Multiple sequence alignment - TraesCS6A01G100900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G100900 chr6A 100.000 5056 0 0 1 5056 68545446 68550501 0.000000e+00 9337.0
1 TraesCS6A01G100900 chr6A 98.433 766 12 0 3 768 253345167 253344402 0.000000e+00 1349.0
2 TraesCS6A01G100900 chr2A 98.904 4289 45 2 768 5056 180203434 180199148 0.000000e+00 7659.0
3 TraesCS6A01G100900 chr2A 97.274 4292 113 4 766 5056 132616130 132611842 0.000000e+00 7275.0
4 TraesCS6A01G100900 chr2A 98.564 766 10 1 1 765 294997869 294997104 0.000000e+00 1352.0
5 TraesCS6A01G100900 chr2A 88.319 565 48 12 3757 4315 705824933 705824381 0.000000e+00 662.0
6 TraesCS6A01G100900 chr2A 86.219 283 36 3 3735 4016 695656790 695657070 2.290000e-78 303.0
7 TraesCS6A01G100900 chr4A 97.575 4289 92 5 769 5056 29805674 29801397 0.000000e+00 7334.0
8 TraesCS6A01G100900 chr4A 95.140 1852 80 8 3208 5056 677889651 677887807 0.000000e+00 2913.0
9 TraesCS6A01G100900 chr1D 96.131 4187 135 16 880 5056 468413311 468417480 0.000000e+00 6809.0
10 TraesCS6A01G100900 chr1D 82.334 634 69 24 1502 2118 475822089 475821482 1.260000e-140 510.0
11 TraesCS6A01G100900 chr2D 94.385 3562 167 19 1503 5055 390622137 390625674 0.000000e+00 5439.0
12 TraesCS6A01G100900 chr2D 96.596 940 31 1 2907 3845 81593689 81592750 0.000000e+00 1557.0
13 TraesCS6A01G100900 chr2D 93.403 1046 57 8 4014 5056 81574413 81573377 0.000000e+00 1539.0
14 TraesCS6A01G100900 chr2D 94.992 599 28 2 2907 3504 81598992 81598395 0.000000e+00 939.0
15 TraesCS6A01G100900 chr2D 91.753 582 32 6 1503 2079 81631622 81631052 0.000000e+00 795.0
16 TraesCS6A01G100900 chr2D 94.495 109 6 0 2801 2909 81630754 81630646 8.710000e-38 169.0
17 TraesCS6A01G100900 chr2D 92.982 114 8 0 2796 2909 81597596 81597483 3.130000e-37 167.0
18 TraesCS6A01G100900 chr6D 93.919 2582 117 18 2483 5055 393958284 393960834 0.000000e+00 3862.0
19 TraesCS6A01G100900 chr6D 86.224 1009 106 25 1721 2713 14581070 14582061 0.000000e+00 1062.0
20 TraesCS6A01G100900 chr6D 92.102 709 34 9 1503 2206 393957591 393958282 0.000000e+00 979.0
21 TraesCS6A01G100900 chr6D 86.177 463 59 3 1909 2369 14580429 14580888 3.520000e-136 496.0
22 TraesCS6A01G100900 chr5A 93.755 1153 66 5 3909 5056 219234270 219235421 0.000000e+00 1725.0
23 TraesCS6A01G100900 chr5A 92.713 741 54 0 766 1506 219232327 219233067 0.000000e+00 1070.0
24 TraesCS6A01G100900 chr5A 91.364 220 18 1 3520 3738 401725734 401725953 2.960000e-77 300.0
25 TraesCS6A01G100900 chr5A 100.000 52 0 0 1503 1554 648915467 648915518 4.170000e-16 97.1
26 TraesCS6A01G100900 chr7B 93.582 1153 55 12 3909 5056 301889963 301891101 0.000000e+00 1701.0
27 TraesCS6A01G100900 chr7B 93.117 741 51 0 766 1506 301888020 301888760 0.000000e+00 1086.0
28 TraesCS6A01G100900 chr7A 86.482 1339 142 22 3735 5056 104997932 104996616 0.000000e+00 1434.0
29 TraesCS6A01G100900 chr7A 98.312 770 11 2 1 769 203072065 203071297 0.000000e+00 1349.0
30 TraesCS6A01G100900 chrUn 98.440 769 11 1 1 768 202264685 202263917 0.000000e+00 1352.0
31 TraesCS6A01G100900 chrUn 98.309 769 12 1 1 768 377089283 377088515 0.000000e+00 1347.0
32 TraesCS6A01G100900 chrUn 92.713 741 53 1 766 1506 195343608 195344347 0.000000e+00 1068.0
33 TraesCS6A01G100900 chrUn 92.691 602 44 0 766 1367 350819094 350818493 0.000000e+00 869.0
34 TraesCS6A01G100900 chrUn 92.691 602 44 0 766 1367 350841814 350841213 0.000000e+00 869.0
35 TraesCS6A01G100900 chr3B 98.440 769 11 1 1 768 632180139 632180907 0.000000e+00 1352.0
36 TraesCS6A01G100900 chr2B 98.564 766 10 1 1 765 81073952 81073187 0.000000e+00 1352.0
37 TraesCS6A01G100900 chr2B 98.562 765 11 0 1 765 577559624 577558860 0.000000e+00 1352.0
38 TraesCS6A01G100900 chr1A 97.938 776 15 1 1 775 233623831 233623056 0.000000e+00 1343.0
39 TraesCS6A01G100900 chr1A 100.000 52 0 0 1503 1554 96748151 96748100 4.170000e-16 97.1
40 TraesCS6A01G100900 chr1B 84.035 570 64 14 1507 2061 661900086 661899529 1.610000e-144 523.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G100900 chr6A 68545446 68550501 5055 False 9337.000000 9337 100.000000 1 5056 1 chr6A.!!$F1 5055
1 TraesCS6A01G100900 chr6A 253344402 253345167 765 True 1349.000000 1349 98.433000 3 768 1 chr6A.!!$R1 765
2 TraesCS6A01G100900 chr2A 180199148 180203434 4286 True 7659.000000 7659 98.904000 768 5056 1 chr2A.!!$R2 4288
3 TraesCS6A01G100900 chr2A 132611842 132616130 4288 True 7275.000000 7275 97.274000 766 5056 1 chr2A.!!$R1 4290
4 TraesCS6A01G100900 chr2A 294997104 294997869 765 True 1352.000000 1352 98.564000 1 765 1 chr2A.!!$R3 764
5 TraesCS6A01G100900 chr2A 705824381 705824933 552 True 662.000000 662 88.319000 3757 4315 1 chr2A.!!$R4 558
6 TraesCS6A01G100900 chr4A 29801397 29805674 4277 True 7334.000000 7334 97.575000 769 5056 1 chr4A.!!$R1 4287
7 TraesCS6A01G100900 chr4A 677887807 677889651 1844 True 2913.000000 2913 95.140000 3208 5056 1 chr4A.!!$R2 1848
8 TraesCS6A01G100900 chr1D 468413311 468417480 4169 False 6809.000000 6809 96.131000 880 5056 1 chr1D.!!$F1 4176
9 TraesCS6A01G100900 chr1D 475821482 475822089 607 True 510.000000 510 82.334000 1502 2118 1 chr1D.!!$R1 616
10 TraesCS6A01G100900 chr2D 390622137 390625674 3537 False 5439.000000 5439 94.385000 1503 5055 1 chr2D.!!$F1 3552
11 TraesCS6A01G100900 chr2D 81573377 81574413 1036 True 1539.000000 1539 93.403000 4014 5056 1 chr2D.!!$R1 1042
12 TraesCS6A01G100900 chr2D 81592750 81598992 6242 True 887.666667 1557 94.856667 2796 3845 3 chr2D.!!$R2 1049
13 TraesCS6A01G100900 chr2D 81630646 81631622 976 True 482.000000 795 93.124000 1503 2909 2 chr2D.!!$R3 1406
14 TraesCS6A01G100900 chr6D 393957591 393960834 3243 False 2420.500000 3862 93.010500 1503 5055 2 chr6D.!!$F2 3552
15 TraesCS6A01G100900 chr6D 14580429 14582061 1632 False 779.000000 1062 86.200500 1721 2713 2 chr6D.!!$F1 992
16 TraesCS6A01G100900 chr5A 219232327 219235421 3094 False 1397.500000 1725 93.234000 766 5056 2 chr5A.!!$F3 4290
17 TraesCS6A01G100900 chr7B 301888020 301891101 3081 False 1393.500000 1701 93.349500 766 5056 2 chr7B.!!$F1 4290
18 TraesCS6A01G100900 chr7A 104996616 104997932 1316 True 1434.000000 1434 86.482000 3735 5056 1 chr7A.!!$R1 1321
19 TraesCS6A01G100900 chr7A 203071297 203072065 768 True 1349.000000 1349 98.312000 1 769 1 chr7A.!!$R2 768
20 TraesCS6A01G100900 chrUn 202263917 202264685 768 True 1352.000000 1352 98.440000 1 768 1 chrUn.!!$R1 767
21 TraesCS6A01G100900 chrUn 377088515 377089283 768 True 1347.000000 1347 98.309000 1 768 1 chrUn.!!$R4 767
22 TraesCS6A01G100900 chrUn 195343608 195344347 739 False 1068.000000 1068 92.713000 766 1506 1 chrUn.!!$F1 740
23 TraesCS6A01G100900 chrUn 350818493 350819094 601 True 869.000000 869 92.691000 766 1367 1 chrUn.!!$R2 601
24 TraesCS6A01G100900 chrUn 350841213 350841814 601 True 869.000000 869 92.691000 766 1367 1 chrUn.!!$R3 601
25 TraesCS6A01G100900 chr3B 632180139 632180907 768 False 1352.000000 1352 98.440000 1 768 1 chr3B.!!$F1 767
26 TraesCS6A01G100900 chr2B 81073187 81073952 765 True 1352.000000 1352 98.564000 1 765 1 chr2B.!!$R1 764
27 TraesCS6A01G100900 chr2B 577558860 577559624 764 True 1352.000000 1352 98.562000 1 765 1 chr2B.!!$R2 764
28 TraesCS6A01G100900 chr1A 233623056 233623831 775 True 1343.000000 1343 97.938000 1 775 1 chr1A.!!$R2 774
29 TraesCS6A01G100900 chr1B 661899529 661900086 557 True 523.000000 523 84.035000 1507 2061 1 chr1B.!!$R1 554

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
797 799 2.125912 GACGCGCTGATCTGGTGT 60.126 61.111 5.73 4.67 0.0 4.16 F
1170 1172 0.108585 ATGGAGCTGTTGTGTTCGGT 59.891 50.000 0.00 0.00 0.0 4.69 F
1340 1342 1.375396 GGCCACACACATGACGCTA 60.375 57.895 0.00 0.00 0.0 4.26 F
1924 3101 2.362736 GAGACCTTCTGATGCATGCAA 58.637 47.619 26.68 8.38 0.0 4.08 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1924 3101 3.732048 AATACCGGGAACAAAGGTGAT 57.268 42.857 6.32 0.0 38.9 3.06 R
2909 4154 2.746375 ATCCCATCCCGCTGACCAC 61.746 63.158 0.00 0.0 0.0 4.16 R
3675 8722 7.938140 TGGGAATCAAAAAGTCAGTAATAGG 57.062 36.000 0.00 0.0 0.0 2.57 R
4272 9331 2.567615 AGACACCAGTAACCACCTCATC 59.432 50.000 0.00 0.0 0.0 2.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
797 799 2.125912 GACGCGCTGATCTGGTGT 60.126 61.111 5.73 4.67 0.00 4.16
1031 1033 0.735632 GACTCAAGAGCAGCTGGACG 60.736 60.000 17.12 1.09 0.00 4.79
1170 1172 0.108585 ATGGAGCTGTTGTGTTCGGT 59.891 50.000 0.00 0.00 0.00 4.69
1340 1342 1.375396 GGCCACACACATGACGCTA 60.375 57.895 0.00 0.00 0.00 4.26
1398 1400 4.941263 GGATTGCAACATTGGTAGTACTGA 59.059 41.667 5.39 0.00 0.00 3.41
1924 3101 2.362736 GAGACCTTCTGATGCATGCAA 58.637 47.619 26.68 8.38 0.00 4.08
2319 3532 8.735315 CAGAACTCTGTTCTGTCTAGATCTTTA 58.265 37.037 24.21 0.00 40.63 1.85
2715 3960 2.826725 TGCCATGCATCAATGAGAAACA 59.173 40.909 0.00 0.00 31.71 2.83
3637 8684 8.035394 TCTATTGTTACTACTGGAGCTGAAAAG 58.965 37.037 0.00 0.00 0.00 2.27
4196 9254 4.405680 TCTTCGATGAGCTTGATTCCCTTA 59.594 41.667 0.00 0.00 0.00 2.69
4272 9331 8.477709 GTTTCTCAGGTATAATTAACGTCATCG 58.522 37.037 0.00 0.00 43.34 3.84
4721 9792 7.656412 TGTGCTTTCAACTGCTTATTTATTGA 58.344 30.769 0.00 0.00 0.00 2.57
4860 9937 3.456277 CCTAAGAGCATTCAACCCTAGGT 59.544 47.826 8.29 0.00 37.65 3.08
4903 9986 5.299531 CGAACACTCAACCCTATGATAGAGA 59.700 44.000 0.00 0.00 0.00 3.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1031 1033 1.819288 TGAAGACGATGGTGTCCTCTC 59.181 52.381 0.00 0.0 39.77 3.20
1259 1261 3.764466 ACAGCCGCCTCCTTCTCG 61.764 66.667 0.00 0.0 0.00 4.04
1340 1342 3.945640 AACTACAGTTGAACCTTGGGT 57.054 42.857 0.00 0.0 36.80 4.51
1398 1400 7.062957 CCTTCCAAAACTAACCATCCTATCAT 58.937 38.462 0.00 0.0 0.00 2.45
1647 2812 8.947115 GGTCTGCTATAAATAAATACCATCACC 58.053 37.037 0.00 0.0 0.00 4.02
1924 3101 3.732048 AATACCGGGAACAAAGGTGAT 57.268 42.857 6.32 0.0 38.90 3.06
2145 3337 9.079833 CAAAAGATGCAGGTAATATGTTGAAAG 57.920 33.333 0.00 0.0 0.00 2.62
2909 4154 2.746375 ATCCCATCCCGCTGACCAC 61.746 63.158 0.00 0.0 0.00 4.16
3675 8722 7.938140 TGGGAATCAAAAAGTCAGTAATAGG 57.062 36.000 0.00 0.0 0.00 2.57
4272 9331 2.567615 AGACACCAGTAACCACCTCATC 59.432 50.000 0.00 0.0 0.00 2.92
4438 9503 2.918600 CAGCGCACGTGTATGTTTACTA 59.081 45.455 18.38 0.0 0.00 1.82
4695 9766 8.306038 TCAATAAATAAGCAGTTGAAAGCACAT 58.694 29.630 0.00 0.0 0.00 3.21
4721 9792 7.480760 AACTTATTGGTATTTCTGGTGCAAT 57.519 32.000 0.00 0.0 0.00 3.56
4903 9986 1.977056 ATGATGCGATGCAGAACCAT 58.023 45.000 0.00 0.0 43.65 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.