Multiple sequence alignment - TraesCS6A01G074400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G074400 chr6A 100.000 2699 0 0 1 2699 42390101 42387403 0.000000e+00 4985.0
1 TraesCS6A01G074400 chr6A 99.074 2700 15 2 1 2699 42209190 42206500 0.000000e+00 4839.0
2 TraesCS6A01G074400 chr6A 86.055 1929 214 23 574 2462 62489515 62487602 0.000000e+00 2021.0
3 TraesCS6A01G074400 chr6A 87.143 210 23 1 2334 2543 62659850 62659645 4.490000e-58 235.0
4 TraesCS6A01G074400 chrUn 92.428 1915 96 22 826 2699 105245674 105247580 0.000000e+00 2687.0
5 TraesCS6A01G074400 chrUn 93.955 579 24 4 1 576 105245010 105245580 0.000000e+00 865.0
6 TraesCS6A01G074400 chrUn 100.000 431 0 0 1 431 345248710 345248280 0.000000e+00 797.0
7 TraesCS6A01G074400 chr6D 87.090 2014 202 26 574 2543 53309609 53311608 0.000000e+00 2226.0
8 TraesCS6A01G074400 chr6D 86.959 2009 202 28 574 2543 51624458 51622471 0.000000e+00 2204.0
9 TraesCS6A01G074400 chr6D 91.065 582 44 7 1 578 53308991 53309568 0.000000e+00 780.0
10 TraesCS6A01G074400 chr6D 89.465 579 55 5 1 576 51625076 51624501 0.000000e+00 726.0
11 TraesCS6A01G074400 chr6D 86.567 67 9 0 1416 1482 52007920 52007986 1.040000e-09 75.0
12 TraesCS6A01G074400 chr6B 88.503 1783 172 12 574 2332 76598961 76597188 0.000000e+00 2126.0
13 TraesCS6A01G074400 chr6B 87.747 1771 191 11 574 2325 118823165 118821402 0.000000e+00 2045.0
14 TraesCS6A01G074400 chr6B 89.173 1367 119 16 970 2316 76733990 76732633 0.000000e+00 1677.0
15 TraesCS6A01G074400 chr6B 91.019 579 46 5 2 576 118823784 118823208 0.000000e+00 776.0
16 TraesCS6A01G074400 chr6B 90.690 580 46 6 1 576 76742411 76741836 0.000000e+00 765.0
17 TraesCS6A01G074400 chr6B 90.674 579 45 6 1 576 76599576 76599004 0.000000e+00 761.0
18 TraesCS6A01G074400 chr6B 84.564 298 41 2 2403 2699 76573228 76572935 9.450000e-75 291.0
19 TraesCS6A01G074400 chr6B 91.429 210 14 1 2334 2543 118784749 118784544 4.400000e-73 285.0
20 TraesCS6A01G074400 chr6B 90.411 73 7 0 2333 2405 76574722 76574650 2.210000e-16 97.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G074400 chr6A 42387403 42390101 2698 True 4985.0 4985 100.0000 1 2699 1 chr6A.!!$R2 2698
1 TraesCS6A01G074400 chr6A 42206500 42209190 2690 True 4839.0 4839 99.0740 1 2699 1 chr6A.!!$R1 2698
2 TraesCS6A01G074400 chr6A 62487602 62489515 1913 True 2021.0 2021 86.0550 574 2462 1 chr6A.!!$R3 1888
3 TraesCS6A01G074400 chrUn 105245010 105247580 2570 False 1776.0 2687 93.1915 1 2699 2 chrUn.!!$F1 2698
4 TraesCS6A01G074400 chr6D 53308991 53311608 2617 False 1503.0 2226 89.0775 1 2543 2 chr6D.!!$F2 2542
5 TraesCS6A01G074400 chr6D 51622471 51625076 2605 True 1465.0 2204 88.2120 1 2543 2 chr6D.!!$R1 2542
6 TraesCS6A01G074400 chr6B 76732633 76733990 1357 True 1677.0 1677 89.1730 970 2316 1 chr6B.!!$R1 1346
7 TraesCS6A01G074400 chr6B 76597188 76599576 2388 True 1443.5 2126 89.5885 1 2332 2 chr6B.!!$R5 2331
8 TraesCS6A01G074400 chr6B 118821402 118823784 2382 True 1410.5 2045 89.3830 2 2325 2 chr6B.!!$R6 2323
9 TraesCS6A01G074400 chr6B 76741836 76742411 575 True 765.0 765 90.6900 1 576 1 chr6B.!!$R2 575

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
431 439 2.468777 GTCATGTTTGTTTCTTGCGCTG 59.531 45.455 9.73 1.08 0.00 5.18 F
1112 1166 2.742372 GCACCAAGCGACCACGAT 60.742 61.111 0.00 0.00 42.66 3.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1551 1611 1.740025 GATCCTTTTCGACCTGGCAAG 59.260 52.381 0.00 0.0 0.0 4.01 R
2613 2726 1.002533 GGTACTAGAGGGGGCCACA 59.997 63.158 9.35 0.0 0.0 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
431 439 2.468777 GTCATGTTTGTTTCTTGCGCTG 59.531 45.455 9.73 1.08 0.00 5.18
994 1048 2.918712 ATGCTAGCATACCACAGACC 57.081 50.000 28.62 0.00 34.49 3.85
1112 1166 2.742372 GCACCAAGCGACCACGAT 60.742 61.111 0.00 0.00 42.66 3.73
2613 2726 0.321653 GGTGCAGTTCCGATGGTTCT 60.322 55.000 0.00 0.00 0.00 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1112 1166 2.435410 CAGATGCCACGCTGCTCA 60.435 61.111 0.00 0.00 0.00 4.26
1551 1611 1.740025 GATCCTTTTCGACCTGGCAAG 59.260 52.381 0.00 0.00 0.00 4.01
2613 2726 1.002533 GGTACTAGAGGGGGCCACA 59.997 63.158 9.35 0.00 0.00 4.17
2649 2762 2.165030 GGATCCCAAACATGCTTGTCTG 59.835 50.000 5.61 2.21 34.06 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.