640 0.000000e+00 885
11 TraesCS6A01G225100 chr7D 93.792 741 45 1 1 741 395352641 395353380 0.000000e+00 1112
12 TraesCS6A01G225100 chr7D 93.657 741 46 1 1 741 484345348 484346087 0.000000e+00 1107
13 TraesCS6A01G225100 chr7D 93.071 736 49 2 1 736 612278239 612278972 0.000000e+00 1075
14 TraesCS6A01G225100 chr7D 90.351 798 71 5 2802 3599 212668057 212668848 0.000000e+00 1042
15 TraesCS6A01G225100 chr7D 89.702 806 76 3 2792 3597 249764306 249763508 0.000000e+00 1022
16 TraesCS6A01G225100 chr6D 93.360 738 47 2 4 741 58529568 58528833 0.000000e+00 1090
17 TraesCS6A01G225100 chr6D 83.455 411 50 12 1375 1778 470743847 470744246 2.040000e-97 366
18 TraesCS6A01G225100 chr3D 93.360 738 48 1 4 741 253666546 253665810 0.000000e+00 1090
19 TraesCS6A01G225100 chr4D 90.977 809 68 4 2792 3599 341234770 341233966 0.000000e+00 1085
20 TraesCS6A01G225100 chr7A 93.099 739 41 5 4 741 133676316 133675587 0.000000e+00 1074
21 TraesCS6A01G225100 chr1D 89.753 810 71 9 2792 3599 120590533 120589734 0.000000e+00 1026
22 TraesCS6A01G225100 chr7B 89.850 798 75 5 2803 3599 188980334 188979542 0.000000e+00 1020


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G225100 chr6A 422934140 422937738 3598 True 6647 6647 100.0000 1 3599 1 chr6A.!!$R1 3598
1 TraesCS6A01G225100 chr2A 525630297 525633894 3597 True 6617 6617 99.8610 1 3599 1 chr2A.!!$R2 3598
2 TraesCS6A01G225100 chr2A 525615904 525618697 2793 True 5149 5149 99.9280 1 2794 1 chr2A.!!$R1 2793
3 TraesCS6A01G225100 chr2A 49277070 49277805 735 False 1053 1053 92.4530 1 741 1 chr2A.!!$F1 740
4 TraesCS6A01G225100 chr2A 657307946 657308750 804 False 1024 1024 89.6420 2792 3599 1 chr2A.!!$F2 807
5 TraesCS6A01G225100 chr2B 460822443 460824857 2414 True 1553 2876 95.6810 768 2794 2 chr2B.!!$R2 2026
6 TraesCS6A01G225100 chr2B 425878147 425878948 801 True 1037 1037 89.9500 2792 3597 1 chr2B.!!$R1 805
7 TraesCS6A01G225100 chr2B 263354856 263355646 790 False 1022 1022 89.9620 2802 3597 1 chr2B.!!$F1 795
8 TraesCS6A01G225100 chr2D 388830640 388832644 2004 True 1414 1943 91.7765 768 2794 2 chr2D.!!$R1 2026
9 TraesCS6A01G225100 chr7D 395352641 395353380 739 False 1112 1112 93.7920 1 741 1 chr7D.!!$F2 740
10 TraesCS6A01G225100 chr7D 484345348 484346087 739 False 1107 1107 93.6570 1 741 1 chr7D.!!$F3 740
11 TraesCS6A01G225100 chr7D 612278239 612278972 733 False 1075 1075 93.0710 1 736 1 chr7D.!!$F4 735
12 TraesCS6A01G225100 chr7D 212668057 212668848 791 False 1042 1042 90.3510 2802 3599 1 chr7D.!!$F1 797
13 TraesCS6A01G225100 chr7D 249763508 249764306 798 True 1022 1022 89.7020 2792 3597 1 chr7D.!!$R1 805
14 TraesCS6A01G225100 chr6D 58528833 58529568 735 True 1090 1090 93.3600 4 741 1 chr6D.!!$R1 737
15 TraesCS6A01G225100 chr3D 253665810 253666546 736 True 1090 1090 93.3600 4 741 1 chr3D.!!$R1 737
16 TraesCS6A01G225100 chr4D 341233966 341234770 804 True 1085 1085 90.9770 2792 3599 1 chr4D.!!$R1 807
17 TraesCS6A01G225100 chr7A 133675587 133676316 729 True 1074 1074 93.0990 4 741 1 chr7A.!!$R1 737
18 TraesCS6A01G225100 chr1D 120589734 120590533 799 True 1026 1026 89.7530 2792 3599 1 chr1D.!!$R1 807
19 TraesCS6A01G225100 chr7B 188979542 188980334 792 True 1020 1020 89.8500 2803 3599 1 chr7B.!!$R1 796

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
747 748 3.475494 TGGTGGTGGCGGCGATAT 61.475 61.111 12.98 0.0 0.0 1.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3346 3783 5.939764 TCTCTAAGTACTACGGGTGTCTA 57.06 43.478 0.0 0.0 0.0 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
747 748 3.475494 TGGTGGTGGCGGCGATAT 61.475 61.111 12.98 0.0 0.0 1.63
3346 3783 3.191371 GCGATGATTTTTCTTGGACCAGT 59.809 43.478 0.00 0.0 0.0 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
747 748 7.875554 TGCAAAGTGTTAGACTAATATGTCACA 59.124 33.333 12.73 0.0 39.27 3.58
3346 3783 5.939764 TCTCTAAGTACTACGGGTGTCTA 57.060 43.478 0.00 0.0 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.