Multiple sequence alignment - TraesCS6A01G085700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G085700 chr6A 100.000 2701 0 0 1 2701 53909926 53912626 0.000000e+00 4988
1 TraesCS6A01G085700 chr6A 96.550 2377 72 6 1 2370 1402458 1404831 0.000000e+00 3927
2 TraesCS6A01G085700 chr6A 96.626 326 5 1 2376 2701 1405212 1405531 1.100000e-148 536
3 TraesCS6A01G085700 chr6A 92.901 324 17 1 2378 2701 541769002 541769319 1.460000e-127 466
4 TraesCS6A01G085700 chr4A 98.815 2701 31 1 1 2701 706656663 706653964 0.000000e+00 4809
5 TraesCS6A01G085700 chr1B 98.519 2701 40 0 1 2701 588243651 588240951 0.000000e+00 4767
6 TraesCS6A01G085700 chr1B 93.036 2355 153 5 9 2358 275820965 275823313 0.000000e+00 3430
7 TraesCS6A01G085700 chr3B 97.927 2701 53 3 1 2701 809092543 809089846 0.000000e+00 4674
8 TraesCS6A01G085700 chr5B 97.782 2705 53 4 1 2701 47287231 47284530 0.000000e+00 4656
9 TraesCS6A01G085700 chr5B 95.092 326 10 1 2376 2701 526523545 526523226 2.400000e-140 508
10 TraesCS6A01G085700 chr4B 98.250 2286 34 3 416 2701 245486813 245489092 0.000000e+00 3995
11 TraesCS6A01G085700 chr4B 96.125 2271 62 11 106 2370 28262749 28260499 0.000000e+00 3683
12 TraesCS6A01G085700 chr4B 93.902 328 12 2 2376 2701 28260116 28259795 3.130000e-134 488
13 TraesCS6A01G085700 chr6B 96.307 2329 67 7 58 2370 262681 260356 0.000000e+00 3807


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G085700 chr6A 53909926 53912626 2700 False 4988.0 4988 100.0000 1 2701 1 chr6A.!!$F1 2700
1 TraesCS6A01G085700 chr6A 1402458 1405531 3073 False 2231.5 3927 96.5880 1 2701 2 chr6A.!!$F3 2700
2 TraesCS6A01G085700 chr4A 706653964 706656663 2699 True 4809.0 4809 98.8150 1 2701 1 chr4A.!!$R1 2700
3 TraesCS6A01G085700 chr1B 588240951 588243651 2700 True 4767.0 4767 98.5190 1 2701 1 chr1B.!!$R1 2700
4 TraesCS6A01G085700 chr1B 275820965 275823313 2348 False 3430.0 3430 93.0360 9 2358 1 chr1B.!!$F1 2349
5 TraesCS6A01G085700 chr3B 809089846 809092543 2697 True 4674.0 4674 97.9270 1 2701 1 chr3B.!!$R1 2700
6 TraesCS6A01G085700 chr5B 47284530 47287231 2701 True 4656.0 4656 97.7820 1 2701 1 chr5B.!!$R1 2700
7 TraesCS6A01G085700 chr4B 245486813 245489092 2279 False 3995.0 3995 98.2500 416 2701 1 chr4B.!!$F1 2285
8 TraesCS6A01G085700 chr4B 28259795 28262749 2954 True 2085.5 3683 95.0135 106 2701 2 chr4B.!!$R1 2595
9 TraesCS6A01G085700 chr6B 260356 262681 2325 True 3807.0 3807 96.3070 58 2370 1 chr6B.!!$R1 2312

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
984 1001 1.265236 GATCTGATCGGGAGCAGGAT 58.735 55.0 13.38 6.39 44.37 3.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2191 2222 2.354328 TGGAGGATGTACCAAGGGTTT 58.646 47.619 0.0 0.0 42.04 3.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
669 683 3.599343 CAAATAGTGCAGACTGTGGCTA 58.401 45.455 3.99 5.01 33.21 3.93
846 862 6.483640 GCAGTACAATTAACTAGATTGGAGGG 59.516 42.308 0.00 0.00 38.50 4.30
878 895 6.921914 TGATCAATATGTGCACATGAAACAA 58.078 32.000 36.72 19.81 37.15 2.83
892 909 6.587990 CACATGAAACAATAAATTAACCCGCA 59.412 34.615 0.00 0.00 0.00 5.69
984 1001 1.265236 GATCTGATCGGGAGCAGGAT 58.735 55.000 13.38 6.39 44.37 3.24
1140 1158 2.364448 GGACGAGGGGAGGAGCTT 60.364 66.667 0.00 0.00 0.00 3.74
1671 1699 6.047231 ACAGATACGGAACTAATAAACTGGC 58.953 40.000 0.00 0.00 0.00 4.85
1823 1851 6.864685 TCTGTGTTGTTACAGTTAATCGGTAG 59.135 38.462 5.89 0.00 46.32 3.18
1831 1859 8.192774 TGTTACAGTTAATCGGTAGTGGATAAG 58.807 37.037 0.00 0.00 0.00 1.73
2158 2189 4.967036 TCATCACAAACACCAGTATCACA 58.033 39.130 0.00 0.00 0.00 3.58
2191 2222 6.945435 TGGAGGTAAATCAAAGCTCAATGTTA 59.055 34.615 4.86 0.00 42.05 2.41
2270 2301 3.838244 AACCATTTATGCTCCGCTAGA 57.162 42.857 0.00 0.00 0.00 2.43
2391 2800 8.768955 GCTTCATTACAAAGTATATGGTCTGAG 58.231 37.037 0.00 0.00 0.00 3.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
239 241 2.355986 CGTCATCCCCGTTCCCTCA 61.356 63.158 0.0 0.00 0.00 3.86
245 247 3.396570 GTCCCCGTCATCCCCGTT 61.397 66.667 0.0 0.00 0.00 4.44
444 453 1.072331 ACCATGAGGAAAGCACGAACT 59.928 47.619 0.0 0.00 38.69 3.01
669 683 7.445121 CAAGTGGATATATACACCAGTCATGT 58.555 38.462 22.2 0.82 42.74 3.21
984 1001 4.050934 ATGTGCTCGCCGTCGTCA 62.051 61.111 0.0 0.00 36.96 4.35
1186 1204 2.685999 GCCAGCCCCTCCAGAATT 59.314 61.111 0.0 0.00 0.00 2.17
1366 1394 7.015877 ACCTACACTCAACTTGTACCATTTAGA 59.984 37.037 0.0 0.00 0.00 2.10
1671 1699 3.258872 TCCATTTGCCTGTTTGATCCTTG 59.741 43.478 0.0 0.00 0.00 3.61
2158 2189 6.071320 GCTTTGATTTACCTCCATTATCCCT 58.929 40.000 0.0 0.00 0.00 4.20
2191 2222 2.354328 TGGAGGATGTACCAAGGGTTT 58.646 47.619 0.0 0.00 42.04 3.27
2429 2840 3.818210 AGAACGCAAATGACCAACATACA 59.182 39.130 0.0 0.00 38.38 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.