Multiple sequence alignment - TraesCS6A01G049800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G049800 chr6A 100.000 3080 0 0 1 3080 25580073 25583152 0.000000e+00 5688
1 TraesCS6A01G049800 chr6A 97.713 3105 40 7 1 3080 25471736 25474834 0.000000e+00 5312
2 TraesCS6A01G049800 chr6A 97.007 2172 50 6 287 2444 25106730 25108900 0.000000e+00 3637
3 TraesCS6A01G049800 chr6A 96.382 2128 38 9 985 3078 25408352 25410474 0.000000e+00 3467
4 TraesCS6A01G049800 chr6A 97.959 1960 25 1 287 2231 25313460 25315419 0.000000e+00 3384
5 TraesCS6A01G049800 chr6A 94.709 1871 68 7 287 2127 25069699 25071568 0.000000e+00 2878
6 TraesCS6A01G049800 chr6A 97.494 1197 30 0 287 1483 25524989 25526185 0.000000e+00 2045
7 TraesCS6A01G049800 chr6A 96.747 1199 31 2 287 1483 25202678 25203870 0.000000e+00 1991
8 TraesCS6A01G049800 chr6A 92.152 1185 63 9 1262 2422 25526000 25527178 0.000000e+00 1646
9 TraesCS6A01G049800 chr6A 89.836 1220 94 18 1243 2441 25203705 25204915 0.000000e+00 1539
10 TraesCS6A01G049800 chr6A 93.904 935 29 17 1 933 25407450 25408358 0.000000e+00 1386
11 TraesCS6A01G049800 chr6A 97.134 628 14 4 2451 3078 25527178 25527801 0.000000e+00 1057
12 TraesCS6A01G049800 chr6A 95.455 638 23 5 2440 3077 25213412 25214043 0.000000e+00 1013
13 TraesCS6A01G049800 chr6A 94.852 641 24 5 2440 3080 25137637 25138268 0.000000e+00 992
14 TraesCS6A01G049800 chr6A 97.912 431 6 3 2264 2692 25315421 25315850 0.000000e+00 743
15 TraesCS6A01G049800 chr6A 96.410 390 9 3 2692 3080 25316199 25316584 3.350000e-179 638
16 TraesCS6A01G049800 chr6A 98.625 291 4 0 1 291 25524670 25524960 1.640000e-142 516
17 TraesCS6A01G049800 chr6A 97.938 291 6 0 1 291 25313142 25313432 3.540000e-139 505
18 TraesCS6A01G049800 chr6A 96.564 291 9 1 1 291 25106412 25106701 5.970000e-132 481
19 TraesCS6A01G049800 chr6A 96.220 291 11 0 1 291 25202359 25202649 7.730000e-131 477
20 TraesCS6A01G049800 chr6A 89.189 111 8 2 1 111 565053010 565053116 5.360000e-28 135
21 TraesCS6A01G049800 chrUn 93.910 1642 87 3 483 2112 94374281 94375921 0.000000e+00 2466
22 TraesCS6A01G049800 chrUn 93.788 1642 86 3 483 2112 94456416 94458053 0.000000e+00 2453
23 TraesCS6A01G049800 chrUn 92.737 1666 84 8 483 2112 94279963 94281627 0.000000e+00 2372
24 TraesCS6A01G049800 chrUn 92.758 1657 86 8 483 2112 94431429 94433078 0.000000e+00 2364
25 TraesCS6A01G049800 chrUn 92.664 1663 88 8 483 2112 325949665 325951326 0.000000e+00 2364
26 TraesCS6A01G049800 chrUn 90.212 1226 100 9 899 2112 94682709 94683926 0.000000e+00 1581
27 TraesCS6A01G049800 chrUn 86.946 835 73 11 899 1715 181048617 181049433 0.000000e+00 905
28 TraesCS6A01G049800 chrUn 86.826 835 74 11 899 1715 181032899 181033715 0.000000e+00 900
29 TraesCS6A01G049800 chrUn 86.108 835 86 20 899 1715 180994204 180995026 0.000000e+00 872
30 TraesCS6A01G049800 chr6B 92.880 1236 80 4 483 1715 62653139 62654369 0.000000e+00 1788
31 TraesCS6A01G049800 chr6B 86.258 815 73 12 899 1692 43857866 43858662 0.000000e+00 848
32 TraesCS6A01G049800 chr6B 89.189 111 8 2 1 111 558917768 558917874 5.360000e-28 135
33 TraesCS6A01G049800 chr4D 93.250 637 27 10 2361 2985 495450586 495449954 0.000000e+00 924
34 TraesCS6A01G049800 chr4D 96.234 239 9 0 2127 2365 495450877 495450639 2.880000e-105 392
35 TraesCS6A01G049800 chr4D 96.537 231 8 0 2121 2351 495451414 495451184 1.730000e-102 383
36 TraesCS6A01G049800 chr4D 90.643 171 16 0 121 291 105123154 105122984 8.590000e-56 228
37 TraesCS6A01G049800 chr5B 84.547 453 55 10 2503 2955 658338329 658338766 4.720000e-118 435
38 TraesCS6A01G049800 chr5B 89.333 225 21 3 2122 2346 658337974 658338195 2.340000e-71 279
39 TraesCS6A01G049800 chr7D 82.917 480 61 15 2506 2977 14636819 14636353 2.210000e-111 412
40 TraesCS6A01G049800 chr1D 91.765 170 13 1 122 291 473119042 473119210 5.130000e-58 235
41 TraesCS6A01G049800 chr3D 90.805 174 13 3 118 291 441025616 441025786 2.390000e-56 230
42 TraesCS6A01G049800 chr3A 89.189 111 8 2 1 111 472418316 472418422 5.360000e-28 135
43 TraesCS6A01G049800 chr7B 83.673 147 17 4 350 492 712740716 712740573 6.930000e-27 132


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G049800 chr6A 25580073 25583152 3079 False 5688.000000 5688 100.000000 1 3080 1 chr6A.!!$F5 3079
1 TraesCS6A01G049800 chr6A 25471736 25474834 3098 False 5312.000000 5312 97.713000 1 3080 1 chr6A.!!$F4 3079
2 TraesCS6A01G049800 chr6A 25069699 25071568 1869 False 2878.000000 2878 94.709000 287 2127 1 chr6A.!!$F1 1840
3 TraesCS6A01G049800 chr6A 25407450 25410474 3024 False 2426.500000 3467 95.143000 1 3078 2 chr6A.!!$F10 3077
4 TraesCS6A01G049800 chr6A 25106412 25108900 2488 False 2059.000000 3637 96.785500 1 2444 2 chr6A.!!$F7 2443
5 TraesCS6A01G049800 chr6A 25202359 25204915 2556 False 1335.666667 1991 94.267667 1 2441 3 chr6A.!!$F8 2440
6 TraesCS6A01G049800 chr6A 25313142 25316584 3442 False 1317.500000 3384 97.554750 1 3080 4 chr6A.!!$F9 3079
7 TraesCS6A01G049800 chr6A 25524670 25527801 3131 False 1316.000000 2045 96.351250 1 3078 4 chr6A.!!$F11 3077
8 TraesCS6A01G049800 chr6A 25213412 25214043 631 False 1013.000000 1013 95.455000 2440 3077 1 chr6A.!!$F3 637
9 TraesCS6A01G049800 chr6A 25137637 25138268 631 False 992.000000 992 94.852000 2440 3080 1 chr6A.!!$F2 640
10 TraesCS6A01G049800 chrUn 94374281 94375921 1640 False 2466.000000 2466 93.910000 483 2112 1 chrUn.!!$F2 1629
11 TraesCS6A01G049800 chrUn 94456416 94458053 1637 False 2453.000000 2453 93.788000 483 2112 1 chrUn.!!$F4 1629
12 TraesCS6A01G049800 chrUn 94279963 94281627 1664 False 2372.000000 2372 92.737000 483 2112 1 chrUn.!!$F1 1629
13 TraesCS6A01G049800 chrUn 94431429 94433078 1649 False 2364.000000 2364 92.758000 483 2112 1 chrUn.!!$F3 1629
14 TraesCS6A01G049800 chrUn 325949665 325951326 1661 False 2364.000000 2364 92.664000 483 2112 1 chrUn.!!$F9 1629
15 TraesCS6A01G049800 chrUn 94682709 94683926 1217 False 1581.000000 1581 90.212000 899 2112 1 chrUn.!!$F5 1213
16 TraesCS6A01G049800 chrUn 181048617 181049433 816 False 905.000000 905 86.946000 899 1715 1 chrUn.!!$F8 816
17 TraesCS6A01G049800 chrUn 181032899 181033715 816 False 900.000000 900 86.826000 899 1715 1 chrUn.!!$F7 816
18 TraesCS6A01G049800 chrUn 180994204 180995026 822 False 872.000000 872 86.108000 899 1715 1 chrUn.!!$F6 816
19 TraesCS6A01G049800 chr6B 62653139 62654369 1230 False 1788.000000 1788 92.880000 483 1715 1 chr6B.!!$F2 1232
20 TraesCS6A01G049800 chr6B 43857866 43858662 796 False 848.000000 848 86.258000 899 1692 1 chr6B.!!$F1 793
21 TraesCS6A01G049800 chr4D 495449954 495451414 1460 True 566.333333 924 95.340333 2121 2985 3 chr4D.!!$R2 864
22 TraesCS6A01G049800 chr5B 658337974 658338766 792 False 357.000000 435 86.940000 2122 2955 2 chr5B.!!$F1 833

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
919 993 2.387757 AGTGCCACCAAACAGAACATT 58.612 42.857 0.0 0.0 0.0 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2668 3633 0.90158 TCCTAGGACACCACGTTCCC 60.902 60.0 7.62 0.0 0.0 3.97 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
706 780 3.359033 ACTAAGTACCGTGACAGCCATA 58.641 45.455 0.00 0.0 0.00 2.74
919 993 2.387757 AGTGCCACCAAACAGAACATT 58.612 42.857 0.00 0.0 0.00 2.71
1438 1595 2.095768 CCACAGTATTCGCAACCACAAG 60.096 50.000 0.00 0.0 0.00 3.16
1596 1852 4.963373 TGCAACAAAGTACTTACCAGCTA 58.037 39.130 8.92 1.0 0.00 3.32
2313 3136 4.486090 GACTGTACGTGACACATCTGAAT 58.514 43.478 6.37 0.0 33.31 2.57
2757 4077 5.796935 CGTTCATGCACTTGGAAAATAGAAG 59.203 40.000 0.00 0.0 0.00 2.85
2758 4078 6.348458 CGTTCATGCACTTGGAAAATAGAAGA 60.348 38.462 0.00 0.0 0.00 2.87
2759 4079 7.370383 GTTCATGCACTTGGAAAATAGAAGAA 58.630 34.615 0.00 0.0 0.00 2.52
2760 4080 7.523293 TCATGCACTTGGAAAATAGAAGAAA 57.477 32.000 0.00 0.0 0.00 2.52
2761 4081 7.950512 TCATGCACTTGGAAAATAGAAGAAAA 58.049 30.769 0.00 0.0 0.00 2.29
3001 4322 1.883084 GCGACTAATCTGCACCGGG 60.883 63.158 6.32 0.0 0.00 5.73
3025 4346 1.641140 CGCGCAATCAATTCGGCTA 59.359 52.632 8.75 0.0 0.00 3.93
3036 4357 2.225791 ATTCGGCTAGACACAGCGCA 62.226 55.000 11.47 0.0 42.76 6.09
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
30 31 3.197766 TGCATCGTCACCTTATCCTTTCT 59.802 43.478 0.00 0.0 0.00 2.52
273 274 5.631119 AGTGCCTCTACAATACCAAAACTT 58.369 37.500 0.00 0.0 0.00 2.66
919 993 8.199449 GGATGCTTCTAAAAATCATCATTTGGA 58.801 33.333 0.00 0.0 36.25 3.53
1438 1595 2.669364 CTGCTGCTGTGAAATTGGTTC 58.331 47.619 0.00 0.0 36.70 3.62
1596 1852 4.053295 GCTGACAACACAATTCTTGCAAT 58.947 39.130 0.00 0.0 0.00 3.56
2668 3633 0.901580 TCCTAGGACACCACGTTCCC 60.902 60.000 7.62 0.0 0.00 3.97
2677 3642 6.222038 TGACACATATCTTTCCTAGGACAC 57.778 41.667 12.22 0.0 0.00 3.67
3001 4322 3.355203 AATTGATTGCGCGGGTGCC 62.355 57.895 8.83 0.0 38.08 5.01
3007 4328 0.383491 CTAGCCGAATTGATTGCGCG 60.383 55.000 0.00 0.0 0.00 6.86
3036 4357 4.989279 AATGCAATCTAATCAAACGGCT 57.011 36.364 0.00 0.0 0.00 5.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.