Multiple sequence alignment - TraesCS6A01G162400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G162400 chr6A 100.000 2285 0 0 1 2285 157652231 157654515 0 4220
1 TraesCS6A01G162400 chr6A 98.481 1777 27 0 509 2285 214162609 214160833 0 3133
2 TraesCS6A01G162400 chr6A 98.835 515 6 0 1 515 214163268 214162754 0 918
3 TraesCS6A01G162400 chr3A 99.045 1780 17 0 506 2285 514529444 514531223 0 3193
4 TraesCS6A01G162400 chr3A 98.593 1777 25 0 509 2285 627956441 627954665 0 3144
5 TraesCS6A01G162400 chr3A 99.223 515 4 0 1 515 627957100 627956586 0 929
6 TraesCS6A01G162400 chr3A 98.828 512 5 1 1 512 514528790 514529300 0 911
7 TraesCS6A01G162400 chr6B 98.649 1777 23 1 509 2285 439442465 439440690 0 3147
8 TraesCS6A01G162400 chr6B 98.447 515 8 0 1 515 439443124 439442610 0 907
9 TraesCS6A01G162400 chr7A 98.537 1777 26 0 509 2285 613754768 613752992 0 3138
10 TraesCS6A01G162400 chr7A 98.058 515 10 0 1 515 613755427 613754913 0 896
11 TraesCS6A01G162400 chr2B 98.537 1777 26 0 509 2285 708697126 708695350 0 3138
12 TraesCS6A01G162400 chr2B 98.441 513 7 1 1 512 673834537 673835049 0 902
13 TraesCS6A01G162400 chr2B 98.444 514 5 2 1 512 708698014 708697502 0 902
14 TraesCS6A01G162400 chr5B 98.424 1777 28 0 509 2285 524582476 524580700 0 3127
15 TraesCS6A01G162400 chr5B 98.835 515 6 0 1 515 332626827 332626313 0 918
16 TraesCS6A01G162400 chr7B 98.424 1777 26 1 509 2285 577195210 577193436 0 3125
17 TraesCS6A01G162400 chr7B 97.481 516 12 1 1 515 577195870 577195355 0 880
18 TraesCS6A01G162400 chr1A 98.477 1773 27 0 513 2285 64890874 64889102 0 3125


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G162400 chr6A 157652231 157654515 2284 False 4220.0 4220 100.0000 1 2285 1 chr6A.!!$F1 2284
1 TraesCS6A01G162400 chr6A 214160833 214163268 2435 True 2025.5 3133 98.6580 1 2285 2 chr6A.!!$R1 2284
2 TraesCS6A01G162400 chr3A 514528790 514531223 2433 False 2052.0 3193 98.9365 1 2285 2 chr3A.!!$F1 2284
3 TraesCS6A01G162400 chr3A 627954665 627957100 2435 True 2036.5 3144 98.9080 1 2285 2 chr3A.!!$R1 2284
4 TraesCS6A01G162400 chr6B 439440690 439443124 2434 True 2027.0 3147 98.5480 1 2285 2 chr6B.!!$R1 2284
5 TraesCS6A01G162400 chr7A 613752992 613755427 2435 True 2017.0 3138 98.2975 1 2285 2 chr7A.!!$R1 2284
6 TraesCS6A01G162400 chr2B 708695350 708698014 2664 True 2020.0 3138 98.4905 1 2285 2 chr2B.!!$R1 2284
7 TraesCS6A01G162400 chr2B 673834537 673835049 512 False 902.0 902 98.4410 1 512 1 chr2B.!!$F1 511
8 TraesCS6A01G162400 chr5B 524580700 524582476 1776 True 3127.0 3127 98.4240 509 2285 1 chr5B.!!$R2 1776
9 TraesCS6A01G162400 chr5B 332626313 332626827 514 True 918.0 918 98.8350 1 515 1 chr5B.!!$R1 514
10 TraesCS6A01G162400 chr7B 577193436 577195870 2434 True 2002.5 3125 97.9525 1 2285 2 chr7B.!!$R1 2284
11 TraesCS6A01G162400 chr1A 64889102 64890874 1772 True 3125.0 3125 98.4770 513 2285 1 chr1A.!!$R1 1772

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
357 360 2.124695 CCTAAGGTCAAGGCGCCC 60.125 66.667 26.15 7.48 0.0 6.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2056 2590 0.475437 ACCCCACCCAAAATGGCATT 60.475 50.0 6.96 6.96 35.79 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
293 296 5.889289 AGTTTTTGTGGTGGAAAAGCTACTA 59.111 36.000 0.00 0.00 33.60 1.82
357 360 2.124695 CCTAAGGTCAAGGCGCCC 60.125 66.667 26.15 7.48 0.00 6.13
694 1228 5.837979 CCCTCTCAAATCCTTCTCAGATCTA 59.162 44.000 0.00 0.00 0.00 1.98
891 1425 4.278975 AGGCTTTCATAGTATGCTAGGC 57.721 45.455 20.58 20.58 36.74 3.93
1220 1754 3.070878 TGCCCGAACTATGCTTATGATCA 59.929 43.478 0.00 0.00 0.00 2.92
2056 2590 5.920273 GCTATAAGCAAAACTGCAGAAACAA 59.080 36.000 23.35 0.00 41.89 2.83
2154 2688 9.284968 TGCTAAGCAAAGAGAACTAATAACTTT 57.715 29.630 0.00 0.00 34.76 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
293 296 1.882989 GAGAGCACCAGGAGCGTTCT 61.883 60.000 2.85 1.75 37.01 3.01
357 360 1.135315 GCGCTGCATTGTGTAGTGG 59.865 57.895 0.00 0.00 40.25 4.00
511 1045 3.121030 CTACACAGTGCAGCGCCC 61.121 66.667 2.29 0.00 0.00 6.13
694 1228 4.081862 TCGAAATCCACGGTCAAATACTCT 60.082 41.667 0.00 0.00 0.00 3.24
891 1425 6.817765 ACATCAAACACACATAACCCTAAG 57.182 37.500 0.00 0.00 0.00 2.18
1220 1754 1.165270 GGCGTTAGTTGGAAGTGCAT 58.835 50.000 0.00 0.00 0.00 3.96
1986 2520 1.404181 CGCTGCACTATACTGTGTGGT 60.404 52.381 0.00 0.00 39.89 4.16
1997 2531 1.737236 CAACATTTAGGCGCTGCACTA 59.263 47.619 7.64 0.00 0.00 2.74
2056 2590 0.475437 ACCCCACCCAAAATGGCATT 60.475 50.000 6.96 6.96 35.79 3.56


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.