Multiple sequence alignment - TraesCS6A01G192100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G192100 chr6A 100.000 2267 0 0 1 2267 260116413 260118679 0.000000e+00 4187
1 TraesCS6A01G192100 chrUn 97.887 2272 36 8 1 2267 93409764 93412028 0.000000e+00 3919
2 TraesCS6A01G192100 chr5D 97.841 2270 40 6 1 2267 503218085 503215822 0.000000e+00 3912
3 TraesCS6A01G192100 chr5D 96.942 1831 45 8 440 2267 329120678 329122500 0.000000e+00 3061
4 TraesCS6A01G192100 chr2D 97.753 2270 41 7 1 2266 272794026 272796289 0.000000e+00 3901
5 TraesCS6A01G192100 chr6D 97.489 2270 45 7 1 2266 168251405 168249144 0.000000e+00 3866
6 TraesCS6A01G192100 chr3B 96.894 2286 45 9 1 2267 201526891 201524613 0.000000e+00 3805
7 TraesCS6A01G192100 chr3A 96.920 2273 56 9 1 2267 672910140 672912404 0.000000e+00 3797
8 TraesCS6A01G192100 chr3A 93.548 155 9 1 2096 2250 179810584 179810737 1.750000e-56 230
9 TraesCS6A01G192100 chr7A 93.692 2267 110 11 1 2267 352181967 352184200 0.000000e+00 3363
10 TraesCS6A01G192100 chr5A 96.508 1747 53 5 1 1744 619266238 619264497 0.000000e+00 2881
11 TraesCS6A01G192100 chr4A 94.393 214 10 1 1744 1957 700661601 700661812 6.040000e-86 327
12 TraesCS6A01G192100 chr4A 93.130 131 6 2 2127 2257 675665032 675665159 2.970000e-44 189
13 TraesCS6A01G192100 chr2A 89.691 194 10 6 1797 1989 581940296 581940112 2.910000e-59 239


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G192100 chr6A 260116413 260118679 2266 False 4187 4187 100.000 1 2267 1 chr6A.!!$F1 2266
1 TraesCS6A01G192100 chrUn 93409764 93412028 2264 False 3919 3919 97.887 1 2267 1 chrUn.!!$F1 2266
2 TraesCS6A01G192100 chr5D 503215822 503218085 2263 True 3912 3912 97.841 1 2267 1 chr5D.!!$R1 2266
3 TraesCS6A01G192100 chr5D 329120678 329122500 1822 False 3061 3061 96.942 440 2267 1 chr5D.!!$F1 1827
4 TraesCS6A01G192100 chr2D 272794026 272796289 2263 False 3901 3901 97.753 1 2266 1 chr2D.!!$F1 2265
5 TraesCS6A01G192100 chr6D 168249144 168251405 2261 True 3866 3866 97.489 1 2266 1 chr6D.!!$R1 2265
6 TraesCS6A01G192100 chr3B 201524613 201526891 2278 True 3805 3805 96.894 1 2267 1 chr3B.!!$R1 2266
7 TraesCS6A01G192100 chr3A 672910140 672912404 2264 False 3797 3797 96.920 1 2267 1 chr3A.!!$F2 2266
8 TraesCS6A01G192100 chr7A 352181967 352184200 2233 False 3363 3363 93.692 1 2267 1 chr7A.!!$F1 2266
9 TraesCS6A01G192100 chr5A 619264497 619266238 1741 True 2881 2881 96.508 1 1744 1 chr5A.!!$R1 1743

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
863 866 1.909302 CTACATCCGCCCCTTATCCAT 59.091 52.381 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1702 1710 1.815613 CTCGAGCTTGAGGTCTGAAGA 59.184 52.381 21.73 0.0 40.17 2.87 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
203 204 9.866655 ATATAAGATCCATCTGTCTAGAGATCC 57.133 37.037 11.72 0.00 36.22 3.36
394 395 2.475187 GCTGTAGCGAAACTCATTGCAG 60.475 50.000 0.00 0.00 0.00 4.41
438 439 3.151542 AGATTACCATCTGGGGAGGTT 57.848 47.619 0.54 0.00 38.44 3.50
534 535 2.180276 AGAGCCGGATCTAAGTGTTGT 58.820 47.619 23.29 0.00 0.00 3.32
863 866 1.909302 CTACATCCGCCCCTTATCCAT 59.091 52.381 0.00 0.00 0.00 3.41
1441 1449 1.475682 AGTTCCAACCGATCGTCTACC 59.524 52.381 15.09 0.00 0.00 3.18
1523 1531 4.681942 CAAAGAGTTCTTGACGAGATTCGT 59.318 41.667 3.49 3.49 45.46 3.85
1554 1562 9.079833 GTTACTACGAGCAAACTGTTATGATAA 57.920 33.333 0.00 0.00 0.00 1.75
1612 1620 5.766174 TCTTAAAGTTGGTTTATTCGGCAGT 59.234 36.000 0.00 0.00 30.46 4.40
1919 1946 5.427378 CAGAAACACCATTCCTTTTGGTTT 58.573 37.500 0.00 0.00 45.19 3.27
2046 2074 8.924511 AAAAATAGAATCAGACTCAAGTTCCA 57.075 30.769 0.00 0.00 0.00 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
203 204 7.433719 GCATACGGCTTTCTAGATGTATATGAG 59.566 40.741 0.00 0.00 40.25 2.90
311 312 5.009911 GTGATTTCTATGTTATGCATGGCCA 59.990 40.000 8.56 8.56 38.47 5.36
394 395 1.209747 AGTGGCCGATTTACCCTCTTC 59.790 52.381 0.00 0.00 0.00 2.87
534 535 3.036452 ACTATGGGGCGTTTACCTAGA 57.964 47.619 0.00 0.00 0.00 2.43
789 792 1.378514 ATGCGCGGGTTCAATTCCT 60.379 52.632 8.83 0.00 0.00 3.36
827 830 2.265367 TGTAGCCAAGTGGATCAAGGA 58.735 47.619 0.18 0.00 37.39 3.36
1441 1449 6.201044 TGCTTTGAAAACTCTCTCGAACTTAG 59.799 38.462 0.00 0.00 0.00 2.18
1474 1482 6.945435 TGCTTTGAAAACAGACATAGGGATAA 59.055 34.615 0.00 0.00 0.00 1.75
1539 1547 9.726232 CATGAGGTTCATTATCATAACAGTTTG 57.274 33.333 0.00 0.00 34.28 2.93
1554 1562 2.301296 CTCGATAGGGCATGAGGTTCAT 59.699 50.000 0.00 0.00 37.65 2.57
1612 1620 5.011635 TCCCTATAATGAGTAGCATTTGCGA 59.988 40.000 0.00 0.00 44.68 5.10
1665 1673 1.819903 ACTCCTACTGACTTCGGCTTC 59.180 52.381 0.00 0.00 0.00 3.86
1700 1708 2.628178 TCGAGCTTGAGGTCTGAAGAAA 59.372 45.455 0.00 0.00 40.17 2.52
1701 1709 2.230025 CTCGAGCTTGAGGTCTGAAGAA 59.770 50.000 21.73 0.00 40.17 2.52
1702 1710 1.815613 CTCGAGCTTGAGGTCTGAAGA 59.184 52.381 21.73 0.00 40.17 2.87
1703 1711 2.276472 CTCGAGCTTGAGGTCTGAAG 57.724 55.000 21.73 0.00 40.17 3.02
1862 1889 5.420409 AGTCTGAAACCGAGTGGATTTATC 58.580 41.667 0.00 0.00 39.21 1.75
2179 2207 7.106239 TCTCTAATTCTTCGATTGCTCCTTTT 58.894 34.615 0.00 0.00 0.00 2.27
2180 2208 6.644347 TCTCTAATTCTTCGATTGCTCCTTT 58.356 36.000 0.00 0.00 0.00 3.11


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.