Multiple sequence alignment - TraesCS6A01G183600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G183600 chr6A 100.000 2285 0 0 1 2285 214163117 214160833 0 4220
1 TraesCS6A01G183600 chr3A 98.731 2285 29 0 1 2285 627956949 627954665 0 4060
2 TraesCS6A01G183600 chr3A 98.731 2285 27 2 1 2285 514528941 514531223 0 4058
3 TraesCS6A01G183600 chr6B 98.512 2285 33 1 1 2285 439442973 439440690 0 4030
4 TraesCS6A01G183600 chr7A 98.206 2285 41 0 1 2285 613755276 613752992 0 3993
5 TraesCS6A01G183600 chr7B 98.163 2286 39 2 1 2285 577195719 577193436 0 3986
6 TraesCS6A01G183600 chr1A 98.029 2283 45 0 3 2285 64891384 64889102 0 3967
7 TraesCS6A01G183600 chr5B 97.970 2118 31 2 115 2232 255655796 255657901 0 3663
8 TraesCS6A01G183600 chr5B 98.512 1949 29 0 337 2285 524582648 524580700 0 3439
9 TraesCS6A01G183600 chr1B 95.387 2233 79 9 1 2232 631842863 631845072 0 3531
10 TraesCS6A01G183600 chr2B 96.377 414 11 3 1 412 708697863 708697452 0 678


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G183600 chr6A 214160833 214163117 2284 True 4220 4220 100.000 1 2285 1 chr6A.!!$R1 2284
1 TraesCS6A01G183600 chr3A 627954665 627956949 2284 True 4060 4060 98.731 1 2285 1 chr3A.!!$R1 2284
2 TraesCS6A01G183600 chr3A 514528941 514531223 2282 False 4058 4058 98.731 1 2285 1 chr3A.!!$F1 2284
3 TraesCS6A01G183600 chr6B 439440690 439442973 2283 True 4030 4030 98.512 1 2285 1 chr6B.!!$R1 2284
4 TraesCS6A01G183600 chr7A 613752992 613755276 2284 True 3993 3993 98.206 1 2285 1 chr7A.!!$R1 2284
5 TraesCS6A01G183600 chr7B 577193436 577195719 2283 True 3986 3986 98.163 1 2285 1 chr7B.!!$R1 2284
6 TraesCS6A01G183600 chr1A 64889102 64891384 2282 True 3967 3967 98.029 3 2285 1 chr1A.!!$R1 2282
7 TraesCS6A01G183600 chr5B 255655796 255657901 2105 False 3663 3663 97.970 115 2232 1 chr5B.!!$F1 2117
8 TraesCS6A01G183600 chr5B 524580700 524582648 1948 True 3439 3439 98.512 337 2285 1 chr5B.!!$R1 1948
9 TraesCS6A01G183600 chr1B 631842863 631845072 2209 False 3531 3531 95.387 1 2232 1 chr1B.!!$F1 2231

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
559 561 3.376078 CCTTGGGCGCTGCACATT 61.376 61.111 7.64 0.0 43.39 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1434 1438 0.034089 CCTCCAAGCCCCTTCGAAAT 60.034 55.0 0.0 0.0 0.0 2.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
559 561 3.376078 CCTTGGGCGCTGCACATT 61.376 61.111 7.64 0.0 43.39 2.71
909 912 4.296621 AGGGTTAGGGTTATGTGTGTTC 57.703 45.455 0.00 0.0 0.00 3.18
1070 1074 1.779061 ATGCCGAACAAGTGGGAGGT 61.779 55.000 0.00 0.0 0.00 3.85
1434 1438 2.683968 CAACGGAGGTTCGAAGAATCA 58.316 47.619 0.00 0.0 45.90 2.57
1488 1492 0.325671 AGGAGAGGATGGAGCGGAAA 60.326 55.000 0.00 0.0 0.00 3.13
1756 1760 7.492020 GCTGCCATTTGTCATTTGTAATGAATA 59.508 33.333 3.83 0.0 31.29 1.75
2226 2230 9.474313 AACACAAATACCATAACATAACCTCAT 57.526 29.630 0.00 0.0 0.00 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
196 198 2.031919 TGTAGTGTGGCGCCTTGG 59.968 61.111 29.70 0.0 0.00 3.61
358 360 2.908015 CCTAAGGCCAAGGCGCTA 59.092 61.111 7.64 0.0 43.06 4.26
909 912 4.258543 ACATAACCCTAACACCAACATCG 58.741 43.478 0.00 0.0 0.00 3.84
1070 1074 1.071542 TCACCTTGTCCAAAGATGCGA 59.928 47.619 0.00 0.0 0.00 5.10
1310 1314 2.017049 GAGGCGGTGACTGCATAAAAT 58.983 47.619 19.20 0.0 0.00 1.82
1434 1438 0.034089 CCTCCAAGCCCCTTCGAAAT 60.034 55.000 0.00 0.0 0.00 2.17
1488 1492 1.562783 CCCTCTCCTCCTCTCGTTTT 58.437 55.000 0.00 0.0 0.00 2.43
1756 1760 2.230508 AGTACGACATGGTTCACGACAT 59.769 45.455 0.00 0.0 0.00 3.06
1811 1815 7.798596 ATGAACAAACACAAATTTTATGCCA 57.201 28.000 0.00 0.0 0.00 4.92
2226 2230 7.771361 TGTGAACTTGTGAGGTTGATTAACTTA 59.229 33.333 0.00 0.0 36.99 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.