Multiple sequence alignment - TraesCS6A01G114500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G114500 chr6A 100.000 2487 0 0 1 2487 84434144 84436630 0.000000e+00 4593
1 TraesCS6A01G114500 chrUn 98.794 2487 27 1 1 2487 282364696 282362213 0.000000e+00 4423
2 TraesCS6A01G114500 chrUn 98.673 2487 30 1 1 2487 86510012 86507529 0.000000e+00 4407
3 TraesCS6A01G114500 chr6B 98.754 2488 26 3 1 2487 596620324 596622807 0.000000e+00 4418
4 TraesCS6A01G114500 chr3B 98.351 2487 35 3 1 2487 92317838 92320318 0.000000e+00 4361
5 TraesCS6A01G114500 chr2B 98.231 2487 36 5 1 2487 30670611 30668133 0.000000e+00 4342
6 TraesCS6A01G114500 chr2B 95.190 395 18 1 1 395 716506520 716506913 7.550000e-175 623
7 TraesCS6A01G114500 chr2B 97.482 278 7 0 607 884 615943043 615943320 2.240000e-130 475
8 TraesCS6A01G114500 chr2B 91.866 209 10 2 1543 1751 36976231 36976030 4.050000e-73 285
9 TraesCS6A01G114500 chr2B 97.458 118 3 0 1734 1851 648197234 648197117 4.190000e-48 202
10 TraesCS6A01G114500 chr2B 98.165 109 2 0 1950 2058 235057584 235057692 9.080000e-45 191
11 TraesCS6A01G114500 chr2B 98.969 97 1 0 1457 1553 719877662 719877566 9.140000e-40 174
12 TraesCS6A01G114500 chr2B 91.743 109 8 1 902 1010 1808181 1808288 1.540000e-32 150
13 TraesCS6A01G114500 chr2B 94.505 91 5 0 557 647 357609085 357608995 9.270000e-30 141
14 TraesCS6A01G114500 chr4A 97.831 2490 47 6 1 2487 67576684 67574199 0.000000e+00 4292
15 TraesCS6A01G114500 chr3D 97.748 2487 50 2 1 2487 154704960 154702480 0.000000e+00 4277
16 TraesCS6A01G114500 chr3A 97.708 2487 52 3 1 2487 694375570 694373089 0.000000e+00 4272


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G114500 chr6A 84434144 84436630 2486 False 4593 4593 100.000 1 2487 1 chr6A.!!$F1 2486
1 TraesCS6A01G114500 chrUn 282362213 282364696 2483 True 4423 4423 98.794 1 2487 1 chrUn.!!$R2 2486
2 TraesCS6A01G114500 chrUn 86507529 86510012 2483 True 4407 4407 98.673 1 2487 1 chrUn.!!$R1 2486
3 TraesCS6A01G114500 chr6B 596620324 596622807 2483 False 4418 4418 98.754 1 2487 1 chr6B.!!$F1 2486
4 TraesCS6A01G114500 chr3B 92317838 92320318 2480 False 4361 4361 98.351 1 2487 1 chr3B.!!$F1 2486
5 TraesCS6A01G114500 chr2B 30668133 30670611 2478 True 4342 4342 98.231 1 2487 1 chr2B.!!$R1 2486
6 TraesCS6A01G114500 chr4A 67574199 67576684 2485 True 4292 4292 97.831 1 2487 1 chr4A.!!$R1 2486
7 TraesCS6A01G114500 chr3D 154702480 154704960 2480 True 4277 4277 97.748 1 2487 1 chr3D.!!$R1 2486
8 TraesCS6A01G114500 chr3A 694373089 694375570 2481 True 4272 4272 97.708 1 2487 1 chr3A.!!$R1 2486

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
141 143 0.771127 CCCCTCAACTCAACCCTGAA 59.229 55.0 0.0 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1922 1930 1.959085 GTGCAAAGCAGCTTAGCCA 59.041 52.632 8.45 3.16 40.08 4.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
59 60 1.002087 AGTTTAGGACAGAACAGGCCG 59.998 52.381 0.00 0.00 0.00 6.13
60 61 1.053424 TTTAGGACAGAACAGGCCGT 58.947 50.000 0.00 0.00 0.00 5.68
97 99 0.818938 TTTCGCGTATAGCCACCTCA 59.181 50.000 5.77 0.00 44.76 3.86
141 143 0.771127 CCCCTCAACTCAACCCTGAA 59.229 55.000 0.00 0.00 0.00 3.02
762 766 1.808411 AACGTAACAGGAGCACCATG 58.192 50.000 2.07 0.59 38.94 3.66
1069 1073 4.020928 TCGGATTGTTACAACCTCTAGCAA 60.021 41.667 0.00 0.00 0.00 3.91
1161 1165 4.035675 GCTCCAGTGGCTACATTTATGTTC 59.964 45.833 3.51 0.00 41.97 3.18
1284 1288 9.515226 GGTGTTTATGGAATAATTATAGCAGGA 57.485 33.333 0.00 0.00 38.83 3.86
1891 1899 5.309806 ACCCTACATAGAAGAACCACAGTTT 59.690 40.000 0.00 0.00 35.94 2.66
1922 1930 2.702478 GGTATAACCTTTAGCTCCCCGT 59.298 50.000 0.00 0.00 34.73 5.28
1936 1944 1.675641 CCCGTGGCTAAGCTGCTTT 60.676 57.895 21.29 4.94 0.00 3.51
2062 2070 2.432146 TCCGTAAATCAGAGAGCATGCT 59.568 45.455 22.92 22.92 0.00 3.79
2274 2289 1.408702 GTGCTTGGTGGAAAAGAAGCA 59.591 47.619 0.00 0.00 46.49 3.91
2405 2420 3.646715 CTTCGGGGACAAGGGGCA 61.647 66.667 0.00 0.00 0.00 5.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
141 143 2.548067 CCTGACCAAGTTTGCGTACTCT 60.548 50.000 0.00 0.00 0.00 3.24
617 621 7.360101 CGAAAGAAAGTGAAATGTCCTATCGTT 60.360 37.037 0.00 0.00 0.00 3.85
812 816 6.306199 CCTGGTTGACCCAATCATGATATTA 58.694 40.000 9.04 0.00 44.65 0.98
864 868 2.584391 GGCCTGACCTGGTCGACTT 61.584 63.158 21.15 0.00 34.95 3.01
865 869 2.997897 GGCCTGACCTGGTCGACT 60.998 66.667 21.15 0.00 34.95 4.18
1161 1165 2.743928 GCCCAAGCGACCAGACTG 60.744 66.667 0.00 0.00 0.00 3.51
1284 1288 2.083628 CCCCCGTCTTACTAGACCAT 57.916 55.000 0.00 0.00 46.63 3.55
1922 1930 1.959085 GTGCAAAGCAGCTTAGCCA 59.041 52.632 8.45 3.16 40.08 4.75
1936 1944 9.109393 GAATCTTAATTAACTATCAGTGGTGCA 57.891 33.333 0.00 0.00 0.00 4.57
2191 2201 4.681978 CCGATTCGATCCGCCCCC 62.682 72.222 7.83 0.00 0.00 5.40
2274 2289 1.263217 CAAGCGAGCGTACCTTTGTTT 59.737 47.619 0.00 0.00 0.00 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.