Multiple sequence alignment - TraesCS6A01G104400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G104400 chr6A 100.000 1971 0 0 780 2750 73513082 73515052 0.000000e+00 3640
1 TraesCS6A01G104400 chr6A 98.081 1980 24 3 780 2747 47630861 47632838 0.000000e+00 3434
2 TraesCS6A01G104400 chr6A 100.000 284 0 0 1 284 73512303 73512586 2.430000e-145 525
3 TraesCS6A01G104400 chr6A 98.239 284 5 0 1 284 47630333 47630616 5.290000e-137 497
4 TraesCS6A01G104400 chr6A 97.232 289 2 2 1 284 158422342 158422055 4.120000e-133 484
5 TraesCS6A01G104400 chr7B 97.581 1984 24 5 786 2747 628738983 628740964 0.000000e+00 3376
6 TraesCS6A01G104400 chr7B 97.483 1867 25 3 905 2750 75059456 75057591 0.000000e+00 3168
7 TraesCS6A01G104400 chr7B 98.674 754 10 0 780 1533 628738159 628738912 0.000000e+00 1338
8 TraesCS6A01G104400 chr7B 99.296 284 2 0 1 284 628737768 628738051 5.250000e-142 514
9 TraesCS6A01G104400 chr6B 97.918 1921 32 2 835 2747 482807136 482809056 0.000000e+00 3319
10 TraesCS6A01G104400 chr6B 97.718 1271 20 5 905 2166 482844098 482842828 0.000000e+00 2178
11 TraesCS6A01G104400 chr6B 98.505 736 11 0 2015 2750 482842426 482841691 0.000000e+00 1299
12 TraesCS6A01G104400 chr6B 97.232 289 2 2 1 284 482826414 482826127 4.120000e-133 484
13 TraesCS6A01G104400 chr7A 96.626 1986 31 13 789 2747 28239713 28241689 0.000000e+00 3264
14 TraesCS6A01G104400 chr5A 97.308 1932 35 6 835 2750 641773750 641771820 0.000000e+00 3264
15 TraesCS6A01G104400 chr2B 97.340 1767 25 3 1005 2750 616526696 616524931 0.000000e+00 2983
16 TraesCS6A01G104400 chr2B 90.223 1258 89 11 835 2061 723353363 723352109 0.000000e+00 1611
17 TraesCS6A01G104400 chr2B 98.592 284 3 1 1 284 616527911 616527629 4.090000e-138 501
18 TraesCS6A01G104400 chr1A 97.719 1315 14 4 864 2166 266885943 266887253 0.000000e+00 2248
19 TraesCS6A01G104400 chr1A 98.239 284 4 1 1 284 266885321 266885603 1.900000e-136 496
20 TraesCS6A01G104400 chr2A 96.498 1228 24 4 835 2050 167356303 167355083 0.000000e+00 2012
21 TraesCS6A01G104400 chr2A 98.239 284 5 0 1 284 70025584 70025301 5.290000e-137 497
22 TraesCS6A01G104400 chr3B 91.602 1298 69 15 780 2048 680330882 680329596 0.000000e+00 1757
23 TraesCS6A01G104400 chrUn 99.296 284 2 0 1 284 460548737 460549020 5.250000e-142 514
24 TraesCS6A01G104400 chrUn 97.183 284 7 1 1 284 377222460 377222178 1.920000e-131 479
25 TraesCS6A01G104400 chr4A 85.806 155 11 8 787 939 741125775 741125920 1.320000e-33 154


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G104400 chr6A 73512303 73515052 2749 False 2082.500000 3640 100.0000 1 2750 2 chr6A.!!$F2 2749
1 TraesCS6A01G104400 chr6A 47630333 47632838 2505 False 1965.500000 3434 98.1600 1 2747 2 chr6A.!!$F1 2746
2 TraesCS6A01G104400 chr7B 75057591 75059456 1865 True 3168.000000 3168 97.4830 905 2750 1 chr7B.!!$R1 1845
3 TraesCS6A01G104400 chr7B 628737768 628740964 3196 False 1742.666667 3376 98.5170 1 2747 3 chr7B.!!$F1 2746
4 TraesCS6A01G104400 chr6B 482807136 482809056 1920 False 3319.000000 3319 97.9180 835 2747 1 chr6B.!!$F1 1912
5 TraesCS6A01G104400 chr6B 482841691 482844098 2407 True 1738.500000 2178 98.1115 905 2750 2 chr6B.!!$R2 1845
6 TraesCS6A01G104400 chr7A 28239713 28241689 1976 False 3264.000000 3264 96.6260 789 2747 1 chr7A.!!$F1 1958
7 TraesCS6A01G104400 chr5A 641771820 641773750 1930 True 3264.000000 3264 97.3080 835 2750 1 chr5A.!!$R1 1915
8 TraesCS6A01G104400 chr2B 616524931 616527911 2980 True 1742.000000 2983 97.9660 1 2750 2 chr2B.!!$R2 2749
9 TraesCS6A01G104400 chr2B 723352109 723353363 1254 True 1611.000000 1611 90.2230 835 2061 1 chr2B.!!$R1 1226
10 TraesCS6A01G104400 chr1A 266885321 266887253 1932 False 1372.000000 2248 97.9790 1 2166 2 chr1A.!!$F1 2165
11 TraesCS6A01G104400 chr2A 167355083 167356303 1220 True 2012.000000 2012 96.4980 835 2050 1 chr2A.!!$R2 1215
12 TraesCS6A01G104400 chr3B 680329596 680330882 1286 True 1757.000000 1757 91.6020 780 2048 1 chr3B.!!$R1 1268

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
116 117 3.916761 TCTTTTTACTGTGGCGACGTAT 58.083 40.909 0.0 0.0 0.0 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2513 5063 1.007734 GTCACACGTCTCCGCTTCA 60.008 57.895 0.0 0.0 37.7 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
116 117 3.916761 TCTTTTTACTGTGGCGACGTAT 58.083 40.909 0.00 0.00 0.00 3.06
1326 2430 3.518998 CCTGACCTCGTCGGCGAT 61.519 66.667 14.65 0.00 46.80 4.58
1347 2451 4.697756 CGCCGCCTTCTTGTCCCA 62.698 66.667 0.00 0.00 0.00 4.37
1743 3721 1.138247 GTTGGGTAGCGACGACGAT 59.862 57.895 12.29 7.51 42.66 3.73
1758 3738 6.616393 CGACGACGATGAGTAGTTATTTTTC 58.384 40.000 0.00 0.00 38.82 2.29
1844 3826 8.120465 CGGTAATGTTGAATGGACTATGTAAAC 58.880 37.037 0.00 0.00 0.00 2.01
2513 5063 3.361977 GGCACGTTTGGCGGATGT 61.362 61.111 0.00 0.00 46.52 3.06
2524 5074 2.167861 GCGGATGTGAAGCGGAGAC 61.168 63.158 0.00 0.00 0.00 3.36
2747 5298 7.363705 CCTGGAAAATGGTAGAAAATGCATACA 60.364 37.037 0.00 0.00 0.00 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2513 5063 1.007734 GTCACACGTCTCCGCTTCA 60.008 57.895 0.0 0.0 37.7 3.02
2645 5196 0.312416 TTCGTTCATTTTGGCCGTGG 59.688 50.000 0.0 0.0 0.0 4.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.