Multiple sequence alignment - TraesCS6A01G097600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G097600 chr6A 100.000 2451 0 0 1 2451 64699103 64696653 0.000000e+00 4527.0
1 TraesCS6A01G097600 chr3B 98.982 2455 20 2 1 2451 201624340 201621887 0.000000e+00 4390.0
2 TraesCS6A01G097600 chr3B 97.778 90 1 1 1975 2064 666288183 666288271 1.170000e-33 154.0
3 TraesCS6A01G097600 chr3B 100.000 36 0 0 2049 2084 173883895 173883930 1.570000e-07 67.6
4 TraesCS6A01G097600 chr5B 98.657 2458 26 2 1 2451 127817806 127815349 0.000000e+00 4349.0
5 TraesCS6A01G097600 chr1B 98.574 2455 30 2 1 2451 638738018 638735565 0.000000e+00 4335.0
6 TraesCS6A01G097600 chr1B 98.511 2350 29 3 106 2451 471874287 471876634 0.000000e+00 4141.0
7 TraesCS6A01G097600 chr7A 98.170 2350 36 5 106 2451 563575813 563573467 0.000000e+00 4095.0
8 TraesCS6A01G097600 chr7A 98.580 1901 23 1 555 2451 699893405 699895305 0.000000e+00 3358.0
9 TraesCS6A01G097600 chr1A 98.043 2350 41 2 106 2451 94770114 94767766 0.000000e+00 4080.0
10 TraesCS6A01G097600 chr1A 98.080 2083 35 2 106 2184 278537510 278539591 0.000000e+00 3620.0
11 TraesCS6A01G097600 chr6B 97.496 1837 26 2 106 1938 388123329 388125149 0.000000e+00 3120.0
12 TraesCS6A01G097600 chr2B 96.394 1359 20 3 106 1456 357194669 357193332 0.000000e+00 2211.0
13 TraesCS6A01G097600 chr2B 98.919 555 6 0 1897 2451 391202114 391202668 0.000000e+00 992.0
14 TraesCS6A01G097600 chr2B 96.552 116 4 0 1 116 310042578 310042693 2.490000e-45 193.0
15 TraesCS6A01G097600 chr2B 96.341 82 3 0 35 116 391223895 391223814 4.250000e-28 135.0
16 TraesCS6A01G097600 chr2B 97.403 77 2 0 40 116 391146156 391146232 5.500000e-27 132.0
17 TraesCS6A01G097600 chr2B 97.561 41 1 0 106 146 83488366 83488326 1.220000e-08 71.3
18 TraesCS6A01G097600 chr7D 98.276 116 2 0 1 116 307028635 307028750 1.150000e-48 204.0
19 TraesCS6A01G097600 chr3D 98.276 116 2 0 1 116 602856164 602856279 1.150000e-48 204.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G097600 chr6A 64696653 64699103 2450 True 4527 4527 100.000 1 2451 1 chr6A.!!$R1 2450
1 TraesCS6A01G097600 chr3B 201621887 201624340 2453 True 4390 4390 98.982 1 2451 1 chr3B.!!$R1 2450
2 TraesCS6A01G097600 chr5B 127815349 127817806 2457 True 4349 4349 98.657 1 2451 1 chr5B.!!$R1 2450
3 TraesCS6A01G097600 chr1B 638735565 638738018 2453 True 4335 4335 98.574 1 2451 1 chr1B.!!$R1 2450
4 TraesCS6A01G097600 chr1B 471874287 471876634 2347 False 4141 4141 98.511 106 2451 1 chr1B.!!$F1 2345
5 TraesCS6A01G097600 chr7A 563573467 563575813 2346 True 4095 4095 98.170 106 2451 1 chr7A.!!$R1 2345
6 TraesCS6A01G097600 chr7A 699893405 699895305 1900 False 3358 3358 98.580 555 2451 1 chr7A.!!$F1 1896
7 TraesCS6A01G097600 chr1A 94767766 94770114 2348 True 4080 4080 98.043 106 2451 1 chr1A.!!$R1 2345
8 TraesCS6A01G097600 chr1A 278537510 278539591 2081 False 3620 3620 98.080 106 2184 1 chr1A.!!$F1 2078
9 TraesCS6A01G097600 chr6B 388123329 388125149 1820 False 3120 3120 97.496 106 1938 1 chr6B.!!$F1 1832
10 TraesCS6A01G097600 chr2B 357193332 357194669 1337 True 2211 2211 96.394 106 1456 1 chr2B.!!$R2 1350
11 TraesCS6A01G097600 chr2B 391202114 391202668 554 False 992 992 98.919 1897 2451 1 chr2B.!!$F3 554

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
91 92 1.402613 TCGATCCGTGATACGCAAAGA 59.597 47.619 0.0 0.0 40.91 2.52 F
505 506 4.201980 CGTTCGTGTTAGGACATCCATAGA 60.202 45.833 0.0 0.0 38.23 1.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1277 1290 2.700897 CCTCGGGATCAGTGGTAGATTT 59.299 50.00 0.0 0.0 0.0 2.17 R
1965 1978 4.077108 TCTTGTTTGCAGCATCATTCTCT 58.923 39.13 0.0 0.0 0.0 3.10 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
91 92 1.402613 TCGATCCGTGATACGCAAAGA 59.597 47.619 0.00 0.00 40.91 2.52
505 506 4.201980 CGTTCGTGTTAGGACATCCATAGA 60.202 45.833 0.00 0.00 38.23 1.98
835 844 9.485206 TGTTAGTTTCATTAGTCAGTTTCCTAC 57.515 33.333 0.00 0.00 0.00 3.18
1277 1290 6.127394 TGCTACCCATGAGTAATAACGTTACA 60.127 38.462 10.81 4.03 0.00 2.41
1965 1978 3.755191 TGGGAAGGGAATAAGGGGATA 57.245 47.619 0.00 0.00 0.00 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
835 844 3.420893 TGGGAAACTCACTTTGCTATGG 58.579 45.455 0.0 0.0 31.02 2.74
1277 1290 2.700897 CCTCGGGATCAGTGGTAGATTT 59.299 50.000 0.0 0.0 0.00 2.17
1965 1978 4.077108 TCTTGTTTGCAGCATCATTCTCT 58.923 39.130 0.0 0.0 0.00 3.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.