Multiple sequence alignment - TraesCS6A01G152900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G152900 chr6A 100.000 2264 0 0 1 2264 137872483 137874746 0 4181
1 TraesCS6A01G152900 chr5B 99.284 1677 11 1 1 1676 351469616 351467940 0 3029
2 TraesCS6A01G152900 chr5B 99.164 1675 14 0 1 1675 436476554 436478228 0 3016
3 TraesCS6A01G152900 chr5B 99.493 592 3 0 1673 2264 351466341 351465750 0 1077
4 TraesCS6A01G152900 chr5B 99.322 590 4 0 1673 2262 281829454 281828865 0 1068
5 TraesCS6A01G152900 chr7B 99.224 1675 13 0 1 1675 133432653 133430979 0 3022
6 TraesCS6A01G152900 chr7B 98.986 592 6 0 1673 2264 618531616 618531025 0 1061
7 TraesCS6A01G152900 chr2A 99.224 1675 13 0 1 1675 148615284 148613610 0 3022
8 TraesCS6A01G152900 chr2A 99.224 1675 13 0 1 1675 728933672 728935346 0 3022
9 TraesCS6A01G152900 chr1B 99.224 1675 13 0 1 1675 649301320 649299646 0 3022
10 TraesCS6A01G152900 chr7A 99.165 1676 13 1 1 1675 16005011 16006686 0 3016
11 TraesCS6A01G152900 chr7A 99.164 1675 14 0 1 1675 497719530 497717856 0 3016
12 TraesCS6A01G152900 chr7A 98.986 592 6 0 1673 2264 121918942 121918351 0 1061
13 TraesCS6A01G152900 chr7A 96.812 596 15 1 1673 2264 16008273 16008868 0 992
14 TraesCS6A01G152900 chr5A 99.164 1675 14 0 1 1675 591473726 591475400 0 3016
15 TraesCS6A01G152900 chr5A 98.311 592 10 0 1673 2264 591476965 591477556 0 1038
16 TraesCS6A01G152900 chr5A 96.812 596 15 1 1673 2264 300958304 300958899 0 992
17 TraesCS6A01G152900 chr3A 99.493 592 3 0 1673 2264 237056112 237056703 0 1077
18 TraesCS6A01G152900 chr2B 98.986 592 6 0 1673 2264 364334695 364334104 0 1061


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G152900 chr6A 137872483 137874746 2263 False 4181 4181 100.0000 1 2264 1 chr6A.!!$F1 2263
1 TraesCS6A01G152900 chr5B 436476554 436478228 1674 False 3016 3016 99.1640 1 1675 1 chr5B.!!$F1 1674
2 TraesCS6A01G152900 chr5B 351465750 351469616 3866 True 2053 3029 99.3885 1 2264 2 chr5B.!!$R2 2263
3 TraesCS6A01G152900 chr5B 281828865 281829454 589 True 1068 1068 99.3220 1673 2262 1 chr5B.!!$R1 589
4 TraesCS6A01G152900 chr7B 133430979 133432653 1674 True 3022 3022 99.2240 1 1675 1 chr7B.!!$R1 1674
5 TraesCS6A01G152900 chr7B 618531025 618531616 591 True 1061 1061 98.9860 1673 2264 1 chr7B.!!$R2 591
6 TraesCS6A01G152900 chr2A 148613610 148615284 1674 True 3022 3022 99.2240 1 1675 1 chr2A.!!$R1 1674
7 TraesCS6A01G152900 chr2A 728933672 728935346 1674 False 3022 3022 99.2240 1 1675 1 chr2A.!!$F1 1674
8 TraesCS6A01G152900 chr1B 649299646 649301320 1674 True 3022 3022 99.2240 1 1675 1 chr1B.!!$R1 1674
9 TraesCS6A01G152900 chr7A 497717856 497719530 1674 True 3016 3016 99.1640 1 1675 1 chr7A.!!$R2 1674
10 TraesCS6A01G152900 chr7A 16005011 16008868 3857 False 2004 3016 97.9885 1 2264 2 chr7A.!!$F1 2263
11 TraesCS6A01G152900 chr7A 121918351 121918942 591 True 1061 1061 98.9860 1673 2264 1 chr7A.!!$R1 591
12 TraesCS6A01G152900 chr5A 591473726 591477556 3830 False 2027 3016 98.7375 1 2264 2 chr5A.!!$F2 2263
13 TraesCS6A01G152900 chr5A 300958304 300958899 595 False 992 992 96.8120 1673 2264 1 chr5A.!!$F1 591
14 TraesCS6A01G152900 chr3A 237056112 237056703 591 False 1077 1077 99.4930 1673 2264 1 chr3A.!!$F1 591
15 TraesCS6A01G152900 chr2B 364334104 364334695 591 True 1061 1061 98.9860 1673 2264 1 chr2B.!!$R1 591

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
662 665 1.000496 GGTCGAGGAAGAACGAGTGTT 60.0 52.381 0.0 0.0 42.23 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1583 1586 1.679305 GTGCCTCGTCCTCCTCTCA 60.679 63.158 0.0 0.0 0.0 3.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
599 602 3.277142 AGAAAAACAAGTCGTGGAGGT 57.723 42.857 0.00 0.0 0.00 3.85
662 665 1.000496 GGTCGAGGAAGAACGAGTGTT 60.000 52.381 0.00 0.0 42.23 3.32
1078 1081 2.358737 CGTGGTTGGAGGCCAGTC 60.359 66.667 5.01 0.0 36.57 3.51
1583 1586 2.898840 CAAGGGCTCGCGATGCAT 60.899 61.111 24.72 0.0 0.00 3.96
1624 1627 0.853530 ACAAGAAGGGAAAGTGGCCT 59.146 50.000 3.32 0.0 0.00 5.19
1822 5031 2.759973 CTGGCGTCTGGCTCCCTA 60.760 66.667 0.00 0.0 42.94 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
662 665 1.615116 CGACCACCACTACCACCTCTA 60.615 57.143 0.00 0.00 0.00 2.43
947 950 7.256756 AGACATTAAGAGAGCAAATGCATAC 57.743 36.000 8.28 0.00 45.16 2.39
1078 1081 3.580458 TCCTTCTCCTTCTTCTTGTCCAG 59.420 47.826 0.00 0.00 0.00 3.86
1403 1406 1.338674 CCTCCGTAACCAATCTGCACA 60.339 52.381 0.00 0.00 0.00 4.57
1438 1441 0.398522 ATCCCCGTGCATAGGACTCA 60.399 55.000 12.15 0.00 30.97 3.41
1583 1586 1.679305 GTGCCTCGTCCTCCTCTCA 60.679 63.158 0.00 0.00 0.00 3.27
1624 1627 4.398358 CCATTTGTCTACTGAGTAGTCCGA 59.602 45.833 18.33 8.33 37.41 4.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.