Multiple sequence alignment - TraesCS6A01G118600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G118600 chr6A 100.000 2438 0 0 1 2438 89709532 89707095 0 4503
1 TraesCS6A01G118600 chr6A 99.139 2438 21 0 1 2438 89750422 89747985 0 4386
2 TraesCS6A01G118600 chr6A 96.639 2440 74 8 1 2438 411709539 411707106 0 4045
3 TraesCS6A01G118600 chr6A 96.641 2441 71 11 1 2438 203854670 203852238 0 4043
4 TraesCS6A01G118600 chr7A 96.803 2440 70 8 1 2438 271652634 271650201 0 4067
5 TraesCS6A01G118600 chr7A 96.641 2441 74 7 1 2438 495462675 495460240 0 4047
6 TraesCS6A01G118600 chr2A 96.679 2439 73 8 1 2438 647969063 647971494 0 4048
7 TraesCS6A01G118600 chr2A 96.600 2441 73 8 1 2438 517765563 517763130 0 4039
8 TraesCS6A01G118600 chr2A 96.600 2441 72 10 1 2438 594479287 594476855 0 4037
9 TraesCS6A01G118600 chr4A 96.598 2440 72 10 1 2438 475494022 475491592 0 4036


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G118600 chr6A 89707095 89709532 2437 True 4503 4503 100.000 1 2438 1 chr6A.!!$R1 2437
1 TraesCS6A01G118600 chr6A 89747985 89750422 2437 True 4386 4386 99.139 1 2438 1 chr6A.!!$R2 2437
2 TraesCS6A01G118600 chr6A 411707106 411709539 2433 True 4045 4045 96.639 1 2438 1 chr6A.!!$R4 2437
3 TraesCS6A01G118600 chr6A 203852238 203854670 2432 True 4043 4043 96.641 1 2438 1 chr6A.!!$R3 2437
4 TraesCS6A01G118600 chr7A 271650201 271652634 2433 True 4067 4067 96.803 1 2438 1 chr7A.!!$R1 2437
5 TraesCS6A01G118600 chr7A 495460240 495462675 2435 True 4047 4047 96.641 1 2438 1 chr7A.!!$R2 2437
6 TraesCS6A01G118600 chr2A 647969063 647971494 2431 False 4048 4048 96.679 1 2438 1 chr2A.!!$F1 2437
7 TraesCS6A01G118600 chr2A 517763130 517765563 2433 True 4039 4039 96.600 1 2438 1 chr2A.!!$R1 2437
8 TraesCS6A01G118600 chr2A 594476855 594479287 2432 True 4037 4037 96.600 1 2438 1 chr2A.!!$R2 2437
9 TraesCS6A01G118600 chr4A 475491592 475494022 2430 True 4036 4036 96.598 1 2438 1 chr4A.!!$R1 2437

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
224 225 0.531657 TTTGGCGAGCATTCCAATGG 59.468 50.0 0.0 0.0 41.49 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1678 1684 4.900684 TGAATAACACAAATCACCCGAGA 58.099 39.13 0.0 0.0 0.0 4.04 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
211 212 2.414559 CCTCATACAAGCTTGTTTGGCG 60.415 50.000 34.74 27.62 42.35 5.69
221 222 1.000385 CTTGTTTGGCGAGCATTCCAA 60.000 47.619 0.00 0.25 40.31 3.53
224 225 0.531657 TTTGGCGAGCATTCCAATGG 59.468 50.000 0.00 0.00 41.49 3.16
437 440 8.158025 TCTAGGGTCTTGGATTAAAAGATTCA 57.842 34.615 0.00 0.00 36.14 2.57
438 441 8.267894 TCTAGGGTCTTGGATTAAAAGATTCAG 58.732 37.037 0.00 0.00 36.14 3.02
537 540 3.032459 CCTCCAACCCTAAGACCTCTAC 58.968 54.545 0.00 0.00 0.00 2.59
2041 2055 6.734137 TGTGTATTTCGAGAAAGTGCAAATT 58.266 32.000 4.54 0.00 33.32 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
211 212 3.072768 AGAGGAGATCCATTGGAATGCTC 59.927 47.826 23.88 23.88 38.91 4.26
221 222 4.277788 TGAAGAAGGAGAGGAGATCCAT 57.722 45.455 0.92 0.00 39.47 3.41
224 225 5.395214 GGAACTTGAAGAAGGAGAGGAGATC 60.395 48.000 0.00 0.00 32.95 2.75
437 440 1.700186 GGGTTTCAGGTCTTCCTCACT 59.300 52.381 0.00 0.00 43.07 3.41
438 441 1.700186 AGGGTTTCAGGTCTTCCTCAC 59.300 52.381 0.00 0.00 43.07 3.51
1678 1684 4.900684 TGAATAACACAAATCACCCGAGA 58.099 39.130 0.00 0.00 0.00 4.04


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.