Multiple sequence alignment - TraesCS6A01G148300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G148300 chr6A 100.000 2270 0 0 1 2270 129346413 129348682 0.000000 4193.0
1 TraesCS6A01G148300 chr6A 93.575 607 20 1 1683 2270 113532 112926 0.000000 887.0
2 TraesCS6A01G148300 chr7A 95.609 2300 71 3 1 2270 30219362 30217063 0.000000 3661.0
3 TraesCS6A01G148300 chr7A 97.007 1771 34 1 519 2270 482197540 482199310 0.000000 2959.0
4 TraesCS6A01G148300 chr1B 94.560 2298 96 2 2 2270 269304937 269302640 0.000000 3524.0
5 TraesCS6A01G148300 chr1B 83.976 1504 217 12 788 2270 403121375 403122875 0.000000 1421.0
6 TraesCS6A01G148300 chr1A 94.311 2074 94 4 215 2268 392523219 392521150 0.000000 3155.0
7 TraesCS6A01G148300 chr1A 97.005 1202 17 1 1088 2270 316896803 316898004 0.000000 2002.0
8 TraesCS6A01G148300 chr1A 95.166 1117 25 9 1 1107 316894393 316895490 0.000000 1736.0
9 TraesCS6A01G148300 chr3B 95.309 1812 64 4 479 2270 772140624 772138814 0.000000 2856.0
10 TraesCS6A01G148300 chr3B 89.583 48 5 0 283 330 439338935 439338888 0.000007 62.1
11 TraesCS6A01G148300 chr7B 84.827 1417 210 5 788 2202 229833475 229834888 0.000000 1421.0
12 TraesCS6A01G148300 chr7B 83.927 1207 169 7 1085 2270 602644948 602646150 0.000000 1131.0
13 TraesCS6A01G148300 chr5A 83.056 1505 227 17 788 2270 69028452 69026954 0.000000 1341.0
14 TraesCS6A01G148300 chr5A 92.500 40 3 0 283 322 328955842 328955881 0.000088 58.4
15 TraesCS6A01G148300 chr3A 95.448 659 11 1 1631 2270 507103347 507102689 0.000000 1033.0
16 TraesCS6A01G148300 chr4B 89.583 48 5 0 283 330 94511051 94511004 0.000007 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G148300 chr6A 129346413 129348682 2269 False 4193 4193 100.0000 1 2270 1 chr6A.!!$F1 2269
1 TraesCS6A01G148300 chr6A 112926 113532 606 True 887 887 93.5750 1683 2270 1 chr6A.!!$R1 587
2 TraesCS6A01G148300 chr7A 30217063 30219362 2299 True 3661 3661 95.6090 1 2270 1 chr7A.!!$R1 2269
3 TraesCS6A01G148300 chr7A 482197540 482199310 1770 False 2959 2959 97.0070 519 2270 1 chr7A.!!$F1 1751
4 TraesCS6A01G148300 chr1B 269302640 269304937 2297 True 3524 3524 94.5600 2 2270 1 chr1B.!!$R1 2268
5 TraesCS6A01G148300 chr1B 403121375 403122875 1500 False 1421 1421 83.9760 788 2270 1 chr1B.!!$F1 1482
6 TraesCS6A01G148300 chr1A 392521150 392523219 2069 True 3155 3155 94.3110 215 2268 1 chr1A.!!$R1 2053
7 TraesCS6A01G148300 chr1A 316894393 316898004 3611 False 1869 2002 96.0855 1 2270 2 chr1A.!!$F1 2269
8 TraesCS6A01G148300 chr3B 772138814 772140624 1810 True 2856 2856 95.3090 479 2270 1 chr3B.!!$R2 1791
9 TraesCS6A01G148300 chr7B 229833475 229834888 1413 False 1421 1421 84.8270 788 2202 1 chr7B.!!$F1 1414
10 TraesCS6A01G148300 chr7B 602644948 602646150 1202 False 1131 1131 83.9270 1085 2270 1 chr7B.!!$F2 1185
11 TraesCS6A01G148300 chr5A 69026954 69028452 1498 True 1341 1341 83.0560 788 2270 1 chr5A.!!$R1 1482
12 TraesCS6A01G148300 chr3A 507102689 507103347 658 True 1033 1033 95.4480 1631 2270 1 chr3A.!!$R1 639

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
575 587 1.136329 ACTCCATCCACCAACAGCCT 61.136 55.0 0.0 0.0 0.0 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2163 3509 4.232221 CGAAGGCGTTGACTAACTCTTTA 58.768 43.478 0.0 0.0 34.6 1.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 143 1.320344 CCCGGTGAATCGACAGAGGA 61.320 60.000 0.00 0.00 0.00 3.71
173 184 2.436646 CGCTGTCATCCCGGCTTT 60.437 61.111 0.00 0.00 34.46 3.51
473 484 2.751436 ATTGCTGGCGCCGAACAT 60.751 55.556 23.90 8.65 34.43 2.71
517 529 4.862092 CGCCTCGTCTCATGCGCT 62.862 66.667 9.73 0.00 40.58 5.92
575 587 1.136329 ACTCCATCCACCAACAGCCT 61.136 55.000 0.00 0.00 0.00 4.58
812 824 1.606531 CTCCTCAAAGCTCCCAGGG 59.393 63.158 0.00 0.00 0.00 4.45
1082 1095 3.539604 GTGAAATGATGACTGAGGAGGG 58.460 50.000 0.00 0.00 0.00 4.30
2163 3509 6.240894 TGTCAAATCCTCTTTCACAAGCTAT 58.759 36.000 0.00 0.00 0.00 2.97
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
118 129 3.258123 TGAACACATCCTCTGTCGATTCA 59.742 43.478 0.00 0.00 35.29 2.57
132 143 1.069513 TCCGGAAGTCGTTGAACACAT 59.930 47.619 0.00 0.00 37.11 3.21
173 184 1.079621 TTTCGGGACCTCCTGCCTA 59.920 57.895 0.00 0.00 42.21 3.93
517 529 0.601558 GTAGTCGAGGAGGTTGCACA 59.398 55.000 0.00 0.00 0.00 4.57
602 614 3.647771 GGGAGGAGGTGGGCGTTT 61.648 66.667 0.00 0.00 0.00 3.60
639 651 2.416836 CGTTGGCGACCTCATTCTTCTA 60.417 50.000 0.00 0.00 41.33 2.10
812 824 4.459089 GCTGGTCGGAGCAGTCCC 62.459 72.222 30.93 15.86 44.96 4.46
1082 1095 3.680642 ATGCGACATACTTGTTGATGC 57.319 42.857 0.00 0.00 39.29 3.91
2163 3509 4.232221 CGAAGGCGTTGACTAACTCTTTA 58.768 43.478 0.00 0.00 34.60 1.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.