Multiple sequence alignment - TraesCS6A01G166600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G166600 chr6A 100.000 2441 0 0 1 2441 169510159 169512599 0.000000e+00 4508.0
1 TraesCS6A01G166600 chr4A 99.365 1574 8 2 1 1572 615517703 615516130 0.000000e+00 2850.0
2 TraesCS6A01G166600 chr4A 97.460 1575 29 5 1 1572 358851398 358849832 0.000000e+00 2676.0
3 TraesCS6A01G166600 chr5B 98.095 1575 20 4 1 1572 112183679 112182112 0.000000e+00 2734.0
4 TraesCS6A01G166600 chr5B 95.939 1576 46 10 1 1572 567783269 567784830 0.000000e+00 2540.0
5 TraesCS6A01G166600 chr5B 91.039 770 66 2 1674 2441 337837130 337837898 0.000000e+00 1037.0
6 TraesCS6A01G166600 chr5B 100.000 114 0 0 1561 1674 112181825 112181712 6.840000e-51 211.0
7 TraesCS6A01G166600 chr5B 99.115 113 1 0 1561 1673 44864155 44864043 1.140000e-48 204.0
8 TraesCS6A01G166600 chr5B 99.115 113 1 0 1561 1673 219091379 219091267 1.140000e-48 204.0
9 TraesCS6A01G166600 chr2B 96.954 1576 37 5 1 1572 520928828 520927260 0.000000e+00 2634.0
10 TraesCS6A01G166600 chr3D 94.378 1512 67 4 1 1511 535389945 535388451 0.000000e+00 2305.0
11 TraesCS6A01G166600 chr3D 94.785 767 40 0 1674 2440 306505514 306504748 0.000000e+00 1195.0
12 TraesCS6A01G166600 chr3D 95.391 499 23 0 1674 2172 75641907 75641409 0.000000e+00 795.0
13 TraesCS6A01G166600 chr3D 92.029 138 11 0 2304 2441 616434 616297 6.890000e-46 195.0
14 TraesCS6A01G166600 chr3D 97.059 34 1 0 1470 1503 535388374 535388341 9.430000e-05 58.4
15 TraesCS6A01G166600 chr1A 95.047 848 33 2 91 938 181765236 181764398 0.000000e+00 1325.0
16 TraesCS6A01G166600 chr1A 96.474 709 25 0 1674 2382 551850816 551851524 0.000000e+00 1171.0
17 TraesCS6A01G166600 chr1A 96.201 658 18 6 921 1572 181761833 181761177 0.000000e+00 1070.0
18 TraesCS6A01G166600 chr1D 95.052 768 38 0 1674 2441 447446582 447447349 0.000000e+00 1208.0
19 TraesCS6A01G166600 chr7D 94.661 768 41 0 1674 2441 475090920 475091687 0.000000e+00 1192.0
20 TraesCS6A01G166600 chr7D 94.401 768 43 0 1674 2441 245413358 245412591 0.000000e+00 1181.0
21 TraesCS6A01G166600 chr7D 99.115 113 1 0 1561 1673 203043908 203043796 1.140000e-48 204.0
22 TraesCS6A01G166600 chr7D 99.115 113 1 0 1561 1673 518670048 518669936 1.140000e-48 204.0
23 TraesCS6A01G166600 chr4D 94.661 768 41 0 1674 2441 454811398 454810631 0.000000e+00 1192.0
24 TraesCS6A01G166600 chr4D 99.123 114 1 0 1561 1674 329013519 329013632 3.180000e-49 206.0
25 TraesCS6A01G166600 chr4D 99.115 113 1 0 1561 1673 323550279 323550167 1.140000e-48 204.0
26 TraesCS6A01G166600 chr5A 93.229 768 52 0 1674 2441 367848396 367847629 0.000000e+00 1131.0
27 TraesCS6A01G166600 chrUn 77.147 1409 274 30 5 1382 19255813 19254422 0.000000e+00 774.0
28 TraesCS6A01G166600 chr6D 77.237 1397 262 34 5 1374 456817166 456818533 0.000000e+00 767.0
29 TraesCS6A01G166600 chr5D 84.912 623 84 6 827 1448 434817171 434817784 2.670000e-174 621.0
30 TraesCS6A01G166600 chr5D 99.115 113 1 0 1561 1673 294332591 294332479 1.140000e-48 204.0
31 TraesCS6A01G166600 chr2D 75.965 1140 221 38 275 1379 412790281 412789160 2.760000e-149 538.0
32 TraesCS6A01G166600 chr2D 100.000 115 0 0 1561 1675 337396596 337396482 1.900000e-51 213.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G166600 chr6A 169510159 169512599 2440 False 4508.0 4508 100.0000 1 2441 1 chr6A.!!$F1 2440
1 TraesCS6A01G166600 chr4A 615516130 615517703 1573 True 2850.0 2850 99.3650 1 1572 1 chr4A.!!$R2 1571
2 TraesCS6A01G166600 chr4A 358849832 358851398 1566 True 2676.0 2676 97.4600 1 1572 1 chr4A.!!$R1 1571
3 TraesCS6A01G166600 chr5B 567783269 567784830 1561 False 2540.0 2540 95.9390 1 1572 1 chr5B.!!$F2 1571
4 TraesCS6A01G166600 chr5B 112181712 112183679 1967 True 1472.5 2734 99.0475 1 1674 2 chr5B.!!$R3 1673
5 TraesCS6A01G166600 chr5B 337837130 337837898 768 False 1037.0 1037 91.0390 1674 2441 1 chr5B.!!$F1 767
6 TraesCS6A01G166600 chr2B 520927260 520928828 1568 True 2634.0 2634 96.9540 1 1572 1 chr2B.!!$R1 1571
7 TraesCS6A01G166600 chr3D 306504748 306505514 766 True 1195.0 1195 94.7850 1674 2440 1 chr3D.!!$R3 766
8 TraesCS6A01G166600 chr3D 535388341 535389945 1604 True 1181.7 2305 95.7185 1 1511 2 chr3D.!!$R4 1510
9 TraesCS6A01G166600 chr1A 181761177 181765236 4059 True 1197.5 1325 95.6240 91 1572 2 chr1A.!!$R1 1481
10 TraesCS6A01G166600 chr1A 551850816 551851524 708 False 1171.0 1171 96.4740 1674 2382 1 chr1A.!!$F1 708
11 TraesCS6A01G166600 chr1D 447446582 447447349 767 False 1208.0 1208 95.0520 1674 2441 1 chr1D.!!$F1 767
12 TraesCS6A01G166600 chr7D 475090920 475091687 767 False 1192.0 1192 94.6610 1674 2441 1 chr7D.!!$F1 767
13 TraesCS6A01G166600 chr7D 245412591 245413358 767 True 1181.0 1181 94.4010 1674 2441 1 chr7D.!!$R2 767
14 TraesCS6A01G166600 chr4D 454810631 454811398 767 True 1192.0 1192 94.6610 1674 2441 1 chr4D.!!$R2 767
15 TraesCS6A01G166600 chr5A 367847629 367848396 767 True 1131.0 1131 93.2290 1674 2441 1 chr5A.!!$R1 767
16 TraesCS6A01G166600 chrUn 19254422 19255813 1391 True 774.0 774 77.1470 5 1382 1 chrUn.!!$R1 1377
17 TraesCS6A01G166600 chr6D 456817166 456818533 1367 False 767.0 767 77.2370 5 1374 1 chr6D.!!$F1 1369
18 TraesCS6A01G166600 chr5D 434817171 434817784 613 False 621.0 621 84.9120 827 1448 1 chr5D.!!$F1 621
19 TraesCS6A01G166600 chr2D 412789160 412790281 1121 True 538.0 538 75.9650 275 1379 1 chr2D.!!$R2 1104

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
775 801 3.026694 GCCTTGCTTATGACCTCCAATT 58.973 45.455 0.0 0.0 0.0 2.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1772 4730 1.632018 CGGGGGCTGATTTCCAGGTA 61.632 60.0 0.0 0.0 43.13 3.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
683 693 8.964476 TCTTCTTGACTCTATGTTTCAAGTTT 57.036 30.769 9.70 0.00 44.42 2.66
684 694 9.046296 TCTTCTTGACTCTATGTTTCAAGTTTC 57.954 33.333 9.70 0.00 44.42 2.78
685 695 8.731275 TTCTTGACTCTATGTTTCAAGTTTCA 57.269 30.769 9.70 0.00 44.42 2.69
686 696 8.731275 TCTTGACTCTATGTTTCAAGTTTCAA 57.269 30.769 9.70 0.00 44.42 2.69
775 801 3.026694 GCCTTGCTTATGACCTCCAATT 58.973 45.455 0.00 0.00 0.00 2.32
1216 3833 2.354805 GGTCTAAGTGGACGCCATCTTT 60.355 50.000 13.94 7.92 35.28 2.52
1257 3877 4.390129 TTTCAGTGAGTCTAGTCCTCCT 57.610 45.455 8.90 4.52 0.00 3.69
1750 4708 2.731691 TTCAGCCACCAGTCTTCCGC 62.732 60.000 0.00 0.00 0.00 5.54
1772 4730 2.281761 CCAAACTGCTCGCTGGGT 60.282 61.111 0.99 0.00 0.00 4.51
2365 5325 3.801114 AGTCATACGACAAGCAGCATA 57.199 42.857 0.00 0.00 45.23 3.14
2390 5350 0.827507 TGGCCTGCACTTCCTTTTCC 60.828 55.000 3.32 0.00 0.00 3.13
2434 5394 2.960688 GCCGCTCTTCCAAGTCCCT 61.961 63.158 0.00 0.00 0.00 4.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
680 690 4.531659 ACAAGCAAGTAGACGTTGAAAC 57.468 40.909 0.00 0.00 0.00 2.78
681 691 5.122554 TGAAACAAGCAAGTAGACGTTGAAA 59.877 36.000 0.00 0.00 0.00 2.69
682 692 4.632251 TGAAACAAGCAAGTAGACGTTGAA 59.368 37.500 0.00 0.00 0.00 2.69
683 693 4.185394 TGAAACAAGCAAGTAGACGTTGA 58.815 39.130 0.00 0.00 0.00 3.18
684 694 4.530094 TGAAACAAGCAAGTAGACGTTG 57.470 40.909 0.00 0.00 0.00 4.10
685 695 4.634443 AGTTGAAACAAGCAAGTAGACGTT 59.366 37.500 0.00 0.00 0.00 3.99
686 696 4.189231 AGTTGAAACAAGCAAGTAGACGT 58.811 39.130 0.00 0.00 0.00 4.34
775 801 6.744112 AGACTAATGATCCGTTTTGCAAAAA 58.256 32.000 25.40 11.51 0.00 1.94
1216 3833 2.203788 ACCACGAGCCCTCCTTGA 60.204 61.111 0.00 0.00 0.00 3.02
1257 3877 6.889198 AGTGTAAAAGATATTAGAGCCAGCA 58.111 36.000 0.00 0.00 0.00 4.41
1750 4708 4.389576 GCGAGCAGTTTGGCACGG 62.390 66.667 7.07 0.00 45.81 4.94
1772 4730 1.632018 CGGGGGCTGATTTCCAGGTA 61.632 60.000 0.00 0.00 43.13 3.08
2390 5350 4.680237 TGGCTTCCGGACAGCACG 62.680 66.667 28.15 7.90 39.21 5.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.