Multiple sequence alignment - TraesCS6A01G153000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G153000 chr6A 100.000 4603 0 0 1 4603 137878177 137873575 0.000000e+00 8501
1 TraesCS6A01G153000 chr5A 98.169 3331 52 5 697 4023 591480290 591476965 0.000000e+00 5805
2 TraesCS6A01G153000 chr5A 97.229 3284 76 6 750 4023 300961582 300958304 0.000000e+00 5546
3 TraesCS6A01G153000 chr2B 95.077 3616 163 10 1 3612 178340571 178344175 0.000000e+00 5677
4 TraesCS6A01G153000 chr2B 97.498 3318 69 8 715 4023 364331383 364334695 0.000000e+00 5655
5 TraesCS6A01G153000 chr2B 94.172 3569 182 16 1 3561 29747360 29750910 0.000000e+00 5415
6 TraesCS6A01G153000 chr2B 99.314 583 4 0 4021 4603 440605651 440605069 0.000000e+00 1055
7 TraesCS6A01G153000 chr3A 97.956 3278 56 5 752 4023 237059384 237056112 0.000000e+00 5672
8 TraesCS6A01G153000 chr5B 97.836 3281 59 6 750 4023 281826179 281829454 0.000000e+00 5655
9 TraesCS6A01G153000 chr5B 96.146 1012 27 8 1 1010 528760174 528759173 0.000000e+00 1642
10 TraesCS6A01G153000 chr5B 99.469 754 2 1 1 754 351462511 351463262 0.000000e+00 1369
11 TraesCS6A01G153000 chr5B 99.142 583 5 0 4021 4603 281831179 281831761 0.000000e+00 1050
12 TraesCS6A01G153000 chr5B 99.142 583 5 0 4021 4603 436478228 436477646 0.000000e+00 1050
13 TraesCS6A01G153000 chr5B 99.142 583 5 0 4021 4603 471293259 471293841 0.000000e+00 1050
14 TraesCS6A01G153000 chr7A 97.259 3284 75 6 750 4023 16011551 16008273 0.000000e+00 5552
15 TraesCS6A01G153000 chr7A 98.214 560 8 2 25 583 594633823 594634381 0.000000e+00 977
16 TraesCS6A01G153000 chr7A 94.521 219 10 2 575 792 719930912 719931129 2.050000e-88 337
17 TraesCS6A01G153000 chr4A 94.137 3565 186 14 1 3561 660216208 660212663 0.000000e+00 5404
18 TraesCS6A01G153000 chr4B 99.315 584 4 0 4020 4603 649624843 649624260 0.000000e+00 1057
19 TraesCS6A01G153000 chr4B 99.142 583 5 0 4021 4603 655792654 655792072 0.000000e+00 1050
20 TraesCS6A01G153000 chr2A 99.314 583 4 0 4021 4603 728935346 728934764 0.000000e+00 1055
21 TraesCS6A01G153000 chr2A 99.142 583 5 0 4021 4603 148613610 148614192 0.000000e+00 1050
22 TraesCS6A01G153000 chrUn 99.142 583 5 0 4021 4603 437460718 437460136 0.000000e+00 1050
23 TraesCS6A01G153000 chr3B 97.248 218 5 1 575 792 40985294 40985510 7.280000e-98 368


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G153000 chr6A 137873575 137878177 4602 True 8501.0 8501 100.000 1 4603 1 chr6A.!!$R1 4602
1 TraesCS6A01G153000 chr5A 591476965 591480290 3325 True 5805.0 5805 98.169 697 4023 1 chr5A.!!$R2 3326
2 TraesCS6A01G153000 chr5A 300958304 300961582 3278 True 5546.0 5546 97.229 750 4023 1 chr5A.!!$R1 3273
3 TraesCS6A01G153000 chr2B 178340571 178344175 3604 False 5677.0 5677 95.077 1 3612 1 chr2B.!!$F2 3611
4 TraesCS6A01G153000 chr2B 364331383 364334695 3312 False 5655.0 5655 97.498 715 4023 1 chr2B.!!$F3 3308
5 TraesCS6A01G153000 chr2B 29747360 29750910 3550 False 5415.0 5415 94.172 1 3561 1 chr2B.!!$F1 3560
6 TraesCS6A01G153000 chr2B 440605069 440605651 582 True 1055.0 1055 99.314 4021 4603 1 chr2B.!!$R1 582
7 TraesCS6A01G153000 chr3A 237056112 237059384 3272 True 5672.0 5672 97.956 752 4023 1 chr3A.!!$R1 3271
8 TraesCS6A01G153000 chr5B 281826179 281831761 5582 False 3352.5 5655 98.489 750 4603 2 chr5B.!!$F3 3853
9 TraesCS6A01G153000 chr5B 528759173 528760174 1001 True 1642.0 1642 96.146 1 1010 1 chr5B.!!$R2 1009
10 TraesCS6A01G153000 chr5B 351462511 351463262 751 False 1369.0 1369 99.469 1 754 1 chr5B.!!$F1 753
11 TraesCS6A01G153000 chr5B 436477646 436478228 582 True 1050.0 1050 99.142 4021 4603 1 chr5B.!!$R1 582
12 TraesCS6A01G153000 chr5B 471293259 471293841 582 False 1050.0 1050 99.142 4021 4603 1 chr5B.!!$F2 582
13 TraesCS6A01G153000 chr7A 16008273 16011551 3278 True 5552.0 5552 97.259 750 4023 1 chr7A.!!$R1 3273
14 TraesCS6A01G153000 chr7A 594633823 594634381 558 False 977.0 977 98.214 25 583 1 chr7A.!!$F1 558
15 TraesCS6A01G153000 chr4A 660212663 660216208 3545 True 5404.0 5404 94.137 1 3561 1 chr4A.!!$R1 3560
16 TraesCS6A01G153000 chr4B 649624260 649624843 583 True 1057.0 1057 99.315 4020 4603 1 chr4B.!!$R1 583
17 TraesCS6A01G153000 chr4B 655792072 655792654 582 True 1050.0 1050 99.142 4021 4603 1 chr4B.!!$R2 582
18 TraesCS6A01G153000 chr2A 728934764 728935346 582 True 1055.0 1055 99.314 4021 4603 1 chr2A.!!$R1 582
19 TraesCS6A01G153000 chr2A 148613610 148614192 582 False 1050.0 1050 99.142 4021 4603 1 chr2A.!!$F1 582
20 TraesCS6A01G153000 chrUn 437460136 437460718 582 True 1050.0 1050 99.142 4021 4603 1 chrUn.!!$R1 582

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
812 817 3.884895 TGTTCAATAGAATGGCGGATGT 58.115 40.909 0.0 0.0 35.92 3.06 F
1106 1117 2.711547 AGGTAAGAAGCAAGACTGGGTT 59.288 45.455 0.0 0.0 0.00 4.11 F
1857 1868 0.599558 GATTGCAGCTTGACTTGGCA 59.400 50.000 0.0 0.0 0.00 4.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1857 1868 0.635009 TACCTCCCTTCCTCCGACAT 59.365 55.000 0.00 0.00 0.00 3.06 R
2203 2222 1.923356 AAGGCAACCAATGTACCTGG 58.077 50.000 9.09 9.09 40.05 4.45 R
3872 3905 2.759973 CTGGCGTCTGGCTCCCTA 60.760 66.667 0.00 0.00 42.94 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
812 817 3.884895 TGTTCAATAGAATGGCGGATGT 58.115 40.909 0.00 0.00 35.92 3.06
940 949 6.499106 TCATATGGCATAACTTGGAGAAGA 57.501 37.500 11.86 0.00 32.98 2.87
1106 1117 2.711547 AGGTAAGAAGCAAGACTGGGTT 59.288 45.455 0.00 0.00 0.00 4.11
1591 1602 3.494254 ACCAACCCGTGCCCTCAA 61.494 61.111 0.00 0.00 0.00 3.02
1857 1868 0.599558 GATTGCAGCTTGACTTGGCA 59.400 50.000 0.00 0.00 0.00 4.92
2125 2136 0.681733 GGACACCTTGACTGCTGAGA 59.318 55.000 0.00 0.00 0.00 3.27
2185 2204 9.162764 TCAAGAATGAAACTTATGTAGCTAACC 57.837 33.333 0.00 0.00 30.99 2.85
2203 2222 8.045176 AGCTAACCATGTATCTCTTTGTTTTC 57.955 34.615 0.00 0.00 0.00 2.29
4070 5830 4.398358 CCATTTGTCTACTGAGTAGTCCGA 59.602 45.833 18.33 8.33 37.41 4.55
4111 5871 1.679305 GTGCCTCGTCCTCCTCTCA 60.679 63.158 0.00 0.00 0.00 3.27
4256 6016 0.398522 ATCCCCGTGCATAGGACTCA 60.399 55.000 12.15 0.00 30.97 3.41
4291 6051 1.338674 CCTCCGTAACCAATCTGCACA 60.339 52.381 0.00 0.00 0.00 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
14 15 2.496470 GGGCGAGAGAAAGTTTCCTCTA 59.504 50.000 21.59 0.00 39.64 2.43
352 354 9.327628 TCAATTTCATCATCTCTTTTGCAAAAA 57.672 25.926 23.92 11.27 0.00 1.94
1106 1117 8.918961 ACACAAATGAGAAACAACGAAAATTA 57.081 26.923 0.00 0.00 0.00 1.40
1503 1514 2.203549 CTTGCCTTCCTGAGGGTCCC 62.204 65.000 0.00 0.00 46.40 4.46
1591 1602 1.167851 CAACCACGTCATTGGCATCT 58.832 50.000 0.00 0.00 40.77 2.90
1857 1868 0.635009 TACCTCCCTTCCTCCGACAT 59.365 55.000 0.00 0.00 0.00 3.06
2125 2136 6.097915 TCTCATCGAACTACTCAAAACCTT 57.902 37.500 0.00 0.00 0.00 3.50
2185 2204 6.824305 ACCTGGAAAACAAAGAGATACATG 57.176 37.500 0.00 0.00 0.00 3.21
2203 2222 1.923356 AAGGCAACCAATGTACCTGG 58.077 50.000 9.09 9.09 40.05 4.45
3872 3905 2.759973 CTGGCGTCTGGCTCCCTA 60.760 66.667 0.00 0.00 42.94 3.53
4070 5830 0.853530 ACAAGAAGGGAAAGTGGCCT 59.146 50.000 3.32 0.00 0.00 5.19
4111 5871 2.898840 CAAGGGCTCGCGATGCAT 60.899 61.111 24.72 0.00 0.00 3.96


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.