Multiple sequence alignment - TraesCS6A01G194100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G194100 chr6A 100.000 2411 0 0 1 2411 271185867 271183457 0 4453
1 TraesCS6A01G194100 chrUn 97.619 2436 33 11 1 2411 93415908 93418343 0 4154
2 TraesCS6A01G194100 chr5D 97.617 2434 35 9 1 2411 560880906 560878473 0 4152
3 TraesCS6A01G194100 chr5D 97.190 1637 36 6 1 1629 329123993 329125627 0 2760
4 TraesCS6A01G194100 chr2D 97.370 2433 42 9 1 2411 272797797 272800229 0 4119
5 TraesCS6A01G194100 chr3B 97.158 2428 48 15 1 2411 201523104 201520681 0 4082
6 TraesCS6A01G194100 chr3A 96.819 2421 58 10 1 2411 672913912 672916323 0 4026
7 TraesCS6A01G194100 chr1A 96.025 2415 83 13 1 2411 168442203 168444608 0 3916
8 TraesCS6A01G194100 chr1A 97.749 1066 18 3 1 1060 584779539 584778474 0 1831
9 TraesCS6A01G194100 chr4D 95.604 2434 75 13 1 2411 19924892 19922468 0 3873
10 TraesCS6A01G194100 chr7B 95.430 2429 67 13 1 2411 559141415 559139013 0 3831
11 TraesCS6A01G194100 chr1D 97.843 1808 27 9 616 2411 144238516 144236709 0 3112
12 TraesCS6A01G194100 chr4A 96.993 1796 42 10 624 2411 722779092 722780883 0 3007
13 TraesCS6A01G194100 chr2B 95.700 1721 59 7 1 1710 369624140 369622424 0 2754


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G194100 chr6A 271183457 271185867 2410 True 4453 4453 100.000 1 2411 1 chr6A.!!$R1 2410
1 TraesCS6A01G194100 chrUn 93415908 93418343 2435 False 4154 4154 97.619 1 2411 1 chrUn.!!$F1 2410
2 TraesCS6A01G194100 chr5D 560878473 560880906 2433 True 4152 4152 97.617 1 2411 1 chr5D.!!$R1 2410
3 TraesCS6A01G194100 chr5D 329123993 329125627 1634 False 2760 2760 97.190 1 1629 1 chr5D.!!$F1 1628
4 TraesCS6A01G194100 chr2D 272797797 272800229 2432 False 4119 4119 97.370 1 2411 1 chr2D.!!$F1 2410
5 TraesCS6A01G194100 chr3B 201520681 201523104 2423 True 4082 4082 97.158 1 2411 1 chr3B.!!$R1 2410
6 TraesCS6A01G194100 chr3A 672913912 672916323 2411 False 4026 4026 96.819 1 2411 1 chr3A.!!$F1 2410
7 TraesCS6A01G194100 chr1A 168442203 168444608 2405 False 3916 3916 96.025 1 2411 1 chr1A.!!$F1 2410
8 TraesCS6A01G194100 chr1A 584778474 584779539 1065 True 1831 1831 97.749 1 1060 1 chr1A.!!$R1 1059
9 TraesCS6A01G194100 chr4D 19922468 19924892 2424 True 3873 3873 95.604 1 2411 1 chr4D.!!$R1 2410
10 TraesCS6A01G194100 chr7B 559139013 559141415 2402 True 3831 3831 95.430 1 2411 1 chr7B.!!$R1 2410
11 TraesCS6A01G194100 chr1D 144236709 144238516 1807 True 3112 3112 97.843 616 2411 1 chr1D.!!$R1 1795
12 TraesCS6A01G194100 chr4A 722779092 722780883 1791 False 3007 3007 96.993 624 2411 1 chr4A.!!$F1 1787
13 TraesCS6A01G194100 chr2B 369622424 369624140 1716 True 2754 2754 95.700 1 1710 1 chr2B.!!$R1 1709

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
122 131 1.968704 TCACGGCGAGACAGATAGAT 58.031 50.0 16.62 0.0 0.0 1.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2087 2143 1.129811 GAACATTTCCGCGGGTACTTG 59.87 52.381 27.83 17.68 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
122 131 1.968704 TCACGGCGAGACAGATAGAT 58.031 50.000 16.62 0.00 0.00 1.98
153 162 5.107337 CGAAGAGCAATAACACGATATGCAT 60.107 40.000 3.79 3.79 0.00 3.96
214 223 2.543635 ACCGGTTACACTAAGACCCAT 58.456 47.619 0.00 0.00 0.00 4.00
666 688 4.385643 CCCAAATGCCTCTAGAAAGATCCA 60.386 45.833 0.00 0.00 0.00 3.41
1005 1038 7.509659 GGAACCTAGAATTAGAGTCTTATGGGA 59.490 40.741 0.00 0.00 0.00 4.37
1050 1083 7.120923 ACTAACCTCTATAAGAAATGCGGAA 57.879 36.000 0.00 0.00 0.00 4.30
1144 1179 6.320418 ACGAGAGGGTTTTATTGAAAGTGTTT 59.680 34.615 0.00 0.00 0.00 2.83
1321 1357 3.980022 AGTTTTGGGTGGAATGGGAATTT 59.020 39.130 0.00 0.00 0.00 1.82
1667 1718 9.217278 GTCTAGTTCTATACGAATACTGATGGA 57.783 37.037 0.00 0.00 33.45 3.41
1714 1765 4.576463 GTCGTTATGATTCAAGCAAGGGAT 59.424 41.667 0.00 0.00 0.00 3.85
1828 1879 8.560903 AGGATACCAAAGATTCAAAGGATTAGT 58.439 33.333 0.00 0.00 37.17 2.24
1999 2053 1.067212 GACTGATTCGTAGGCGTGGAT 59.933 52.381 0.00 0.00 39.49 3.41
2019 2073 5.824624 TGGATGAATTAGAGTCATTTGCTCC 59.175 40.000 0.00 0.00 35.84 4.70
2025 2079 3.726557 AGAGTCATTTGCTCCAATCCA 57.273 42.857 0.00 0.00 33.69 3.41
2074 2129 8.816204 TCTTTCGAAAAAGAACTTTACTTTCG 57.184 30.769 12.41 18.31 46.09 3.46
2300 2366 3.404224 TGGTTTACGTAGGAATGCACA 57.596 42.857 0.00 0.00 0.00 4.57
2312 2378 7.173562 ACGTAGGAATGCACATTTTAGTTTACA 59.826 33.333 0.00 0.00 0.00 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
122 131 2.289382 TGTTATTGCTCTTCGTCCTGCA 60.289 45.455 0.00 0.00 0.00 4.41
153 162 3.085533 CCCATATTTTTCCACCACGACA 58.914 45.455 0.00 0.00 0.00 4.35
214 223 0.390603 CGAGCCCATACGTGTTTCCA 60.391 55.000 0.00 0.00 0.00 3.53
303 314 6.405953 GCTGCTCTAGGTACAGTTTCAGATAA 60.406 42.308 0.00 0.00 33.87 1.75
666 688 7.330208 ACGTACAATTACAGCTCGAATTACTTT 59.670 33.333 2.73 0.00 0.00 2.66
1005 1038 8.947115 GTTAGTAAATCAGCAATAGTGTCCTTT 58.053 33.333 0.00 0.00 0.00 3.11
1144 1179 5.875224 TCTGTTATGTTCCTGATGTTTCCA 58.125 37.500 0.00 0.00 0.00 3.53
1297 1333 2.604139 TCCCATTCCACCCAAAACTTC 58.396 47.619 0.00 0.00 0.00 3.01
1321 1357 8.754991 ATTCCTCGAGAAGTAGAAAGAATAGA 57.245 34.615 15.71 0.00 38.07 1.98
1667 1718 7.699878 ACTTACTTCAATTTTGACCCTATCCT 58.300 34.615 0.00 0.00 36.83 3.24
1999 2053 6.319658 GGATTGGAGCAAATGACTCTAATTCA 59.680 38.462 13.34 0.00 43.05 2.57
2019 2073 5.865552 CCTGTCTTTGTTATGCTTTGGATTG 59.134 40.000 0.00 0.00 0.00 2.67
2025 2079 3.844640 ACCCCTGTCTTTGTTATGCTTT 58.155 40.909 0.00 0.00 0.00 3.51
2074 2129 5.171874 CGCGGGTACTTGTTTTTACTTTTTC 59.828 40.000 0.00 0.00 0.00 2.29
2087 2143 1.129811 GAACATTTCCGCGGGTACTTG 59.870 52.381 27.83 17.68 0.00 3.16
2300 2366 6.482308 ACGTGCACTCTTCTGTAAACTAAAAT 59.518 34.615 16.19 0.00 0.00 1.82
2312 2378 5.386958 TGTTATTCTACGTGCACTCTTCT 57.613 39.130 16.19 0.00 0.00 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.