Multiple sequence alignment - TraesCS6A01G194300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G194300 chr6A 100.000 2456 0 0 1 2456 271186933 271184478 0 4536
1 TraesCS6A01G194300 chrUn 97.334 2476 44 7 1 2456 93414843 93417316 0 4187
2 TraesCS6A01G194300 chr3A 96.956 2464 62 7 1 2456 672912851 672915309 0 4122
3 TraesCS6A01G194300 chr3B 96.918 2466 60 8 1 2456 201524166 201521707 0 4119
4 TraesCS6A01G194300 chr2D 96.723 2472 59 10 1 2456 272796737 272799202 0 4096
5 TraesCS6A01G194300 chr4D 96.229 2466 76 9 1 2456 19925953 19923495 0 4023
6 TraesCS6A01G194300 chr2B 96.280 2231 73 4 236 2456 369624971 369622741 0 3651
7 TraesCS6A01G194300 chr1A 97.514 2132 43 6 1 2126 584780601 584778474 0 3635
8 TraesCS6A01G194300 chr1A 96.280 1559 53 5 900 2456 168442037 168443592 0 2553
9 TraesCS6A01G194300 chr7A 94.331 2205 106 11 1 2197 352184647 352186840 0 3362
10 TraesCS6A01G194300 chr7B 95.712 1889 53 11 583 2456 559141888 559140013 0 3014


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G194300 chr6A 271184478 271186933 2455 True 4536 4536 100.000 1 2456 1 chr6A.!!$R1 2455
1 TraesCS6A01G194300 chrUn 93414843 93417316 2473 False 4187 4187 97.334 1 2456 1 chrUn.!!$F1 2455
2 TraesCS6A01G194300 chr3A 672912851 672915309 2458 False 4122 4122 96.956 1 2456 1 chr3A.!!$F1 2455
3 TraesCS6A01G194300 chr3B 201521707 201524166 2459 True 4119 4119 96.918 1 2456 1 chr3B.!!$R1 2455
4 TraesCS6A01G194300 chr2D 272796737 272799202 2465 False 4096 4096 96.723 1 2456 1 chr2D.!!$F1 2455
5 TraesCS6A01G194300 chr4D 19923495 19925953 2458 True 4023 4023 96.229 1 2456 1 chr4D.!!$R1 2455
6 TraesCS6A01G194300 chr2B 369622741 369624971 2230 True 3651 3651 96.280 236 2456 1 chr2B.!!$R1 2220
7 TraesCS6A01G194300 chr1A 584778474 584780601 2127 True 3635 3635 97.514 1 2126 1 chr1A.!!$R1 2125
8 TraesCS6A01G194300 chr1A 168442037 168443592 1555 False 2553 2553 96.280 900 2456 1 chr1A.!!$F1 1556
9 TraesCS6A01G194300 chr7A 352184647 352186840 2193 False 3362 3362 94.331 1 2197 1 chr7A.!!$F1 2196
10 TraesCS6A01G194300 chr7B 559140013 559141888 1875 True 3014 3014 95.712 583 2456 1 chr7B.!!$R1 1873

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
613 615 0.894835 GGATGGCGGAACAAACCAAT 59.105 50.0 0.0 0.0 36.94 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2363 2402 2.604139 TCCCATTCCACCCAAAACTTC 58.396 47.619 0.0 0.0 0.0 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
100 101 8.967664 AATAACCAACCTATTGCTTCGTATTA 57.032 30.769 0.00 0.00 34.17 0.98
119 120 9.368674 TCGTATTATCGAGATCCTAACTAAGAG 57.631 37.037 0.00 0.00 34.85 2.85
613 615 0.894835 GGATGGCGGAACAAACCAAT 59.105 50.000 0.00 0.00 36.94 3.16
679 681 5.123227 CAGGAAAGAGTAAATATTCGCCCA 58.877 41.667 0.00 0.00 0.00 5.36
972 979 7.465353 TTTACATGCTTTCTGATTCCATTCA 57.535 32.000 0.00 0.00 0.00 2.57
1013 1020 5.440610 AGAAACTCTCATGTCCAGTTTTGT 58.559 37.500 15.70 8.01 39.84 2.83
1188 1203 1.968704 TCACGGCGAGACAGATAGAT 58.031 50.000 16.62 0.00 0.00 1.98
1219 1234 5.107337 CGAAGAGCAATAACACGATATGCAT 60.107 40.000 3.79 3.79 0.00 3.96
1280 1295 2.543635 ACCGGTTACACTAAGACCCAT 58.456 47.619 0.00 0.00 0.00 4.00
2071 2108 7.509659 GGAACCTAGAATTAGAGTCTTATGGGA 59.490 40.741 0.00 0.00 0.00 4.37
2116 2153 7.120923 ACTAACCTCTATAAGAAATGCGGAA 57.879 36.000 0.00 0.00 0.00 4.30
2210 2248 6.320418 ACGAGAGGGTTTTATTGAAAGTGTTT 59.680 34.615 0.00 0.00 0.00 2.83
2387 2426 3.980022 AGTTTTGGGTGGAATGGGAATTT 59.020 39.130 0.00 0.00 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
100 101 6.597562 ACTGTCTCTTAGTTAGGATCTCGAT 58.402 40.000 0.00 0.00 0.00 3.59
942 949 9.241919 TGGAATCAGAAAGCATGTAAATTTCTA 57.758 29.630 13.35 6.69 40.40 2.10
972 979 3.569194 TCTTCTCATCTAGCTCCTCGT 57.431 47.619 0.00 0.00 0.00 4.18
1013 1020 9.976776 TTCTCTTTCTTAGTTCCATCTCTACTA 57.023 33.333 0.00 0.00 0.00 1.82
1188 1203 2.289382 TGTTATTGCTCTTCGTCCTGCA 60.289 45.455 0.00 0.00 0.00 4.41
1219 1234 3.085533 CCCATATTTTTCCACCACGACA 58.914 45.455 0.00 0.00 0.00 4.35
1280 1295 0.390603 CGAGCCCATACGTGTTTCCA 60.391 55.000 0.00 0.00 0.00 3.53
1369 1385 6.405953 GCTGCTCTAGGTACAGTTTCAGATAA 60.406 42.308 0.00 0.00 33.87 1.75
2071 2108 8.947115 GTTAGTAAATCAGCAATAGTGTCCTTT 58.053 33.333 0.00 0.00 0.00 3.11
2210 2248 5.875224 TCTGTTATGTTCCTGATGTTTCCA 58.125 37.500 0.00 0.00 0.00 3.53
2363 2402 2.604139 TCCCATTCCACCCAAAACTTC 58.396 47.619 0.00 0.00 0.00 3.01
2387 2426 8.754991 ATTCCTCGAGAAGTAGAAAGAATAGA 57.245 34.615 15.71 0.00 38.07 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.