Multiple sequence alignment - TraesCS6A01G196700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G196700 chr6A 100.000 2318 0 0 1 2318 289128632 289130949 0 4281
1 TraesCS6A01G196700 chr5A 99.397 2320 12 2 1 2318 300072979 300075298 0 4205
2 TraesCS6A01G196700 chr5A 99.008 2318 21 2 1 2318 16602919 16600604 0 4152
3 TraesCS6A01G196700 chr2A 99.310 2320 14 2 1 2318 618279956 618277637 0 4194
4 TraesCS6A01G196700 chrUn 99.181 2320 17 2 1 2318 189392539 189394858 0 4178
5 TraesCS6A01G196700 chr7B 99.095 2320 19 2 1 2318 743086199 743088518 0 4167
6 TraesCS6A01G196700 chr3B 98.965 2319 21 3 1 2318 92199604 92201920 0 4146
7 TraesCS6A01G196700 chr7A 98.795 2324 22 3 1 2318 4959838 4962161 0 4132


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G196700 chr6A 289128632 289130949 2317 False 4281 4281 100.000 1 2318 1 chr6A.!!$F1 2317
1 TraesCS6A01G196700 chr5A 300072979 300075298 2319 False 4205 4205 99.397 1 2318 1 chr5A.!!$F1 2317
2 TraesCS6A01G196700 chr5A 16600604 16602919 2315 True 4152 4152 99.008 1 2318 1 chr5A.!!$R1 2317
3 TraesCS6A01G196700 chr2A 618277637 618279956 2319 True 4194 4194 99.310 1 2318 1 chr2A.!!$R1 2317
4 TraesCS6A01G196700 chrUn 189392539 189394858 2319 False 4178 4178 99.181 1 2318 1 chrUn.!!$F1 2317
5 TraesCS6A01G196700 chr7B 743086199 743088518 2319 False 4167 4167 99.095 1 2318 1 chr7B.!!$F1 2317
6 TraesCS6A01G196700 chr3B 92199604 92201920 2316 False 4146 4146 98.965 1 2318 1 chr3B.!!$F1 2317
7 TraesCS6A01G196700 chr7A 4959838 4962161 2323 False 4132 4132 98.795 1 2318 1 chr7A.!!$F1 2317

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
648 650 2.687935 GCTCTCAAACCAACCAAGACAA 59.312 45.455 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2239 2249 6.18336 TGCTCTCGCCTTTTTGTAATCTTATG 60.183 38.462 0.0 0.0 34.43 1.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
648 650 2.687935 GCTCTCAAACCAACCAAGACAA 59.312 45.455 0.0 0.0 0.0 3.18
1046 1049 0.373716 GCCTTATCACGAAAGCCACG 59.626 55.000 0.0 0.0 0.0 4.94
1573 1578 6.878317 ACAGAGAAAGATTACCGATTCATCA 58.122 36.000 0.0 0.0 0.0 3.07
1745 1755 3.006430 TGCGATTAGAAACCAGTGACTCA 59.994 43.478 0.0 0.0 0.0 3.41
2063 2073 0.032017 AGAGTAGGGTGGCCGAGAAT 60.032 55.000 0.0 0.0 0.0 2.40
2113 2123 1.202903 ACAGACTCTACTCACCCACGT 60.203 52.381 0.0 0.0 0.0 4.49
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
648 650 3.258372 TGTTCTCGATAGGAACTTGCTGT 59.742 43.478 14.75 0.0 42.75 4.40
719 721 5.300286 ACTGAGCTAAGCAACACTTTTTCAT 59.700 36.000 0.00 0.0 39.97 2.57
1046 1049 3.307782 TGACTTCCTCAAACGAAACGAAC 59.692 43.478 0.00 0.0 0.00 3.95
1573 1578 7.771927 ACTCACTTCTGATCAAATTGGATTT 57.228 32.000 0.00 0.0 0.00 2.17
2239 2249 6.183360 TGCTCTCGCCTTTTTGTAATCTTATG 60.183 38.462 0.00 0.0 34.43 1.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.