Multiple sequence alignment - TraesCS6A01G188300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G188300 chr6A 100.000 2357 0 0 1 2357 229787056 229784700 0.000000e+00 4353
1 TraesCS6A01G188300 chr2B 98.395 2368 26 4 1 2357 615909341 615911707 0.000000e+00 4152
2 TraesCS6A01G188300 chr2B 97.931 2368 37 4 1 2357 126124900 126122534 0.000000e+00 4091
3 TraesCS6A01G188300 chr7A 97.932 2369 36 5 1 2357 574109057 574106690 0.000000e+00 4091
4 TraesCS6A01G188300 chr7A 98.687 1904 23 2 456 2357 424300200 424302103 0.000000e+00 3376
5 TraesCS6A01G188300 chr4A 97.889 2368 38 6 1 2357 630786654 630784288 0.000000e+00 4085
6 TraesCS6A01G188300 chr1A 97.889 2368 37 7 1 2357 509653880 509656245 0.000000e+00 4084
7 TraesCS6A01G188300 chr1A 84.257 343 44 6 1 333 509664340 509663998 2.260000e-85 326
8 TraesCS6A01G188300 chr4B 97.847 2369 38 5 1 2357 27257721 27260088 0.000000e+00 4080
9 TraesCS6A01G188300 chr4B 97.375 2324 48 7 1 2312 94824394 94822072 0.000000e+00 3941
10 TraesCS6A01G188300 chr4B 85.465 344 38 5 1 333 94813935 94814277 4.820000e-92 348
11 TraesCS6A01G188300 chr1B 97.762 2368 41 6 1 2357 361813501 361811135 0.000000e+00 4069
12 TraesCS6A01G188300 chr3B 93.852 488 18 4 1 477 107984327 107983841 0.000000e+00 725
13 TraesCS6A01G188300 chr7B 85.465 344 38 5 1 333 664976651 664976309 4.820000e-92 348


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G188300 chr6A 229784700 229787056 2356 True 4353 4353 100.000 1 2357 1 chr6A.!!$R1 2356
1 TraesCS6A01G188300 chr2B 615909341 615911707 2366 False 4152 4152 98.395 1 2357 1 chr2B.!!$F1 2356
2 TraesCS6A01G188300 chr2B 126122534 126124900 2366 True 4091 4091 97.931 1 2357 1 chr2B.!!$R1 2356
3 TraesCS6A01G188300 chr7A 574106690 574109057 2367 True 4091 4091 97.932 1 2357 1 chr7A.!!$R1 2356
4 TraesCS6A01G188300 chr7A 424300200 424302103 1903 False 3376 3376 98.687 456 2357 1 chr7A.!!$F1 1901
5 TraesCS6A01G188300 chr4A 630784288 630786654 2366 True 4085 4085 97.889 1 2357 1 chr4A.!!$R1 2356
6 TraesCS6A01G188300 chr1A 509653880 509656245 2365 False 4084 4084 97.889 1 2357 1 chr1A.!!$F1 2356
7 TraesCS6A01G188300 chr4B 27257721 27260088 2367 False 4080 4080 97.847 1 2357 1 chr4B.!!$F1 2356
8 TraesCS6A01G188300 chr4B 94822072 94824394 2322 True 3941 3941 97.375 1 2312 1 chr4B.!!$R1 2311
9 TraesCS6A01G188300 chr1B 361811135 361813501 2366 True 4069 4069 97.762 1 2357 1 chr1B.!!$R1 2356

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
998 1010 0.331954 TAGTCTCCTCCGCCTCTGTT 59.668 55.0 0.0 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2220 2234 3.004944 CGCCATTTCTCCTCTCTACCTAC 59.995 52.174 0.0 0.0 0.0 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 4.473199 GAACGCTATTGTCAAAAAGGACC 58.527 43.478 0.00 0.0 36.97 4.46
80 81 1.856920 TCAAAAAGGACCCCCTGACTT 59.143 47.619 0.00 0.0 43.48 3.01
450 461 0.518636 GCACGCTGATGCTTCTTTCA 59.481 50.000 0.88 0.0 42.62 2.69
541 552 1.748879 GCGGGAAGCTATTGTGCCA 60.749 57.895 0.00 0.0 44.04 4.92
903 915 1.178276 CAGAGTACGACAAGCCTCCT 58.822 55.000 0.00 0.0 0.00 3.69
919 931 3.316308 GCCTCCTGTATGCTTTAACCATG 59.684 47.826 0.00 0.0 0.00 3.66
998 1010 0.331954 TAGTCTCCTCCGCCTCTGTT 59.668 55.000 0.00 0.0 0.00 3.16
1136 1148 0.249955 GCTGAGGAGAAAGCAGAGCT 59.750 55.000 0.00 0.0 42.56 4.09
1216 1228 3.602205 AGAAAAACAGGGAAGAGGCTT 57.398 42.857 0.00 0.0 0.00 4.35
1407 1419 9.520204 CCGCAATCATTTGTATCTTTATTTCTT 57.480 29.630 0.00 0.0 35.17 2.52
1494 1506 0.033642 TTGTGCCGTGTCGTAATGGA 59.966 50.000 3.00 0.0 0.00 3.41
2220 2234 0.109723 TCCGTCTGAAGGGGGTTTTG 59.890 55.000 9.77 0.0 0.00 2.44
2353 2368 3.359523 GAAACGGGTGGCGGAACC 61.360 66.667 0.00 0.0 39.71 3.62
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 7.148918 CCTTTTTGACGTTTTTATCTGCAGATG 60.149 37.037 34.48 20.82 36.05 2.90
450 461 1.366319 AGCCAGACTGATTCTTGGGT 58.634 50.000 3.32 0.00 31.94 4.51
541 552 8.612145 AGTAAATTTTAGGATCCCTGTAGTGTT 58.388 33.333 8.55 0.00 34.61 3.32
687 698 2.092968 TCCGAGCAAGGCAAACTCATAT 60.093 45.455 0.00 0.00 0.00 1.78
903 915 8.800370 TCTATTTGTCATGGTTAAAGCATACA 57.200 30.769 0.00 0.00 34.09 2.29
998 1010 6.701400 CGTGTCAATCCAATGATAGTACATGA 59.299 38.462 0.00 0.00 31.81 3.07
1216 1228 2.580815 CTGCTCCTCCATGCGACA 59.419 61.111 0.00 0.00 0.00 4.35
1407 1419 9.733556 TCCTGAAATAAAGCTACATTAAAGTGA 57.266 29.630 0.00 0.00 0.00 3.41
1532 1545 6.494666 TGTTCGATATTAGTGGAGGGAAAT 57.505 37.500 0.00 0.00 0.00 2.17
2220 2234 3.004944 CGCCATTTCTCCTCTCTACCTAC 59.995 52.174 0.00 0.00 0.00 3.18
2334 2349 3.562232 TTCCGCCACCCGTTTCCT 61.562 61.111 0.00 0.00 34.38 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.