Multiple sequence alignment - TraesCS6A01G075100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G075100 chr6A 100.000 2252 0 0 1 2252 44892475 44890224 0.000000e+00 4159.0
1 TraesCS6A01G075100 chr6A 91.961 1132 73 7 401 1524 596656591 596655470 0.000000e+00 1570.0
2 TraesCS6A01G075100 chr6A 96.197 631 22 1 1 629 44874120 44873490 0.000000e+00 1031.0
3 TraesCS6A01G075100 chr6A 95.687 626 23 4 1524 2146 91806780 91807404 0.000000e+00 1003.0
4 TraesCS6A01G075100 chr6A 95.520 625 25 3 1524 2146 384584535 384583912 0.000000e+00 996.0
5 TraesCS6A01G075100 chr6A 91.435 432 35 1 1 432 44731414 44730985 1.930000e-165 592.0
6 TraesCS6A01G075100 chr6A 94.262 122 7 0 1403 1524 596687413 596687292 1.060000e-43 187.0
7 TraesCS6A01G075100 chr6A 98.438 64 1 0 2189 2252 44872866 44872803 1.830000e-21 113.0
8 TraesCS6A01G075100 chr6A 96.875 64 2 0 2189 2252 596652423 596652360 8.500000e-20 108.0
9 TraesCS6A01G075100 chr6A 96.875 64 2 0 2189 2252 596684243 596684180 8.500000e-20 108.0
10 TraesCS6A01G075100 chrUn 95.283 1802 62 8 411 2191 71647206 71649005 0.000000e+00 2835.0
11 TraesCS6A01G075100 chrUn 93.151 73 5 0 329 401 113151995 113152067 8.500000e-20 108.0
12 TraesCS6A01G075100 chr3A 93.003 1129 62 6 404 1524 221928824 221927705 0.000000e+00 1631.0
13 TraesCS6A01G075100 chr3A 95.520 625 25 3 1524 2146 454209332 454209955 0.000000e+00 996.0
14 TraesCS6A01G075100 chr3A 95.375 627 24 5 1524 2146 231730220 231729595 0.000000e+00 992.0
15 TraesCS6A01G075100 chr3A 96.875 64 2 0 2189 2252 221927630 221927567 8.500000e-20 108.0
16 TraesCS6A01G075100 chr5A 90.381 1102 73 9 401 1492 606194666 606195744 0.000000e+00 1417.0
17 TraesCS6A01G075100 chr5A 95.031 644 29 3 1515 2156 439106819 439106177 0.000000e+00 1009.0
18 TraesCS6A01G075100 chr5A 95.680 625 24 3 1524 2146 162405135 162405758 0.000000e+00 1002.0
19 TraesCS6A01G075100 chr5A 96.875 64 2 0 2189 2252 606197032 606197095 8.500000e-20 108.0
20 TraesCS6A01G075100 chr7A 95.707 629 22 4 1522 2146 213819722 213819095 0.000000e+00 1007.0
21 TraesCS6A01G075100 chr1A 95.126 636 25 5 1521 2152 372283805 372284438 0.000000e+00 998.0
22 TraesCS6A01G075100 chr1A 95.360 625 27 2 1524 2146 207422922 207423546 0.000000e+00 992.0
23 TraesCS6A01G075100 chr1A 89.256 121 12 1 404 524 157950161 157950280 1.390000e-32 150.0
24 TraesCS6A01G075100 chr7B 87.268 809 69 10 631 1435 746336396 746337174 0.000000e+00 893.0
25 TraesCS6A01G075100 chr7B 93.750 64 4 0 1452 1515 746337159 746337222 1.840000e-16 97.1
26 TraesCS6A01G075100 chr1B 87.097 527 59 5 576 1102 202678995 202679512 2.490000e-164 588.0
27 TraesCS6A01G075100 chr1B 88.158 228 27 0 1005 1232 202679487 202679714 2.850000e-69 272.0
28 TraesCS6A01G075100 chr1B 92.090 177 13 1 1260 1435 202681623 202681799 4.800000e-62 248.0
29 TraesCS6A01G075100 chr3D 89.120 432 38 2 1005 1435 380271376 380271799 1.530000e-146 529.0
30 TraesCS6A01G075100 chr3D 87.879 132 14 2 408 538 117817845 117817715 1.080000e-33 154.0
31 TraesCS6A01G075100 chr3D 84.397 141 14 1 962 1102 380271269 380271401 5.050000e-27 132.0
32 TraesCS6A01G075100 chr3D 92.958 71 5 0 1452 1522 380271784 380271854 1.100000e-18 104.0
33 TraesCS6A01G075100 chr2B 85.928 334 41 3 1 334 627000894 627001221 3.560000e-93 351.0
34 TraesCS6A01G075100 chr2B 88.542 96 10 1 483 577 777841747 777841652 5.080000e-22 115.0
35 TraesCS6A01G075100 chr5D 89.167 120 12 1 404 523 540146535 540146653 5.010000e-32 148.0
36 TraesCS6A01G075100 chr5D 87.200 125 12 3 401 524 27096589 27096468 3.020000e-29 139.0
37 TraesCS6A01G075100 chr4A 86.364 132 16 2 413 544 127171820 127171949 2.330000e-30 143.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G075100 chr6A 44890224 44892475 2251 True 4159.000000 4159 100.0000 1 2252 1 chr6A.!!$R2 2251
1 TraesCS6A01G075100 chr6A 91806780 91807404 624 False 1003.000000 1003 95.6870 1524 2146 1 chr6A.!!$F1 622
2 TraesCS6A01G075100 chr6A 384583912 384584535 623 True 996.000000 996 95.5200 1524 2146 1 chr6A.!!$R3 622
3 TraesCS6A01G075100 chr6A 596652360 596656591 4231 True 839.000000 1570 94.4180 401 2252 2 chr6A.!!$R5 1851
4 TraesCS6A01G075100 chr6A 44872803 44874120 1317 True 572.000000 1031 97.3175 1 2252 2 chr6A.!!$R4 2251
5 TraesCS6A01G075100 chrUn 71647206 71649005 1799 False 2835.000000 2835 95.2830 411 2191 1 chrUn.!!$F1 1780
6 TraesCS6A01G075100 chr3A 454209332 454209955 623 False 996.000000 996 95.5200 1524 2146 1 chr3A.!!$F1 622
7 TraesCS6A01G075100 chr3A 231729595 231730220 625 True 992.000000 992 95.3750 1524 2146 1 chr3A.!!$R1 622
8 TraesCS6A01G075100 chr3A 221927567 221928824 1257 True 869.500000 1631 94.9390 404 2252 2 chr3A.!!$R2 1848
9 TraesCS6A01G075100 chr5A 439106177 439106819 642 True 1009.000000 1009 95.0310 1515 2156 1 chr5A.!!$R1 641
10 TraesCS6A01G075100 chr5A 162405135 162405758 623 False 1002.000000 1002 95.6800 1524 2146 1 chr5A.!!$F1 622
11 TraesCS6A01G075100 chr5A 606194666 606197095 2429 False 762.500000 1417 93.6280 401 2252 2 chr5A.!!$F2 1851
12 TraesCS6A01G075100 chr7A 213819095 213819722 627 True 1007.000000 1007 95.7070 1522 2146 1 chr7A.!!$R1 624
13 TraesCS6A01G075100 chr1A 372283805 372284438 633 False 998.000000 998 95.1260 1521 2152 1 chr1A.!!$F3 631
14 TraesCS6A01G075100 chr1A 207422922 207423546 624 False 992.000000 992 95.3600 1524 2146 1 chr1A.!!$F2 622
15 TraesCS6A01G075100 chr7B 746336396 746337222 826 False 495.050000 893 90.5090 631 1515 2 chr7B.!!$F1 884
16 TraesCS6A01G075100 chr1B 202678995 202681799 2804 False 369.333333 588 89.1150 576 1435 3 chr1B.!!$F1 859
17 TraesCS6A01G075100 chr3D 380271269 380271854 585 False 255.000000 529 88.8250 962 1522 3 chr3D.!!$F1 560

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
70 71 0.179171 CAGCAACGACGACTATCGGT 60.179 55.0 0.00 0.0 44.67 4.69 F
831 842 0.793861 TAGCGACATCGTTGCCAAAC 59.206 50.0 2.85 0.0 43.42 2.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1113 1189 0.388006 CACATGCACCGACGACACTA 60.388 55.0 0.0 0.0 0.0 2.74 R
1773 1959 6.476243 AAACAATTACGTGCTTAGTAGTGG 57.524 37.5 0.0 0.0 0.0 4.00 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
60 61 0.874390 TTCTCCATTGCAGCAACGAC 59.126 50.000 10.85 0.00 0.00 4.34
66 67 1.660607 CATTGCAGCAACGACGACTAT 59.339 47.619 10.85 0.00 0.00 2.12
70 71 0.179171 CAGCAACGACGACTATCGGT 60.179 55.000 0.00 0.00 44.67 4.69
173 176 1.891919 GGCGTCTGTTGTGGAGCAA 60.892 57.895 0.00 0.00 34.16 3.91
205 208 1.740025 AGCAAAAGATAACGCAGGAGC 59.260 47.619 0.00 0.00 37.42 4.70
269 272 4.058817 GGTCTTGATTATGTGGATCGGAC 58.941 47.826 0.00 0.00 32.83 4.79
296 299 3.432608 GGTAAGGCGGCTTATAACTGGAA 60.433 47.826 30.98 7.81 0.00 3.53
382 385 6.266558 AGTTCTTCCATAATAGAGCGTCTCAT 59.733 38.462 9.09 0.00 32.06 2.90
433 436 9.827198 TTCCCTAATAATAAAGCATGGATTGAT 57.173 29.630 0.00 0.00 0.00 2.57
451 454 4.909696 TGATTTTGTCGTGTTCACCATT 57.090 36.364 0.00 0.00 0.00 3.16
464 467 6.401260 CGTGTTCACCATTACAATACGCTTTA 60.401 38.462 0.00 0.00 29.75 1.85
476 479 9.562408 TTACAATACGCTTTATTCCCATGATTA 57.438 29.630 0.00 0.00 0.00 1.75
629 632 4.590647 CCTAGTCCATGATACCATCACTGT 59.409 45.833 0.00 0.00 43.01 3.55
831 842 0.793861 TAGCGACATCGTTGCCAAAC 59.206 50.000 2.85 0.00 43.42 2.93
960 972 3.191888 ACAATCTCACAGGAGTAGGGT 57.808 47.619 0.00 0.00 42.05 4.34
1024 1036 1.502163 CGCCGGCATCATTCTTCTCC 61.502 60.000 28.98 0.00 0.00 3.71
1113 1189 3.354678 GCCACCATTGTTGCGACT 58.645 55.556 5.50 0.00 0.00 4.18
1223 1304 4.524328 GCAAAAGGAGATTGGGAAAGAGAA 59.476 41.667 0.00 0.00 0.00 2.87
1258 1421 6.841443 AGACAACGAGATCATGAATTCATC 57.159 37.500 18.16 8.61 33.61 2.92
1381 1544 0.821517 TCGCTAACATGGTGTCGGAT 59.178 50.000 0.00 0.00 0.00 4.18
1396 1559 4.459337 GTGTCGGATTTCCTCCAAGATTTT 59.541 41.667 0.00 0.00 45.24 1.82
1483 1646 1.949525 AGATGCGGCACCAAATCATAC 59.050 47.619 4.03 0.00 0.00 2.39
1647 1831 7.265647 TGAACTTTTCATACCGATTTGAACA 57.734 32.000 0.00 0.00 34.08 3.18
1773 1959 9.897744 TCATTTTTCTTGTACATGAGTCAAATC 57.102 29.630 10.92 0.00 0.00 2.17
1793 1979 6.903883 AATCCACTACTAAGCACGTAATTG 57.096 37.500 0.00 0.00 0.00 2.32
1838 3020 9.816354 TTTTCTCTTTTTAAAATGCTAAGCACT 57.184 25.926 0.55 0.00 43.04 4.40
1840 3022 9.816354 TTCTCTTTTTAAAATGCTAAGCACTTT 57.184 25.926 0.55 0.00 43.04 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
158 161 2.481952 GACAGATTGCTCCACAACAGAC 59.518 50.000 0.00 0.00 42.27 3.51
183 186 3.561725 GCTCCTGCGTTATCTTTTGCTAT 59.438 43.478 0.00 0.00 0.00 2.97
205 208 1.395954 CACATCACAGCAGAACCATCG 59.604 52.381 0.00 0.00 0.00 3.84
213 216 1.077930 CTCCCCCACATCACAGCAG 60.078 63.158 0.00 0.00 0.00 4.24
269 272 0.677842 ATAAGCCGCCTTACCTACCG 59.322 55.000 0.00 0.00 36.43 4.02
296 299 3.157087 ACAAATCATCCGGCTGAAAACT 58.843 40.909 12.76 0.00 0.00 2.66
382 385 8.593945 AAGATATAATGGTTCTTTTGCCTTCA 57.406 30.769 0.00 0.00 0.00 3.02
433 436 5.562506 TTGTAATGGTGAACACGACAAAA 57.437 34.783 0.00 0.00 35.33 2.44
451 454 9.733556 ATAATCATGGGAATAAAGCGTATTGTA 57.266 29.630 0.00 0.00 0.00 2.41
464 467 8.477419 AATTGAAACCGTATAATCATGGGAAT 57.523 30.769 0.00 0.00 0.00 3.01
501 504 7.267857 GGTTTTAGTACCACCTCACGTATATT 58.732 38.462 0.00 0.00 38.12 1.28
960 972 3.607163 CGCCCTACGTGGAGGTAA 58.393 61.111 0.00 0.00 38.35 2.85
1024 1036 4.789075 ACGACGACGCGGAATGGG 62.789 66.667 12.47 0.00 43.96 4.00
1113 1189 0.388006 CACATGCACCGACGACACTA 60.388 55.000 0.00 0.00 0.00 2.74
1171 1248 1.136828 CCCCCGATCATAACCTCCAA 58.863 55.000 0.00 0.00 0.00 3.53
1223 1304 1.878656 CGTTGTCTTCTCCTCCGCCT 61.879 60.000 0.00 0.00 0.00 5.52
1258 1421 1.191868 GCACAATCTCTGCGATCGATG 59.808 52.381 21.57 10.42 0.00 3.84
1381 1544 5.584251 GTGCAAAACAAAATCTTGGAGGAAA 59.416 36.000 0.00 0.00 36.82 3.13
1396 1559 1.588674 CGTCCTAGGTGTGCAAAACA 58.411 50.000 9.08 0.00 36.04 2.83
1483 1646 4.463050 AGGTGGATTAGGAGTCTAGGAG 57.537 50.000 0.00 0.00 0.00 3.69
1773 1959 6.476243 AAACAATTACGTGCTTAGTAGTGG 57.524 37.500 0.00 0.00 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.