Multiple sequence alignment - TraesCS6A01G194200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G194200 chr6A 100.000 2345 0 0 1 2345 271186369 271184025 0 4331
1 TraesCS6A01G194200 chr2D 96.952 2362 52 8 1 2345 272797298 272799656 0 3945
2 TraesCS6A01G194200 chr3B 96.904 2358 58 9 1 2345 201523606 201521251 0 3936
3 TraesCS6A01G194200 chr6D 97.329 2321 48 7 1 2309 168248135 168245817 0 3930
4 TraesCS6A01G194200 chr3A 96.850 2349 62 7 1 2341 672913411 672915755 0 3917
5 TraesCS6A01G194200 chr4D 95.353 2367 81 10 1 2345 19925395 19923036 0 3735
6 TraesCS6A01G194200 chr7B 95.924 2306 66 11 19 2309 559141888 559139596 0 3712
7 TraesCS6A01G194200 chr5D 96.213 2139 55 12 1 2131 329123507 329125627 0 3478
8 TraesCS6A01G194200 chr1A 96.271 2011 66 9 336 2344 168442037 168444040 0 3290
9 TraesCS6A01G194200 chr1A 97.258 1568 36 4 1 1562 584780040 584778474 0 2651
10 TraesCS6A01G194200 chr7A 94.455 1641 75 8 1 1633 352185208 352186840 0 2512
11 TraesCS6A01G194200 chr1D 98.219 1235 15 5 1118 2345 144238516 144237282 0 2152
12 TraesCS6A01G194200 chr4A 97.386 1224 26 5 1126 2345 722779092 722780313 0 2078


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G194200 chr6A 271184025 271186369 2344 True 4331 4331 100.000 1 2345 1 chr6A.!!$R1 2344
1 TraesCS6A01G194200 chr2D 272797298 272799656 2358 False 3945 3945 96.952 1 2345 1 chr2D.!!$F1 2344
2 TraesCS6A01G194200 chr3B 201521251 201523606 2355 True 3936 3936 96.904 1 2345 1 chr3B.!!$R1 2344
3 TraesCS6A01G194200 chr6D 168245817 168248135 2318 True 3930 3930 97.329 1 2309 1 chr6D.!!$R1 2308
4 TraesCS6A01G194200 chr3A 672913411 672915755 2344 False 3917 3917 96.850 1 2341 1 chr3A.!!$F1 2340
5 TraesCS6A01G194200 chr4D 19923036 19925395 2359 True 3735 3735 95.353 1 2345 1 chr4D.!!$R1 2344
6 TraesCS6A01G194200 chr7B 559139596 559141888 2292 True 3712 3712 95.924 19 2309 1 chr7B.!!$R1 2290
7 TraesCS6A01G194200 chr5D 329123507 329125627 2120 False 3478 3478 96.213 1 2131 1 chr5D.!!$F1 2130
8 TraesCS6A01G194200 chr1A 168442037 168444040 2003 False 3290 3290 96.271 336 2344 1 chr1A.!!$F1 2008
9 TraesCS6A01G194200 chr1A 584778474 584780040 1566 True 2651 2651 97.258 1 1562 1 chr1A.!!$R1 1561
10 TraesCS6A01G194200 chr7A 352185208 352186840 1632 False 2512 2512 94.455 1 1633 1 chr7A.!!$F1 1632
11 TraesCS6A01G194200 chr1D 144237282 144238516 1234 True 2152 2152 98.219 1118 2345 1 chr1D.!!$R1 1227
12 TraesCS6A01G194200 chr4A 722779092 722780313 1221 False 2078 2078 97.386 1126 2345 1 chr4A.!!$F1 1219

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
49 50 0.894835 GGATGGCGGAACAAACCAAT 59.105 50.0 0.0 0.0 36.94 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1799 1843 2.604139 TCCCATTCCACCCAAAACTTC 58.396 47.619 0.0 0.0 0.0 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 0.894835 GGATGGCGGAACAAACCAAT 59.105 50.000 0.00 0.00 36.94 3.16
115 116 5.123227 CAGGAAAGAGTAAATATTCGCCCA 58.877 41.667 0.00 0.00 0.00 5.36
408 415 7.465353 TTTACATGCTTTCTGATTCCATTCA 57.535 32.000 0.00 0.00 0.00 2.57
624 639 1.968704 TCACGGCGAGACAGATAGAT 58.031 50.000 16.62 0.00 0.00 1.98
655 670 5.107337 CGAAGAGCAATAACACGATATGCAT 60.107 40.000 3.79 3.79 0.00 3.96
716 731 2.543635 ACCGGTTACACTAAGACCCAT 58.456 47.619 0.00 0.00 0.00 4.00
1507 1549 7.509659 GGAACCTAGAATTAGAGTCTTATGGGA 59.490 40.741 0.00 0.00 0.00 4.37
1552 1594 7.120923 ACTAACCTCTATAAGAAATGCGGAA 57.879 36.000 0.00 0.00 0.00 4.30
1646 1688 6.320418 ACGAGAGGGTTTTATTGAAAGTGTTT 59.680 34.615 0.00 0.00 0.00 2.83
1823 1867 3.980022 AGTTTTGGGTGGAATGGGAATTT 59.020 39.130 0.00 0.00 0.00 1.82
2169 2228 9.217278 GTCTAGTTCTATACGAATACTGATGGA 57.783 37.037 0.00 0.00 33.45 3.41
2216 2275 4.576463 GTCGTTATGATTCAAGCAAGGGAT 59.424 41.667 0.00 0.00 0.00 3.85
2294 2353 4.142609 AGCGAAGATTTGAAGGATAGCA 57.857 40.909 0.00 0.00 0.00 3.49
2330 2389 8.560903 AGGATACCAAAGATTCAAAGGATTAGT 58.439 33.333 0.00 0.00 37.17 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
378 385 9.241919 TGGAATCAGAAAGCATGTAAATTTCTA 57.758 29.630 13.35 6.69 40.40 2.10
408 415 3.569194 TCTTCTCATCTAGCTCCTCGT 57.431 47.619 0.00 0.00 0.00 4.18
624 639 2.289382 TGTTATTGCTCTTCGTCCTGCA 60.289 45.455 0.00 0.00 0.00 4.41
655 670 3.085533 CCCATATTTTTCCACCACGACA 58.914 45.455 0.00 0.00 0.00 4.35
716 731 0.390603 CGAGCCCATACGTGTTTCCA 60.391 55.000 0.00 0.00 0.00 3.53
805 820 6.405953 GCTGCTCTAGGTACAGTTTCAGATAA 60.406 42.308 0.00 0.00 33.87 1.75
1507 1549 8.947115 GTTAGTAAATCAGCAATAGTGTCCTTT 58.053 33.333 0.00 0.00 0.00 3.11
1646 1688 5.875224 TCTGTTATGTTCCTGATGTTTCCA 58.125 37.500 0.00 0.00 0.00 3.53
1799 1843 2.604139 TCCCATTCCACCCAAAACTTC 58.396 47.619 0.00 0.00 0.00 3.01
1823 1867 8.754991 ATTCCTCGAGAAGTAGAAAGAATAGA 57.245 34.615 15.71 0.00 38.07 1.98
2169 2228 7.699878 ACTTACTTCAATTTTGACCCTATCCT 58.300 34.615 0.00 0.00 36.83 3.24
2294 2353 9.312904 TGAATCTTTGGTATCCTTCAAATCTTT 57.687 29.630 0.00 0.00 33.19 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.